Cumulative evidence has shown the unique properties of

Transcription

1 GASTROENTEROLOGY 2006;131: Activation of Mouse Natural Killer T Cells Accelerates Liver Regeneration After Partial Hepatectomy HIROYUKI NAKASHIMA,* TAKUO INUI,* YOSHIKO HABU,* MANABU KINOSHITA, SHIGEAKI NAGAO, ATSUSHI KAWAGUCHI, SOICHIRO MIURA, NARIYOSHI SHINOMIYA,* HIDEO YAGITA, and SHUHJI SEKI* *Department of Immunology and Microbiology, National Defense Medical College, Tokorozawa, Japan; Division of Basic Traumatology, National Defense Medical College Research Institute, Tokorozawa, Japan; Second Department of Internal Medicine, National Defense Medical College, Tokorozawa, Japan; and the Department of Immunology, Juntendo University School of Medicine, Hongo, Bunkyo-ku, Tokyo, Japan Background & Aims: Activation of natural killer T cells with the synthetic ligand -galactosylceramide ( -GalCer) induced hepatotoxicity through the tumor necrosis factor (TNF) and Fas-ligand mediated pathway in aged mice. The aim of this study was to elucidate how -GalCer activated natural killer T cells function in hepatocyte proliferation and liver regeneration in partially hepatectomized (PHx) mice. Methods: Mice were injected with -GalCer at 36 hours after 70% PHx. Hepatocyte mitosis was evaluated by either mitotic figures or proliferating cell nuclear antigen staining. The role of TNF and Fas-ligand in hepatocyte mitosis also was assessed. Results: In PHx mice injected with -GalCer, hepatocyte mitosis was greatly enhanced at 44 hours after surgery and the increase was more obvious in aged mice than in young mice. The expression of both TNF receptor 1 and Fas-ligand in liver natural killer T cells tended to increase after -GalCer injection in PHx mice. Treatment of mice with anti-nk1.1 Ab 3 days before and just after hepatectomy greatly inhibited the effect of -GalCer on hepatocyte mitosis and liver regeneration. Furthermore, pretreatment of PHx mice with either anti-tnf Ab or anti-fasl Ab 1 hour before -GalCer injection mostly abrogated the increase in hepatocyte proliferation. -GalCer injection did not accelerate hepatocyte proliferation in Fas-mutated lpr mice after PHx. CD1d-/- mice without -GalCer injection showed decreased hepatocyte mitosis after PHx. Conclusions: Activated natural killer T cells help hepatocyte proliferation and liver regeneration after PHx via the TNF and Fas/Fas-ligand mediated pathway. Cumulative evidence has shown the unique properties of mouse natural killer T (NKT) cells. These cells are dependent on a nonclassic major histocompatibility complex class I like molecule, CD1d, for their development; they use an invariant V 14/J 281/V 8 gene product for their T-cell receptors (TCRs) 1 4 ; and they are abundant in the liver. 5 7 These cells, when activated by either endogenous or exogenous interleukin-12, produce interferon (IFN)- and acquire potent antitumor cytotoxicity: they inhibit tumor metastasis in the liver, lung, and kidney. 5,8 10 -galactosylceramide ( -GalCer), a recently found synthetic ligand of NKT cells, 11,12 has further advanced the functional analysis of these cells. NKT cells activated by -GalCer promptly produce both IFN- and interleukin-4, 12 suggesting that NKT cells may be involved in either T-helper 1 response or T-helper 2 response. Because NKT cells preactivated by interleukin-12 greatly increase both IFN- and IL-4 production after -GalCer stimulation, they may produce these 2 cytokines to enhance cellular immunity and humoral immunity, respectively, against microbes. 13 In addition, NKT cells reportedly produce tumor necrosis factor (TNF) after -GalCer stimulation, 14,15 which is a critical cytokine for the host defense against infections. 16,17 The IFN- produced by -GalCer stimulated NKT cells activates NK cells, and NK cells inhibit liver metastases of tumors in an IFN- dependent manner, whereas activated NKT cells themselves induce hepatocyte injury via the TNF and Fas-ligand (FasL)-mediated pathways The role of NKT cells in autoimmune diseases remains controversial; NKT cells activated by -GalCer reportedly inhibit autoimmune diabetes in nonobese diabetic mice, but they also aggravate diseases in other autoimmune mouse models. 4,21,22 Based on these findings, NKT cells could be a double-edged sword; their function and the effects of their activation thus should be examined carefully. 