/02/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 87(6): Copyright 2002 by The Endocrine Society

Transcription

1 /02/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 87(6): Printed in U.S.A. Copyright 2002 by The Endocrine Society Germline Mutations of TSH Receptor Gene as Cause of Nonautoimmune Subclinical Hypothyroidism LUISELLA ALBERTI, MARIA CARLA PROVERBIO, SABINE COSTAGLIOLA, ROBERTO ROMOLI, BENEDETTA BOLDRIGHINI, MARIA CRISTINA VIGONE, GIOVANNA WEBER, GIUSEPPE CHIUMELLO, PAOLO BECK-PECCOZ, AND LUCA PERSANI Institute of Endocrine Sciences, University of Milan, Istituto Auxologico Italiano Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) (L.A., L.P.) and Ospedale Maggiore IRCCS (R.R., P.B.-P.), Milan, Italy; Department of Pediatrics (M.C.P., B.B., M.C.V., G.W., G.C.), Scientific Institute H.S. Raffaele, Milan, Italy; and Institut de Recherche Interdisciplinaire (S.C.), University of Brussels, B-1070 Brussels, Belgium Germline loss-of-function mutations of TSH receptor (TSHR) gene have been described in families with partial or complete TSH resistance. Large TSH elevations were generally found in the patients with homozygous or compound heterozygous mutations. In this study, we sequenced the entire TSHR gene in a series of 10 unrelated patients with slight ( mu/liter) to moderate (24 46 mu/liter) elevations of serum TSH, associated with definitely normal free thyroid hormone concentrations. Thyroid volume was normal in all patients, except two with a modest hypoplasia. Autoimmune thyroid disease was excluded in all patients on the basis of clinical and biochemical parameters. Eight patients had at least one firstdegree relative bearing the same biochemical picture. TSHR mutations were detected in 4 of 10 cases by analyzing DNA from peripheral leukocytes. A compound heterozygosity (P162A on maternal allele, and the novel mutation C600R on the paternal one) was found in the patient with the highest TSH levels. Only one TSHR allele was mutated in the remaining three cases, and no alterations in TSHR gene promoter were detected in all of these probands. A novel mutation (L467P) was detected on the maternal allele in one patient and Abbreviations: btsh, Bovine TSH; FT 3, free T 3 ;FT 4, free T 4 ; TM5, fifth transmembrane; TSHR, TSH receptor; WT, wild-type. in her monozygotic twin. Previously described inactive mutants, T655 and C41S, were detected in the other two cases. When tested on several occasions, circulating TSH values fluctuating above the upper limit of the normal range could be shown in heterozygous subjects of these families. A dominant mode of inheritance of the biochemical alterations was detected in these cases. Mutant TSHRs were studied during transient expression in COS7 and HEK293T cells. Their TSHindependent camp accumulation activities were very low or similar to mock-transfected cells, and no increases were seen after maximal hormone stimulation. Flow cytometry experiments showed a poor level of expression of all mutant TSHRs at the cell membrane. In conclusion, we found several lossof-function mutations of TSHR, including two novel ones, in a series of unrelated patients with slightly elevated TSH levels. Therefore, partial resistance to TSH action is a frequent finding among patients with slight hyperthyrotropinemia of nonautoimmune origin. Germline mutations of TSHR may be associated with serum TSH values fluctuating above the upper limit of the normal range, also in the heterozygous state. (J Clin Endocrinol Metab 87: , 2002) GERMLINE LOSS-OF-FUNCTION MUTATIONS of TSH receptor (TSHR) gene have been described in the case of partial or complete TSH resistance (1 12). This condition encompasses a wide spectrum of biochemical, as well as clinical and morphological alterations depending on the degree of impairment of TSHR function. Accordingly, patients with complete or severe refractoriness to TSH action have profound thyroid gland hypoplasia and low thyroid hormone levels, despite large elevations of circulating TSH levels (6 10). On the other