19 Of interest, the -GalCer mediated functions of NKT cells are enhanced in mice in an age-dependent manner 19 ; the proliferation, cytokine production, antitumor cytotoxicity, and hepatotoxicity of liver mononuclear cells (MNCs) mediated or triggered by -GalCer activated liver NKT cells became higher as mice aged. Although hepatocyte injury was induced by -GalCer activated NKT cells through TNF and FasL in aged mice, recent reports also have indicated that either TNF or an agonistic anti-fas antibody (Ab) increased the hepatocyte proliferation in regenerating liver after partial hepatectomy (PHx) These molecules thus can be cytotoxic against steady-state hepatocytes yet also augment proliferation of newly regenerating hepatocytes, suggesting that TNF and FasL function differently against hepatocytes depending on the condition of the cells. On the other hand, the number of NKT cells and NK-T cells (CD56 T cells) in the livers of mice and human beings, respectively, decreases with the progress of hepatitis and their preponderance is finally lost in the liver with cirrhosis, 28,29 suggesting that intact hepatocytes are necessary for the maintenance of hepatic NKT cells. In addition, liver NKT cells greatly increased in number and proportion in the early phase Abbreviations used in this paper: Ab, antibody; -GalCer, -galactosylceramide; FasL, Fas-ligand; IFN, interferon; MNC, mononuclear cell; NKT, natural killer T; PCNA, proliferating cell nuclear antigen; PCR, polymerase chain reaction; PHx, partial hepatectomy or partially hepatectomized; SE, standard error; TCR, T-cell receptor; TNF, tumor necrosis factor; TNFR1, tumor necrosis factor receptor by the AGA Institute /06/$32.00 doi: /j.gastro

2 1574 NAKASHIMA ET AL GASTROENTEROLOGY Vol. 131, No. 5 Figure 1. Serum ALT levels and liver histopathology in PHx and sham-operated mice after -GalCer injection. Young (7-week-old) and aged (50-week-old) mice were subjected to PHx or sham operation, and -GalCer or vehicle was injected (IV) 48 hours after surgery. Sera were obtained from the retro-orbital sinus of (A) young and (B) aged mice at the indicated hours after -GalCer or vehicle injection. Data are means SE from 5 mice in each group. *P.05., Sham -GalCer;, PHx -GalCer; , PHx vehicle. (C) The liver of a sham-operated aged mouse injected with -GalCer shown at low (100 ) magnification. (D) The liver of a PHx aged mouse injected with -GalCer shown at low (100 ) magnification. Twenty-four hours after -GalCer injection, livers were obtained from sham-operated and PHx mice and fixed in 10% formalin. Shown are representative microscopic findings from among 4 mice in each group having similar findings (H&E staining). after PHx. 30 These findings led us to hypothesize that NKT cells and hepatocytes mutually interact, and NKT cells may in turn positively participate in the growth/proliferation of hepatocytes in regenerating liver. In the present study we show that -GalCer injection into PHx mice does not induce a significant hepatic injury, but instead accelerates hepatocyte proliferation and liver regeneration through the TNF and FasL-mediated pathway, and we discuss the roles of NKT cells and NK cells in the homeostasis of hepatocytes. Materials and Methods This study was conducted in accordance with the guidelines of the Institutional Review Board for the Care of Animal Subjects at the National Defense Medical College, Japan. Mice C57BL/6 (B6) mice were obtained from Japan SLC Inc. (Shizuoka, Japan) and were maintained until 50 or 75 weeks of age at our institution. MRL lpr/lpr (lpr) mice, MRL /, B6 bg/bg (bg) mice, and BALB/c mice were obtained from Japan SLC Inc. and used at 7 weeks of age. CD1d-/- mice with a BALB/c background 31 were purchased from The Jackson Laboratory (Bar Harbor, ME) and used at 7 weeks of age. Reagents -GalCer (KRN7000) was provided by the Pharmaceutical Research Laboratory of Kirin Brewery Company (Tokyo, Japan). 11,32 The mice were injected intravenously (IV) with 100 g/kg body weight of -GalCer or with vehicle. Oligonucleotide Primers and Polymerase Chain Reaction Analysis The sequences of oligonucleotide primers for reverse-transcription polymerase chain reaction (PCR) analysis were as follows. For mouse TNF receptor 1 (TNFR1), 33 the antisense primer (CAAGATAACCAGGGGCAACAG) and the sense primer (CCAACGCTACCTGAGTGAGA) were used; for mouse glyceraldehyde-3-phosphate dehydrogenase, 13 antisense (GTCCAGGGTT- TCTTACTCCT) and sense (ATGACCACAGTCCATGCCAT); and for mouse FasL, 34 antisense (TGGGCCACACTCCTCGGCTC) and sense (TGG TGGCTCTGGTTGGAATGGG) were used. For quantification, the band intensity was analyzed using the National Institutes of Health (Bethesda, MD) image software package (version 1.60). An aliquot of extract containing total RNA from liver NKT cells (RNeasy Mini Kit [250]; Qiagen, Hilden, Germany) was used for the reverse-transcriptase reaction. Next, the complementary DNA of each sample was amplified by PCR. The PCR products were subjected to electrophoresis in a 2.4% agarose gel and then were stained with ethidium bromide. PCR bands were quantitated based on the ratio of the signal intensity of the PCR products to those of the internal controls (glyceraldehyde-3-phosphate dehydrogenase). The linearity of a reverse-transcription PCR analysis was confirmed in advance, and an estimation of each band was performed within a linear range.

3 November 2006 NATURAL KILLER T CELLS AND LIVER REGENERATION 1575 Flow Cytometric Analysis and Sorting of NKT Cells For an analysis of the FasL expression, liver MNCs were isolated 1 hour after the injection of -GalCer or vehicle. Next, as previously described, 19 the cells were stained with fluorescein isothiocyanate conjugated monoclonal Ab to TCR (H57-597; BD PharMingen, San Diego, CA), phycoerythine-conjugated monoclonal Ab to NK1.1 (PK136; BD PharMingen), and biotin-conjugated monoclonal Ab to FasL (MFL1; BD PharMingen), followed by Cy5-streptavidin. Flow cytometry was performed on an Epics XL (Coulter, Miami, FL). -GalCer loaded CD1d IgG1 dimer (CD1/ -GalCer dimer) was used as described in the technical data sheet (BD PharMingen). 37 For sorting NKT cells, isolated liver MNCs from PHx mice were stained with phycoerythine-nk1.1 Ab and fluorescein isothiocyanate-tcr, and NKT cells were purified using an Epics Altra (Coulter). Measurement of Alanine Aminotransferase The peripheral blood of individual mice was collected from the retro-orbital sinus at the indicated time points after -GalCer injection. The levels of serum alanine aminotransferase (ALT) were determined using a DRICHEM 3000V instrument (Fuji Medical Systems, Tokyo, Japan). Neutralization of TNF or FasL, and Depletion of NK Cells or Both NK Cells and NKT Cells Mice were injected via IV with anti-tnf Ab (.5 mg/ mouse) (MP6-XT3; BD PharMingen), anti-fasl Ab (.5 mg/ mouse) (MFL4), 38 or PBS 1 hour before IV injection of -GalCer or vehicle. To deplete NK cells, anti-asialogm1 Ab (50 g) was injected into mice 3 days before PHx and just after PHx. To deplete both NK cells and NKT cells, anti-nk1.1 Ab (200 g) was injected into mice 3 days before PHx and just after PHx. Figure 2. Reverse-transcription PCR analysis of the TNFR1 and FasL mrna expression in liver NKT cells. TNFR1 and FasL expression of liver NKT cells from either young (7 weeks) or aged (50 weeks) mice subjected to sham operation or PHx. (A) At 1 hour after injection of either -GalCer or vehicle, liver MNCs were obtained from mice in each group. NKT cells were purified using a cell sorter after staining with NK1.1 Ab and TCR Ab, and total RNA was extracted. (B) PCR bands of TNFR1 and FasL were quantitated based on the ratio of the signal intensity of the PCR products to those of the internal controls (glyceraldehyde-3- phosphate dehydrogenase), as described in the Materials and Methods section. Data are means SE from 4 independent experiments. P.05. PHx The mice underwent 70% PHx under deep ether anesthesia by a resection of the anterior and left lateral lobes of the liver according to the method of Higgins and Anderson. 35 Before surgical close of the peritoneal space, about 300 L of phosphate-buffered saline (PBS) or antibody aliquots were administered into the peritoneal space. Control mice were subjected to a sham operation and received PBS. Isolation of Mononuclear Cells Hepatic MNCs were prepared essentially as described previously. 36 Histologic Assessment The PHx mice treated with respective antibodies were injected with -GalCer and killed 8 hours after -GalCer injection and the remnant liver was removed under deep ether anesthesia. The resected specimens were fixed in 10% formalin and were stored at 4 C and embedded in paraffin. Sections were stained with H&E for histologic examination. The numbers of mitotic figures and the total number of hepatocytes in the field were counted in 20 fields at 400 on each slide. Hepatocyte mitosis is expressed as the number of mitotic figures per 2000 hepatocytes. For immunohistochemical demonstration of the proliferating cell nuclear antigen (PCNA), a paraffin-embedded specimen was cut into 5.0- m sections. Rabbit polyclonal anti- PCNA (FL-261) Ab (Santa Cruz Biotechnology, Santa Cruz, CA) was used as the primary Ab, followed by the rabbit ABC staining system (Santa Cruz Biotechnology). 39 PCNA-positive cells were counted by light microscopy at 100 and expressed as the number of positive cells per 1000 hepatocytes. Statistical Analysis In each experiment, the results are expressed as the mean standard error (SE). Where appropriate, the Student t test was used to compare the data of 2 different groups. P values less than.05 were considered significant. Results -GalCer Did Not Induce Severe Hepatic Injury After PHx Two days after PHx or sham operation, IV administration of -GalCer induced ALT increase only in sham-operated mice. As we previously reported for nonoperated mice, 19 the hepatotoxicity induced by -GalCer was more profound in aged

4 1576 NAKASHIMA ET AL GASTROENTEROLOGY Vol. 131, No. 5 Figure 3. Surface FasL expression of liver NKT cells. At 1 hour after the -GalCer or vehicle treatment, liver MNCs of young and aged PHx or sham mice (75 weeks of age) were isolated and subjected to flow cytometric analysis. FasL expression on gated CD1/ -GalCer NK1.1 NKT cells was shown. Anti-TNF Ab was injected 12 hours before -GalCer injection. The data are representative of 4 independent experiments with similar results. The percentages of FasL expression of old PHX mice with or without TNF Ab are means SE from 4 mice. *P.05, PHx group vs PHx TNF Ab group. mice than in young mice when both had the sham operation (Figure 1A, B). Surprisingly, however, in PHx mice, the hepatotoxicity was greatly reduced even in aged mice (Figure 1A, B). Increased ALT levels in PHx mice after -GalCer injection relative to that of PHx mice after vehicle injection suggests the injury of nonproliferating quiescent hepatocytes (Figure 1A, B). In histologic examination of the aged mice, sham-operated mice showed massive necrotic areas in the liver parenchyma (Figure 1C); however, such necrotic areas rarely were found in PHx mice (Figure 1D). These findings suggest that young hepatocytes after mitosis and those undergoing mitosis in aged mice are resistant to the FasL-mediated hepatic injury. -GalCer Induced TNFR1 and FasL Expression in Liver NKT Cells of PHx Mice Because TNFR1 and FasL messenger RNAs (mrnas) are confined mainly to NKT cells after -GalCer injection in nonoperated mice, 19,20 we examined their expression in liver NKT cells. Because hepatocyte mitosis is most prominent at hours after PHx, 40 -GalCer or vehicle was administered 40 hours after PHx; the remnant liver was resected 1 hour after -GalCer administration and MNCs were obtained; then NKT cells were isolated by sorting. TNFR1 and FasL mrnas in NKT cells were expressed more prominently in liver MNCs of old mice than in young mice with or without PHx (Figure 2), and mrnas tended to increase by -GalCer injection (Figure 2). Liver MNCs other than NKT cells showed much lower TNFR1 and FasL mrna levels than NKT cells (data not shown). Because FasL expression of NKT cells increased age-dependently, 19 we used 75-week-old mice for flow cytometric analysis of FasL. In PHx mice, FasL-expressing CD1/ -GalCer dimer NKT cells were induced almost comparably in aged mice 1 hour after -GalCer or vehicle administration, but the surface FasL intensity tended to increase with -GalCer administration (Figure 3). Anti-TNF Ab pretreatment (12 hours before -GalCer injection) significantly decreased FasL expression of NKT cells in PHx mice injected with either -GalCer or vehicle (Figure 3, rightsided panels). Similarly to the case of NK1.1 Ag expressing NKT cells, 13 CD1/ -GalCer NKT cells started to decrease proportionally at 2 hours after -GalCer administration (data not shown), which probably is associated with internalization of TCRs from the surface of NKT cells after -GalCer injection. 