hand, in partial resistance the elevated concentrations of serum TSH allow an almost normal thyroid gland development (small/normal thyroid size) and the production of normal free thyroid hormone circulating levels (3 5, 11, 12). TSH resistance due to loss-of-function mutations of TSHR has been described so far in a dozen families (1 12). All of the probands had moderate to large elevations of circulating TSH in the absence of antithyroid autoantibodies, and they were found to harbor compound heterozygous or homozygous TSHR mutations. Interestingly, the relatives with heterozygous TSHR mutations have seldom been reported with slight elevations of serum TSH concentrations (3, 11, 12), suggesting the possibility to investigate TSHR gene among patients with borderline biochemical alteration such as that typically found in subclinical hypothyroidism. Subclinical hypothyroidism identifies a condition biochemically characterized by the association of normal free thyroid hormone levels and slight hyperthyrotropinemia (13). It represents the most frequent alteration of thyroid function and is often due to autoimmune disease (14). In these cases, subclinical hypothyroidism is considered a transitory condition in the evolution of autoimmune disease toward clinically overt hypothyroidism (13). Nevertheless, the origin of slight TSH elevations remains obscure in a subset of these patients, in particular among those not evolving in overt disease. In the present study, we examined TSHR gene in a series of unrelated patients with slight to moderate elevations of circulating TSH and normal free thyroid hormone levels, in whom the diagnosis of autoimmune thyroid disease had been excluded, to evaluate the involvement of germline lossof-function mutations of TSHR in the pathogenesis of slight hyperthyrotropinemia. 2549

2 2550 J Clin Endocrinol Metab, June 2002, 87(6): Alberti et al. TSHR in Nonautoimmune Hyperthyrotropinemia Patients Patients and Methods We studied 10 subjects with neonatal to juvenile evidence of hyperthyrotropinemia (Table 1). Results of neonatal TSH screening on dry blood spot were above the normal range in three of five cases. All subjects were originating from distinct families. Patient HF has a monozygotic twin sister with an identical biochemical picture (Table 2). Free thyroid hormones (FT 4 and FT 3 ) were clearly within the normal range in all cases. The presence of autoimmune thyroid disease was excluded on the basis of the absence of antithyroperoxidase, anti-tg, and anti-tshr autoantibodies and confirmed by the absence of hypoechoic lesions at thyroid ultrasound (15). In all cases, parathyroid function was normal, and TSH response to TRH iv injection (200 g in adults or 7.0 g/kg body weight in infants) was exaggerated. Serial dilutions of TSH immunoreactivity (1:2.5, 1:5, and 1:10) were performed in most cases (PG, LC, FD, FV, BL, and HF, including several relatives of the last two cases) and were always parallel to the standard curve (data not shown). Circulating TSH was also immunoextracted from sera of patients BL and HF, and the biological activity of immunopurified material was tested in a homologous bioassay, as previously described (16). The biological/ immunological activities ratio of immunopurified TSH was normal ( and in cases BL and HF, respectively; normal values, ). Thyroid ultrasound revealed the presence of normal thyroid volume and structure in eight cases; only modest hypoplasia was seen in the cases with the highest TSH concentrations. Scintiscan did not reveal any thyroid ectopy. Slight impairment of 99m Tc uptake was reported in only one case (HF). Eight patients had at least one first-degree relative with slightly elevated TSH (Tables 1 and 2). Informed consent to the study was obtained from all subjects. Biochemical determinations Serum TSH concentrations were measured by commercial immunometric assay using Delfia technology (Wallac, Inc., Turku, Finland), with a sensitivity of 0.01 mu/liter, and inter- or intra-assay coefficient of variation less than 