41,42 Most NK cells and conventional T cells with high TCRs did not express FasL at 1 hour after -GalCer or vehicle administration and thereafter until 48 hours after injection (data not shown). Enhancement of Hepatocyte Mitosis and Liver Regeneration by -GalCer After PHx To investigate whether -GalCer activation of NKT cells could accelerate the proliferation of hepatocytes, we compared the frequencies of mitotic hepatocytes by histologic examination. Considering the beginning of the hepatocyte proliferation and mitosis period, -GalCer was administered 36 hours after surgery and the number of mitotic figures in hepatocytes was counted 8 hours later. The number of mitotic

5 November 2006 NATURAL KILLER T CELLS AND LIVER REGENERATION 1577 were depleted using anti-nk1.1 Ab. The anti-nk1.1 Ab was injected into mice 3 days before (IV) and then just after the PHx (intraperitoneally). -GalCer was administered 36 hours after PHx. Hepatocyte proliferation was evaluated by counting either mitotic figures (Figure 5A) or PCNA-positive hepatocytes (Figure 5B) 44 hours after PHx (8 hours after -GalCer injection). The increased proliferation of hepatocytes after -GalCer injection was diminished significantly in mice pretreated with anti- NK1.1 Ab (Figures 5A-B, 6, and 7). We also examined hepatocyte proliferation in mice depleted of NK cells alone by using anti-asialo GM1 Ab, and we found that mice lacking NK cells tended to increase hepatocyte mitosis after -GalCer injection (data not shown). These findings suggest that NKT cells play a critical role in the enhanced proliferation of hepatocytes caused by -GalCer in PHx mice. Consistently, 4 days after surgery, the liver weight of -GalCer injected mice was greater than that of control mice, whereas the depletion of NKT cells diminished the effect of -GalCer (Figure 5C). When anti-tnf Ab or anti-fasl Ab was administered to PHx mice at 1 hour before the -GalCer administration, either Ab mostly abrogated the enhanced hepatocyte proliferation (Figures 5A-B, 6, and 7). Anti-FasL Ab significantly decreased the remnant liver weight increase by the -GalCer injection. These results suggest that activated NKT cells could accelerate hepatocyte proliferation through FasL and TNF. Figure 4. Augmentation of hepatocyte mitosis after -GalCer injection in PHx mice. (A) The livers were obtained from young (7 weeks) and old mice (50 weeks) at 8 hours after -GalCer or vehicle injection (44 hours after PHx) and stained with H&E to examine the hepatocyte mitotic figures per 2000 hepatocytes. Data are means SE from 5 mice in each group. (B) Time schedule of the examination of hepatocyte mitosis. (C) Mitotic figures and (D) PCNA-positive cells in hepatocytes from aged mice were counted at 2 days (44 h), 4, 6, and 8 days after PHx. Data are means SE from 5 to 10 mice in each group. *P.05, **P.01. figures markedly increased after -GalCer administration, especially in aged (50 wk) mice (Figure 4A). An -GalCer administration at either 24 or 48 hours after PHx was less effective in increasing hepatocyte mitosis (data not shown). The numbers of mitotic figures and PCNA-positive hepatocytes were examined further in aged mice on days 2 (44 h), 4, 6, and 8 after PHx (Figure 4B). Enhancement of hepatocyte mitosis was most evident 8 hours after -GalCer administration (2 days [44 h] after PHx), whereas the degrees of hepatocyte mitosis thereafter decreased and did not significantly differ between PHx mice with or without -GalCer administration (Figure 4C, D). We also examined the effect of a moderate dose of concanavalin A (.25 mg) on hepatocyte mitosis after PHx. Although PHx mice showed much lower ALT levels than sham mice, concanavalin A did not increase mitotic figures in PHx mice (data not shown). Involvement of NKT Cells, TNF, and FasL in Enhanced Hepatocyte Mitosis by -GalCer Administration in PHx Mice First, to substantiate the role of NKT cells in hepatocyte proliferation after -GalCer injection, NKT cells and NK cells Analysis of PHx lpr Mice After -GalCer Administration, and the Role of TNF, FasL, NK Cells, and NKT Cells in Homeostatic Hepatocyte Proliferation After PHx Although hepatocyte proliferation was not impaired in Fas-mutated lpr mice as compared with that in / mice (Figure 8A), -GalCer administration did not accelerate hepatocyte mitosis after PHx in lpr mice (Figure 8A). In line with the results from lpr mice, injection of either anti-tnf Ab or anti- FasL Ab alone into mice at 1 hour before PHx without subsequent -GalCer injection did not affect mitotic figures significantly (Figure 8B). However, the injection of both Abs into mice 1 hour before PHx without subsequent -GalCer treatment significantly inhibited hepatocyte proliferation (Figure 8B). These results suggest that blockade of both TNF and FasL (but not the blockade of each molecule alone) before starting hepatocyte mitosis inhibits hepatocyte proliferation after PHx. Next, we examined the effect of depletion of NK cells (using antiasialogm1 Ab) or depletion of both NK cells and NKT cells (using anti-nk1.1 Ab) on homeostatic hepatocyte proliferation after PHx. Depletion of NK cells greatly increased hepatocyte proliferation, whereas depletion of both NK cells and NKT cells did not affect the number of mitotic figures significantly (Figure 8C). NKT cell deficient CD1d-/- mice showed a significantly decreased hepatocyte proliferation after PHx relative to BALB/c mice (Figure 8D). However, NK-deficient B6 bg/bg (bg) mice, which have NK cells that are severely impaired functionally, strongly showed increased hepatocyte proliferation after PHx (Figure 8E). Furthermore, depletion of NKT cells by anti- NK1.1 Ab greatly decreased hepatocyte proliferation (Figure 8E). These findings suggest that NKT cells accelerate homeostatic hepatocyte proliferation after PHx, whereas NK cells inhibit hepatocyte proliferation.

6 1578 NAKASHIMA ET AL GASTROENTEROLOGY Vol. 131, No. 5 Figure 5. Inhibition of -GalCer induced hepatocyte proliferation and liver regeneration in PHx mice either by NK1.1 Ab, anti-tnf Ab, or anti-fasl Ab treatment. Aged (50 weeks) mice were injected twice with NK1.1 Ab (200 g) or PBS, at 3 days before PHx (IV) and just after PHx (intraperitoneally). PHx mice were injected with anti-tnf Ab or anti-fasl Ab (.5 mg) (PBS as a control) 1 hour before -GalCer injection. -GalCer or vehicle was injected into PHx mice 36 hours after PHx. (A) Mitotic figures and (B) PCNA-positive cells were counted at 44 hours after PHx, or 8 hours after -GalCer injection (n 5 10 in each mouse group). (C) Weights of remnant livers were measured at indicated days until 8 days after PHx (n 5 10 in each group). Data are pooled from 3 to 5 independent experiments with 1 to 2 mice per group. P.05. (C) Œ, Vehicle;, -GalCer;, NK1.1 -GalCer; Œ, TNF -GalCer;, FasL -GalCer. Discussion In the present study, we show that -GalCer injection into PHx mice accelerates hepatocyte mitosis and liver regeneration, especially in aged mice. Because depletion of both NK cells and NKT cells, but not depletion of NK cells alone, lessened the increase of -GalCer induced hepatocyte mitosis, NKT cells play a critical role in the enhanced hepatocyte mitosis and liver regeneration. Furthermore, either anti-tnf Ab or anti-fasl Ab inhibited the increase in hepatocyte mitosis after -GalCer injection in PHx B6 mice, and -GalCer injection did not accelerate hepatocyte mitosis in PHx lpr mice. These results indicate that the -GalCer activated NKT cells accelerated hepatocyte proliferation via the TNF and Fas/FasL-mediated pathway. Furthermore, experiments using NKT cell deficient CD1-/- mice and NK cell deficient bg mice after PHx (without -GalCer) suggest that NKT cells accelerate homeostatic hepatocyte proliferation but that NK cells negatively regulate hepatocyte proliferation. We recently reported that -GalCer stimulated NKT cells exerted hepatotoxicity via TNF and FasL in aged mice. 19 In marked contrast, -GalCer did not induce a severe hepatic injury in PHx mice but did accelerate the proliferation of hepatocytes, especially in aged mice. These findings suggest that activated NKT cells not only attack hepatocytes but also support their growth and proliferation (depending on the condition of hepatocytes) using the TNF and FasL-mediated pathway. We recently showed that TNF produced by lipopolysaccharide-activated Kupffer cells was hepatotoxic for steady-state hepatocytes, but it increased hepatocyte proliferation in the regenerating liver after PHx. 27 It also has been reported that -GalCer activated NKT cells induced the injury of regenerating hepatocytes as estimated by increased ALT levels 24 hours after PHx. 43 However, it has been reported by us and others 40,44,45 that hepatocyte mitosis is not observed at 24 hours after PHx; it begins about 32 hours after PHx and is most prominent hours after PHx. This is in contrast to the situation in the rat model, in which hepatocyte mitosis peaks 24 hours after PHx. 46 Accordingly, we adjusted the time point of -GalCer injection into mice to 36 hours after PHx, when the hepatocyte mitosis becomes prominent. Therefore, the ALT levels in mice at 24 hours after surgery might not reflect hepatotoxicity against regenerating hepatocytes. 43 In addition, in that experiment, -GalCer was injected into mice 5 days before PHx. 43 Therefore, the experimental system of that mouse study 43 was quite different from ours. Increased TNFR and FasL expression of NKT cells is the main mechanism of TNF-dependent hepatotoxicity after -Gal- Cer injection in aged normal mice, because both FasL expression and hepatotoxicity mostly were abolished by prior administration of anti-tnf Ab. 20 Recent studies have shown by

7 November 2006 NATURAL KILLER T CELLS AND LIVER REGENERATION 1579 Figure 6. Mitotic figures of hepatocytes in the livers of aged mice in each group. Mitotic figures are indicated by white arrowheads. intracellular staining that NKT cells may produce TNF after -GalCer injection. 14,15 These findings suggest that TNF produced and secreted by NKT cells and Kupffer cells activates NKT cells through their own TNFR and induce their FasL expression. In the present study, we have found that TNFR1 expression in liver MNCs was more profound in PHx mice than in sham-operated mice, and -GalCer administration further increased the expression of TNFR1. In addition, anti-tnf Ab partially but significantly decreased FasL expression from NKT cells in PHx mice. These results suggest that at 40 hours after PHx, when the hepatocyte mitosis is most active, NKT cells increase their sensitivity to TNF and express FasL. It was recently reported that the engagement of Fas antigen expressed on hepatocytes by an agonistic anti-fas Ab accelerated hepatocyte proliferation in PHx mice. 25,26 In sham-operated mice, Fas stimulation by anti-fas Ab increased hepatocyte apoptosis and caused fulminant hepatic failure, whereas in PHx mice, hepatic regeneration (rather than hepatic damage) was enhanced. 25,26 The involvement of Fas on hepatocytes and FasL on liver MNCs in liver regeneration also could explain why