5%. Serum concentrations of free thyroid hormones were measured by commercial back-titration fluoroimmunoassay (Delfia, Wallac, Inc.). Antithyroperoxidase, anti-tg, and anti-tshr autoantibodies were evaluated by commercial kits (Brahms Diagnostica, Berlin, Germany). DNA analyses DNA was extracted from peripheral blood using a commercial kit (Nucleon BACC2, Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK) according to the manufacturer s instructions. The whole length of exon 10 was sequenced using 5 overlapping fragments amplified by PCR as previously described (17), and the fragments containing exons 1 to 9 and the promoter region were obtained using specific primers (18, 19). All purified PCR fragments were directly sequenced with either forward or reverse primers using the Big Dye Terminator kit and resolved by capillary electrophoresis on ABI 310 Automated Sequencer (PE Biosystems, Foster City, CA). The sequences of the mutated fragment were repeated at least twice from two different PCR products. Cloning and mutagenesis of TSHR cdna encoding the human TSHR was obtained by RT-PCR from a normal thyroid tissue using the following primers: 1F, 5 -GAGGATG- GAGAAATAGCCCCGAG-3 ; and 10R, 5 -GTGTCATGGGATTGGA- AT-3 (18); and it was cloned into the polylinker of the eukariotic expression vector ptarget (Promega Corp., Madison, WI). The wildtype (WT) insert was entirely sequenced. The substitutions observed in this study were introduced by sitedirected mutagenesis using the GeneEditor in vitro site-directed mutagenesis system (Promega Corp.) and the following primers, where bold indicates the introduced mutation: TTCAGAGTCACCTCCAAGGAT- ATTCAA (C41S), GGGATGTACCCGCTCCTCATCGC (L467P), GTCT- GCTGCCGTTATGTGAAG (C600R), AAGCCTCTCATCTGTTAGCA- ACTCC (T655 ). Full-length TSHR clones carrying the appropriate mutations were entirely sequenced. Cell culture and transient transfection COS7 cells and HEK293T cells were grown in DMEM (Life Technologies, Inc., Italia, San Giuliano Milanese, Italy) containing 10% FCS and an ampicillin-streptomycin mixture. For transient transfection, cells were seeded at the density of 300,000 cells per 3-cm dish in complete medium. After 24 h, cells were transfected; diethylaminoethyl-dextran method followed by a dimethylsulfoxide shock was used for COS7 cells (20), and calcium phosphate method was used for HEK293T cells (21). Cells were then grown in DMEM 10% FCS for 48 h before camp determinations or flow cytometry analysis. TABLE 1. Clinical and biochemical data of the 10 patients with nonautoimmune hyperthyrotropinemia Case Sex Age at diagnosis dbs TSH (mu/liter) [ 12.5] Serum TSH (mu/liter) [ ] FT 4 (pmol/ liter) [9 20] FT 3 (pmol/liter) [5 10] a [4 8] b Thyroid ultrasound Serum TSH levels in firstdegree relatives (mu/liter) HF F 5 yr n.a Normal Father, mother, twin sister, sister d PG F 6 months Normal Father (1.4), mother (7.4), sister (16.2) CE M 30 d Normal Father (n.a.), mother (8.7) LC F 23 d Normal Father (n.a.), mother, sister d FD M 30 d > Normal Father, mother, brother d BL M 25 yr pre Hypoplasia c Father, mother, brother d IS M 8 yr pre Normal Father (1.2), mother on L-T 4 FV M 25 d Normal Father (3.3), mother (11.0), sister (6.1), brother (26.7) BF F 68 d n.a Hypoplasia c Father (2.1), mother (1.7) PA M 7 yr n.a Normal Father (6.6), mother (2.3), brother (1.6), sister (10.3) Normal range values are reported between brackets. Serum TSH concentrations were evaluated in all available first-degree relatives of each proband. Only case BF was classified as sporadic, because the father of case LC was not available for the analysis. Antithyroid autoantibodies were negative in all these cases. Abnormal data and relatives with elevated circulating TSH are reported in bold. dbs, Dry blood spot; pre, born in prescreening period; n.a., not available. a Normal values in the first year of postnatal life. b Normal values after the first year of postnatal life. c Thyroid gland of small volume, but normal structure. d See Table 2 for detailed TSH values in these families.

3 Alberti et al. TSHR in Nonautoimmune Hyperthyrotropinemia J Clin Endocrinol Metab, June 2002, 87(6): TABLE 2. Families with TSHR mutations: serum concentrations of basal TSH and its peak values after TRH injection, as well as results of TSHR gene sequence, in all members Family TSHR gene Basal TSH (mu/liter) TSH peak after TRH (mu/liter) Net responses during TRH test (pmol/liter) FT 4 FT 3 Case BL Proband P162A/C600R Brother P162A/wt Mother P162A/wt Father C600R/wt Case HF Proband L467P/wt Twin sister L467P/wt Sister wt/wt 1.6 Mother L467P/wt on L-T 4 Father wt/wt 2.5 Case LC Proband T655 /wt Sister wt/wt 2.1 Mother wt/wt 1.7 Father Not available Not available Case FD Proband C41S/wt Brother wt/wt 3.6 Mother wt/wt 2.9 Father C41S/wt Normal values in females in males In some cases, TSH evaluations could be obtained on several occasions, note the variability of circulating TSH values. Net increments of FT 4 and FT 3 circulating levels after stimulation of endogenous TSH during TRH test (difference between peak values recorded at time 120 min after TRH injection and baseline values) were normal in three patients. Abnormal data are reported in bold. Flow cytometry analysis Flow cytometry experiments were performed using intact or permeabilized COS7 cells as previously described (22). For permeabilization, cells were kept on ice for 10 min in PBS-paraformaldehyde 2%, washed once with PBS-BSA 0.1%, and treated with 2% saponine at room temperature for 30 min. Both permeabilized and unpermeabilized cells were labeled with 3G4 monoclonal antibody recognizing a linear epitope and BA8 antibody against a conformational epitope. Both epitopes are located within TSHR ectodomain (22, 23). Determination of camp production COS7 or HEK293T transfected cells were washed with isotonic Krebs- Ringer-HEPES buffer (ph 7.4); 0.5 mm 3-isobutyl-1-methylxanthine, 0.5% BSA, and were incubated at 37 C, 5%CO 2 in this same buffer supplemented or not with increasing concentrations of bovine TSH (btsh; Sigma-Aldrich Corp. srl, Milan, Italy). The medium was removed after 1 h, and 0.1 N HCl was added. The samples were dried, and the camp concentration was measured by RIA (RIANEN, NEN Life Science Products Inc., Boston, MA). The results are expressed in picomoles per dish. Results Identification of mutations in the THSR gene The automated sequencing revealed the presence of the following substitutions. The case BL showed two missense mutations: one at the codon 162 in exon 6, P162A, previously described as inactivating mutation (3, 24), and a neverdescribed T to C substitution at the codon 600 in exon 10 (Fig. 1). This mutation causes the substitution cysteine to arginine in the fifth transmembrane (TM5) segment. Further studies of maternal and paternal TSHR genes identified the mother and the brother as heterozygous carriers of the P162A mutation and the father as carrier of the C600R mutation (Table 2). FIG. 1. Schematic representation of TSHR. The five mutations reported in this series of patients and their locations are illustrated. C41S and P162A are located in receptor ectodomain, whereas T655 causes the formation of a nonsense codon at 656 and the loss of TM7 and the intracellular tail of the receptor. The mutations L467P and C600R are novel, and they are located in TM2 and at the intracellular end of TM5, respectively. On the maternal allele of case HF and her monozygotic twin, we detected a not previously described T to C change at the codon 467 (exon 10) with the leucine to proline sub-

4 2552 J Clin Endocrinol Metab, June 2002, 87(6): Alberti et al. TSHR in Nonautoimmune Hyperthyrotropinemia stitution in the TM2 domain (Fig. 1). Heterozygous state of the mutation was documented also using the retrotranscribed material obtained from the RNA extract of circulating leukocytes from one of the twins. The results indicated the expression of both the maternal and the paternal alleles in leukocytes. The propositus LC showed a simple heterozygous twobase deletion (AC) at codon 655 (T655 ). This already described mutation (8) causes the formation of a premature stop codon at 656 and the production of a truncated protein lacking the last TM7 domain and the C-terminal tail (Fig. 1). The last well characterized (25) inactivating mutation was found in the TSHR extracellular domain of the propositus FD. It consists in agtocchange at codon 41 in exon 1 leading to a cysteine to serine substitution on the paternal allele (Fig. 1). In all of these cases, we could not detect other mutation in the coding sequence or in the intron-exon boundaries of the TSHR gene. The already known silent polymorphism at codon 52 (26) was