8 1580 NAKASHIMA ET AL GASTROENTEROLOGY Vol. 131, No. 5 Figure 7. PCNA-positive hepatocytes in the livers of aged mice in each group. Fas-deficient lpr mice and FasL-deficient gld mice showed impaired liver regeneration after anti-fas Ab injection. 26 -GalCer activated NKT cells exert antitumor activity via the NK cell/ifn- /perforin pathway and hepatotoxicity via the TNF/FasL pathway because neutralization of TNF inhibited FasL expression in NKT cells and the hepatic injury is induced by -GalCer without affecting the antitumor effect These findings imply that NKT cells are a double-edged sword and they exert a harmful effect on the host through the TNF/FasL system. However, our present study indicates that NKT cells and the TNF/FasL system may function in a beneficial manner for the host. Although TNF is considered a villain in septic shock and organ failure, it also is essential for the host defense against infections 16,17,47 and for hepatocyte proliferation and liver regeneration after PHx. 23,48 Hepatocytes are newly generated in the portal area and senescent hepatocytes gradually move to the central vein area and undergo apoptosis after 200 days in rats. 49 NKT cells and the TNF/FasL/Fas system may normally regulate the turnover of hepatocytes. Whether TNF and/or FasL induces an apoptotic

9 November 2006 NATURAL KILLER T CELLS AND LIVER REGENERATION 1581 Figure 8. (A) The effect of -GalCer injection on hepatocyte mitosis after PHx in lpr mice. The livers were obtained from MRL / or lpr mice (7 weeks of age) at 8 hours after -GalCer or vehicle injection (44 hours after PHx) and were stained with H&E to examine the hepatocyte mitotic figures per 2000 hepatocytes. Data are means SE from 5 lpr mice and 3 / mice. (B) The effect of anti-tnf Ab and/or anti-fasl Ab pretreatment on hepatocyte mitosis in PHx B6 mice. B6 mice (n 3) (50 weeks of age) were treated with anti-tnf Ab, anti-fasl Ab, or both Abs (PBS as a control) 1 hour before PHx, and hepatocyte mitosis was examined at 44 hours after PHx without -GalCer injection. (C) The effect of the depletion of NK cells or of both NK and NKT cells on hepatocyte mitosis in PHx B6 mice. Mice (n 3) were injected with anti-asialogm1 Ab (50 g), anti-nk1.1 Ab (200 g), or PBS at 3 days before PHx (IV) and just after PHx (intraperitoneally). (D) NKT cell deficient CD1d-/- mice show decreased hepatocyte mitosis after PHx. CD1d-/- mice (n 5) and BALB/c mice (n 5) (7 weeks of age) were examined. (E) bg mice (7 weeks of age) show increased hepatocyte mitosis after PHx, and depletion of NKT and NK cells decreased hepatocyte mitosis. bg mice were injected twice with NK1.1 Ab (200 g) or PBS, at 3 days before PHx (IV) and just after PHx (intraperitoneally), B6 mice (7 weeks of age) also were injected with PBS. Four mice of each group were examined. *P.05, **P.01. or an anti-apoptotic signal in hepatocytes through their receptors may depend on the physiologic and pathologic conditions of the hepatocytes. 26,50 Indeed, an anti-apoptotic molecule was decreased in hepatocytes of control mice but not in hepatocytes of PHx mice after anti-fas Ab injection. 26 The age-dependent increase of FasL and TNFR expression in NKT cells may compensate for the depressed hepatocyte proliferation after diminished secretion of growth hormone in aged hosts. 45 Our present results also show that the absence of TNF or FasL/Fas alone did not significantly impair hepatocyte mitosis in PHx mice without -GalCer treatment, but depletion of both TNF and FasL did impair hepatocyte mitosis. Therefore, in the process of homeostatic hepatocyte proliferation after PHx, some other growth factors involved in hepatocyte mitosis may compensate for the lack of TNF or FasL. It has been reported that polyriboinosinic polyribocytidylic acid activated NK cells inhibited liver regeneration in PHx mice. 51 We also examined the effect of -GalCer on hepatocyte mitosis in mice depleted of NK cells and found that hepatocyte mitosis tended to increase in these mice. Furthermore, our experiments using CD1d-/- mice, NK-deficient bg mice, and NK cell depleted mice suggest that NKT cells also accelerate the homeostatic proliferation of hepatocytes after PHx but that NK cells are inhibitory. Finally, it should be noted that NK-T cells in human liver infected with hepatitis C virus gradually decrease as the hepatitis progresses, and the preponderance of NK-T cells in the liver disappears in patients with cirrhosis. 29 Mouse NKT cells also disappear in cirrhotic liver induced by CCl These findings indicate that intact hepatocytes are needed to maintain liver NKT cells. Taken together with the results in this study, it is fascinating to suggest that NKT cells and hepatocytes interact with and affect each other. References 1. Bendelac A. Positive selection of mouse NK1 T cells by CD1- expressing cortical thymocytes. J Exp Med 1995;182: Makino Y, Koseki H, Adachi Y, Akasaka T, Tsuchida K, Taniguchi M. Extrathymic differentiation of a T cell bearing invariant V alpha 14J alpha 281 TCR. Int Rev Immunol 1994;11:31 46.