detected in the heterozygous state in 2 of 10 cases (BL and IA). The TSHR promoter region was also sequenced without finding any alteration, except the polymorphic nucleotide at position 445 (G to T) (19) that was found in the heterozygous state in cases HF, BL, and FD. Biochemical evaluations in families with TSHR mutations Results of TSHR gene analysis, as well as basal TSH concentrations and peak TSH values after TRH injection in available members of the families with TSHR mutations are shown in Table 2. Several members of these families could be tested on several occasions. Circulating TSH values fluctuating above the upper limit of the normal range, as well as exaggerated TSH responses to TRH, are associated with the presence of TSHR mutations in these families. Serum concentrations of FT 4 and FT 3 increased normally in three patients after the stimulation of endogenous TSH during TRH test (Table 2). Patient BL, all affected members of case HF, as well as patient LC had been receiving l-t 4 treatment and normalized their TSH secretion ( mu/ liter) during standard replacement doses ( g/kg din adults, 3.4 in twins HF, and 7.7 in infant LC). Flow cytometry analysis The results of these analyses are illustrated in the two panels of Fig. 2. As demonstrated by the results obtained in permeabilized cells and shown in the lower part of each panel, all mutant and WT receptor proteins are translated to a similar level. Nevertheless, all mutants display a poor presence on the surface of intact cells: 20, 18, and 5% vs. WT for L467P-, C600R-, and T655 -TSHR, respectively, using BA8 antibody (Fig. 2A). These values were similar using 3G4 antibody: 27 and 14% vs. WT for L467P- and C600R-TSHR, respectively (Fig. 2B). The C41S-TSHR mutant is not present on the cell membrane (Fig. 2B). Determination of camp accumulation When overexpressed in COS-7 or in HEK293T cells, the construct carrying the WT-TSHR displays an increased camp production in the absence of agonist compared with that of vector alone. In contrast, TSHR-characteristic constitutive activity is dramatically reduced or completely lost in the presence of mutant receptor constructs (Fig. 3). Stimulation with increasing concentration of btsh of cells transiently transfected with WT-TSHR construct results in the well described dose-response curve reaching the plateau at 10 mu/ml btsh (Fig. 4), whereas all mutants display a strongly reduced ability to activate adenylyl cyclase in response to btsh (Fig. 5). Discussion We screened a series of 10 unrelated patients with slight to moderate serum TSH elevations of nonautoimmune origin for the possible involvement of germline mutations in TSHR gene. Direct sequencing of the entire coding sequence and all intron-exon boundaries led to the identification of five different mutations of TSHR gene in the constitutive DNA of 4 of 10 subjects. Three of these mutations had been previously reported as inactivating mutations in familial settings of TSH resistance (3, 4, 8, 12). Two novel substitutions (C600R and L467P) leading to the synthesis of TSHR inactive mutants are described in the present article. The patient (BL) with the highest TSH concentrations ( mu/liter) had the classic phenotype of partial TSH resistance in the presence of a compound heterozygosity of TSHR gene (P162A/C600R). Variable TSH levels with occasional elevations above the upper limit of the normal range were documented in his heterozygous relatives. Heterozygous mutations of TSHR gene were detected in the other three probands with slight hyperthyrotropinemia. Therefore, the most striking findings of this work are: 1) the frequent involvement of TSHR gene mutations in subjects with neonatal to juvenile evidence of nonautoimmune hyperthyrotropinemia, and 2) the slight and variable biochemical alteration in subjects heterozygous for inactivating mutations of TSHR gene. All of the mutations reported in this study are impairing TSHR functional activity. The mutation P162A was functionally tested in the original article of Sunthornthepvarakul et al. (3) and further characterized more recently (24). This mutant receptor retains 10% of the activity of WT TSHR. The mutation C41S was originally produced by experimental mutagenesis (25) and was later found to be harbored by one patient with partial TSH resistance (4). The AC deletion at codon 655, followed by the creation of a stop codon at position 656 (T655 -TSHR) was originally described in one case of complete TSH resistance (8). Due to the large C-terminal deletion, the functional activity of this mutant receptor had not been tested in vitro. We further studied the biological characteristics of these two latter mutant receptors and functionally characterized the two novel mutants, L467P and C600R. The basal constitutive activity of WT-TSHR is largely lost in the case of all mutants, because their ligand-independent activity is similar to (for C41S- and T655 -TSHR) or slightly above (for L467P- or C600R-TSHR) that observed in mock-transfected cells. In both in vitro systems, no camp increase was seen after stimulation with btsh 10 mu/ml. Molecular explanation for the complete refractoriness of cells transfected with all four TSHR mutants is given by the experiments of flow cytometry showing that C41S-TSHR and

5 Alberti et al. TSHR in Nonautoimmune Hyperthyrotropinemia J Clin Endocrinol Metab, June 2002, 87(6): FIG. 2. Flow cytometry analysis. A, Analysis with BA8 monoclonal antibody (mab), directed against a conformational epitope in the extracellular domain of TSHR (23), of intact or permeabilized COS7 cells transfected with either empty ptarget vector or WT-, L467P-, C600R-, or T655 -TSHR. B, Analysis with 3G4 mab, directed against a linear epitope in the extracellular domain of TSHR (23), of intact or permeabilized COS7 cells transfected with either empty ptarget vector or WT-, C41S-, L467P-, or C600R-TSHR. T655 -TSHR are very poorly, if not at all, expressed at the surface of intact cells, and the membrane targeting of C600R- TSHR and L467P-TSHR is severely impaired. If this result could be expected in the case of T655 (8), this same result in the case of C41S is more surprising, but consistent with the complete absence of ligand binding (25) and very recent studies demonstrating that C41 is a key residue for receptor expression (27). Substitution at C41 causes a severe alteration of TSHR folding, leading to the complete entrapment of mutant receptor in the intracellular compartments. C600 and L467 are located in TM5 and TM2, respectively. Previous studies have demonstrated the relevance of TM5 for signal transduction (28), and present results indicate that C600 is a relevant residue for correct folding of this domain and membrane targeting of the receptor. Substitution of T477 at the extracellular end of TM2 was reported to severely impair cell surface expression of the mutant receptor (10). A poor routing to the cell membrane was also seen in the case of L467P mutant, the introduction of this proline causing the breaking of TM2 -helix.

6 2554 J Clin Endocrinol Metab, June 2002, 87(6): Alberti et al. TSHR in Nonautoimmune Hyperthyrotropinemia FIG. 3. Basal camp accumulation in COS7 or HEK293T cells transiently transfected with WT- (n 7or4,respectively, for COS7 or HEK293T), C41S- (n 1 in both cell types), L467P- (n 4 in both), C600R- (n 4 in both), or T655 -TSHR (n 4 or 3). Each experiment was performed in triplicate wells. Results (mean SE) are expressed as percentage above basal camp accumulation in mock transfected cells. FIG. 4. Representative hormone-induced camp accumulation in COS7 cells transiently transfected with WT-TSHR (F) or empty vector (E) in presence of increasing concentrations of btsh. Several factors may have contributed to the high prevalence of TSHR mutations in this series. Subjects were indeed selected on the basis of young age and after careful exclusion of thyroid autoimmune disease. Moreover, familiarity for hyperthyrotropinemia was documented in 8 of 10 cases. Slight hyperthyrotropinemia was inherited in a dominant manner, and cosegregation with a single mutated TSHR allele was evident at least in families HF and FD. Furthermore, heterozygous relatives of case BL had borderline high TSH concentrations, as previously reported in other familial settings of TSH resistance (3, 11, 12). The lack of major deletions at TSHR gene locus involving one of the two alleles can be ruled out by the heterozygosity state of all reported substitutions. Moreover, expression of both maternal and paternal TSHR alleles was documented in family HF by taking advantage of illegitimate gene transcription in peripheral leukocytes. TSHR gene promoter was sequenced in the probands without finding any alteration except the previously described polymorphism at nucleotide 445 (19) in the heterozygous state in 3 of 4 cases. Involvement of parental imprinting can be excluded because the biochemical alteration in our probands was inherited from either the father (case FD) or the mother (case HF). Possible interference in TSH immunoassay, as well as alterations of TSH post-translational processing and bioactivity had been excluded. Therefore, molecular mechanisms underlying these surprising findings are presently unknown and could involve haploinsufficiency