10 1582 NAKASHIMA ET AL GASTROENTEROLOGY Vol. 131, No Lantz O, Bendelac A. An invariant T cell receptor alpha chain is used by a unique subset of major histocompatibility complex class I-specific CD4 and CD4-8- T cells in mice and humans. J Exp Med 1994;180: Van Kaer L. Alpha-galactosylceramide therapy for autoimmune diseases: prospects and obstacles. Nat Rev Immunol 2005;5: Hashimoto W, Takeda K, Anzai R, Ogasawara K, Sakihara H, Sugiura K, Seki S, Kumagai K. Cytotoxic NK1.1 Ag alpha beta T cells with intermediate TCR induced in the liver of mice by IL-12. J Immunol 1995;154: Tsukahara A, Seki S, Iiai T, Moroda T, Watanabe H, Suzuki S, Tada T, Hiraide H, Hatakeyama K, Abo T. Mouse liver T cells: their change with aging and in comparison with peripheral T cells. Hepatology 1997;26: Seki S, Habu Y, Kawamura T, Takeda K, Dobashi H, Ohkawa T, Hiraide H. The liver as a crucial organ in the first line of host defense: the roles of Kupffer cells, natural killer (NK) cells and NK1.1 Ag T cells in T helper 1 immune responses. Immunol Rev 2000;174: Seki S, Hashimoto W, Ogasawara K, Satoh M, Watanabe H, Habu Y, Hiraide H, Takeda K. Antimetastatic effect of NK1 T cells on experimental haematogenous tumour metastases in the liver and lungs of mice. Immunology 1997;92: Cui J, Shin T, Kawano T, Sato H, Kondo E, Toura I, Kaneko Y, Koseki H, Kanno M, Taniguchi M. Requirement for Valpha14 NKT cells in IL-12-mediated rejection of tumors. Science 1997;278: Takahashi M, Ogasawara K, Takeda K, Hashimoto W, Sakihara H, Kumagai K, Anzai R, Satoh M, Seki S. LPS induces NK1.1 alpha beta T cells with potent cytotoxicity in the liver of mice via production of IL-12 from Kupffer cells. J Immunol 1996;156: Kobayashi E, Motoki K, Uchida T, Fukushima H, Koezuka Y. KRN7000, a novel immunomodulator, and its antitumor activities. Oncol Res 1995;7: Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Motoki K, Ueno H, Nakagawa R, Sato H, Kondo E, Koseki H, Taniguchi M. CD1drestricted and TCR-mediated activation of V alpha14 NKT cells by glycosylceramides. Science 1997;278: Habu Y, Uchida T, Inui T, Nakashima H, Fukasawa M, Seki S. Enhancement of the synthetic ligand-mediated function of liver NK1.1Ag T cells in mice by interleukin-12 pretreatment. Immunology 2004;113: Minagawa M, Deng Q, Liu ZX, Tsukamoto H, Dennert G. Activated natural killer T cells induce liver injury by Fas and tumor necrosis factor-alpha during alcohol consumption. Gastroenterology 2004;126: Biburger M, Tiegs G. Alpha-galactosylceramide-induced liver injury in mice is mediated by TNF-alpha but independent of Kupffer cells. J Immunol 2005;175: Rothe J, Mackay F, Bluethmann H, Zinkernagel R, Lesslauer W. Phenotypic analysis of TNFR1-deficient mice and characterization of TNFR1-deficient fibroblasts in vitro. Circ Shock 1994;44: Muller M, Althaus R, Frohlich D, Frei K, Eugster HP. Reduced antilisterial activity of TNF-deficient bone marrow-derived macrophages is due to impaired superoxide production. Eur J Immunol 1999;29: Nakagawa R, Nagafune I, Tazunoki Y, Ehara H, Tomura H, Iijima R, Motoki K, Kamishohara M, Seki S. Mechanisms of the antimetastatic effect in the liver and of the hepatocyte injury induced by alpha-galactosylceramide in mice. J Immunol 2001;166: Inui T, Nakagawa R, Ohkura S, Habu Y, Koike Y, Motoki K, Kuranaga N, Fukasawa M, Shinomiya N, Seki S. Age-associated augmentation of the synthetic ligand-mediated function of mouse NK1.1 ag( ) T cells: their cytokine production and hepatotoxicity in vivo and in vitro. J Immunol 2002;169: Inui T, Nakashima H, Habu Y, Nakagawa R, Fukasawa M, Kinoshita M, Shinomiya N, Seki S. Neutralization of tumor necrosis factor abrogates hepatic failure induced by alpha-galactosylceramide without attenuating its antitumor effect in aged mice. J Hepatol 2005;43: Morshed SR, Mannoor K, Halder RC, Kawamura H, Bannai M, Sekikawa H, Watanabe H, Abo T. Tissue-specific expansion of NKT and CD5 B cells at the onset of autoimmune disease in (NZBxNZW)F1 mice. Eur J Immunol 2002;32: Chiba A, Kaieda S, Oki S, Yamamura T, Miyake S. The involvement of V(alpha)14 natural killer T cells in the pathogenesis of arthritis in murine models. Arthritis Rheum 2005;52: Akerman P, Cote P, Yang SQ, McClain C, Nelson S, Bagby GJ, Diehl AM. Antibodies to tumor necrosis factor-alpha inhibit liver regeneration after partial hepatectomy. Am J Physiol 1992;263: G579 G Webber EM, Bruix J, Pierce RH, Fausto N. Tumor necrosis factor primes hepatocytes for DNA replication in the rat. Hepatology 1998;28: Takehara T, Hayashi N, Mita E, Kanto T, Tatsumi T, Sasaki Y, Kasahara A, Hori M. Delayed Fas-mediated hepatocyte apoptosis during liver regeneration in mice: hepatoprotective role of TNF alpha. Hepatology 1998;27: Desbarats J, Newell MK. Fas engagement accelerates liver regeneration after partial hepatectomy. Nat Med 2000;6: Kinoshita M, Uchida T, Nakashima H, Ono S, Seki S, Hiraide H. Opposite effects of enhanced tumor necrosis factor-alpha production from Kupffer cells by gadolinium chloride on liver injury/ mortality in endotoxemia of normal and partially hepatectomized mice. Shock 2005;23: Kawachi Y, Arai K, Moroda T, Kawamura T, Umezu H, Naito M, Ohtsuka K, Hasegawa K, Takahashi-Iwanaga H, Iwanaga T, et al. Supportive cellular elements for hepatic T cell differentiation: T cells expressing intermediate levels of the T cell receptor are cytotoxic against syngeneic hepatoma, and are lost after hepatocyte damage. Eur J Immunol 1995;25: Kawarabayashi N, Seki S, Hatsuse K, Ohkawa T, Koike Y, Aihara T, Habu Y, Nakagawa R, Ami K, Hiraide H, Mochizuki H. Decrease of CD56( )T cells and natural killer cells in cirrhotic livers with hepatitis C may be involved in their susceptibility to hepatocellular carcinoma. Hepatology 2000;32: Minagawa M, Oya H, Yamamoto S, Shimizu T, Bannai M, Kawamura H, Hatakeyama K, Abo T. Intensive expansion of natural killer T cells in the early phase of hepatocyte regeneration after partial hepatectomy in mice and its association with sympathetic nerve activation. Hepatology 2000;31: Smiley ST, Kaplan MH, Grusby MJ. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 1997;275: Morita M, Motoki K, Akimoto K, Natori T, Sakai T, Sawa E, Yamaji K, Koezuka Y, Kobayashi E, Fukushima H. Structure-activity relationship of alpha-galactosylceramides against B16-bearing mice. J Med Chem 1995;38: Walter U, Franzke A, Sarukhan A, Zober C, von Boehmer H, Buer J, Lechner O. Monitoring gene expression of TNFR family members by beta-cells during development of autoimmune diabetes. Eur J Immunol 2000;30: Medana I, Li Z, Flugel A, Tschopp J, Wekerle H, Neumann H. Fas ligand (CD95L) protects neurons against perforin-mediated T lymphocyte cytotoxicity. J Immunol 2001;167: Higgins GM, Anderson RM. Restoration of the liver of the white rat following partial surgical removal. Arch Pathol 1931;12:186.

11 November 2006 NATURAL KILLER T CELLS AND LIVER REGENERATION Ogasawara K, Takeda K, Hashimoto W, Satoh M, Okuyama R, Yanai N, Obinata M, Kumagai K, Takada H, Hiraide H, Seki S. Involvement of NK1 T cells and their IFN-gamma production in the generalized Shwartzman reaction. J Immunol 1998;160: Schumann J, Voyle RB, Wei BY, MacDonald HR. Cutting edge: influence of the TCR V beta domain on the avidity of CD1d:alphagalactosylceramide binding by invariant V alpha 14 NKT cells. J Immunol 2003;170: Kayagaki N, Yamaguchi N, Nagao F, Matsuo S, Maeda H, Okumura K, Yagita H. Polymorphism of murine Fas ligand that affects the biological activity. Proc Natl Acad Sci U S A 1997;94: Bravo R, Macdonald-Bravo H. Existence of two populations of cyclin/proliferating cell nuclear antigen during the cell cycle: association with DNA replication sites. J Cell Biol 1987;105: Inui T, Shinomiya N, Fukasawa M, Kobayashi M, Kuranaga N, Ohkura S, Seki S. Growth-related signaling regulates activation of telomerase in regenerating hepatocytes. Exp Cell Res 2002;273: Wilson MT, Johansson C, Olivares-Villagomez D, Singh AK, Stanic AK, Wang CR, Joyce S, Wick MJ, Van Kaer L. The response of natural killer T cells to glycolipid antigens is characterized by surface receptor down-modulation and expansion. Proc Natl Acad SciUSA2003;100: Crowe NY, Uldrich AP, Kyparissoudis K, Hammond KJ, Hayakawa Y, Sidobre S, Keating R, Kronenberg M, Smyth MJ, Godfrey DI. Glycolipid antigen drives rapid expansion and sustained cytokine production by NK T cells. J Immunol 2003;171: Ito H, Ando K, Nakayama T, Taniguchi M, Ezaki T, Saito K, Takemura M, Sekikawa K, Imawari M, Seishima M, Moriwaki H. Role of Valpha 14 NKT cells in the development of impaired liver regeneration in vivo. Hepatology 2003;38: Noguchi S, Ohba Y, Oka T. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in mice. J Endocrinol 1991;128: Krupczak-Hollis K, Wang X, Dennewitz MB, Costa RH. Growth hormone stimulates proliferation of old-aged regenerating liver through forkhead box m1b. Hepatology 2003;38: Michalopoulos GK, DeFrances MC. Liver regeneration. Science 1997;276: Bopst M, Garcia I, Guler R, Olleros ML, Rulicke T, Muller M, Wyss S, Frei K, Le Hir M, Eugster HP. Differential effects of TNF and LTalpha in the host defense against M. bovis BCG. Eur J Immunol 2001;31: Yamada Y, Kirillova I, Peschon JJ, Fausto N. Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc Natl Acad SciUSA1997;94: Zajicek G, Oren R, Weinreb M Jr. The streaming liver. Liver 1985;5: Yuan J. Transducing signals of life and death. Curr Opin Cell Biol 1997;9: Sun R, Gao B. Negative regulation of liver regeneration by innate immunity (natural killer cells/interferon-gamma). Gastroenterology 2004;127: Received December 6, Accepted July 28, Address requests for reprints to: Shuhji Seki, MD, Department of Immunology and Microbiology, National Defense Medical College, 3-2 Namiki, Tokorozawa , Japan. btraums@ndmc.ac.jp; fax: (81) Supported in part by a grant-in-aid for a Special Research Program (Host Stress Responses to Internal and External Factors) from the National Defense Medical College (N.S. and S.S.).