or dominant negative influence of mutant receptors on WT receptor functions. Interestingly, entrapment in intracellular compartments and poor routing to the cell membrane were documented by flow cytometry for all reported mutants. Further studies are needed to clarify whether intracellular routing of translated WT-TSHRs might also be affected in these conditions leading to an impaired cell surface expression. Whatever the mechanism involved, TSH fluctuations above the upper limit of the normal range do not appear to be age-dependent in these families, because normal TSH values were found in patient FD when he was 8 months old (TSH, 3.9 mu/liter) and in his father (2.2 mu/liter) at the age of 38 yr. It is conceivable that changes in endogenous or environmental factors, of an entity that may lead to only minimal modifications of TSH secretion in normal conditions, may instead cause larger TSH variations in subjects with TSHR defects. Several other mechanisms may be considered in the families with normal TSHR gene sequence. Because all the cases had similar phenotypes, these may include defects at different gene levels possibly leading to an impaired TSHR gene transcription or, more generally, to an impaired positive signaling in thyroid cells (19). TSHR gene has been defined as highly mutable (29), and gain-of-function mutations of TSHR represent the major cause of toxic nodular goiters (1, 17, 20, 22). Our data are consistent with the idea that inactivating mutations of TSHR can account for several cases of nonautoimmune subclinical hypothyroidism, in particular those arising in familial settings. Some of these cases can be detected at neonatal TSH screening and are therefore treated lifelong because hyperthyrotropinemia is not transitory. Nevertheless, serum TSH elevations were revealed beyond infancy in several subjects that were clinically euthyroid and in whom TSH testing was performed because they were first-degree relatives of an index case or for nonspecific reasons, such as abnormal weight gain. Although treatment is prudentially advocated at present, it is tempting to question whether l-t 4 may be required in these cases, because the elevation of circulating TSH would represent the compensatory mechanism allowing gland development and the maintenance of a normal thyroid hormone secretion in the presence of partial refractoriness to TSH action. Of note, hypothalamus and pituitary are responding adequately during l-t 4 replacement in these pa-

7 Alberti et al. TSHR in Nonautoimmune Hyperthyrotropinemia J Clin Endocrinol Metab, June 2002, 87(6): FIG. 5. Stimulation with 10 U/liter btsh of camp accumulation in COS7 or HEK293T cells transiently transfected with empty ptarget vector (n 7or3, respectively, in COS7 or HEK293T), or WT- (n 7 or 3), C41S- (n 2 in both cell types), L467P- (n 7 or 3), C600R (n 7 or 3), and T655 -TSHR constructs (n 5 or 3). Each experiment was performed in triplicate wells. Results (mean SE) are expressed as percentage above nonstimulated cells. tients. Further studies and longer follow-up of such patients are needed to give an evidence-based answer to this question. Acknowledgments We are indebted to Dr. G. Garofalo (V. Cervello Hospital, Palermo, Italy) for referring the case FV and to Mrs. E. Giammona for her skillful technical assistance. Received September 26, Accepted January 29, Address all correspondence and requests for reprints to: Luca Persani, M.D., Ph.D., Institute of Endocrine Sciences, University of Milan, Istituto di Ricovero e Cura a Carattere Scientifico Istituto Auxologico Italiano, Via Ariosto 13, Milan, Italy. luca.persani@unimi.it. This work was partially supported by Progetto di Ricerca Corrente Grants 05C632 and 05C901 of Istituto di Ricovero e Cura a Carattere Scientifico Istituto Auxologico Italiano, Milan, Italy; and Progetto Grant MM of Ministero dell Università e della Ricerca Scientifica e Tecnologica, Rome, Italy. References 1. Duprez L, Parma J, Van Sande J, Rodien P, Dumont JE, Vassart G, Abramowicz M 1998 TSH receptor mutations and thyroid disease. Trends Endocrinol Metab 9: Kopp P 1999 Resistance to TSH. In: Jameson JL, ed. Contemporary endocrinology: hormone resistance syndrome. Totowa, NJ: Humana Press Inc.; Sunthornthepvarakul T, Gottschalk ME, Hayashi Y, Refetoff S 1995 Resistance to thyrotropin caused by mutations in the thyrotropin-receptor gene. N Engl J Med 332: de Roux N, Misrahi M, Brauner R, Houang M, Carel JC, Granier M, Le Bouc Y, Ghinea N, Boumedienne A, Toublanc JE, Milgrom E 1996 Four families with loss of function mutations of the thyrotropin receptor. J Clin Endocrinol Metab 81: Clifton-Bligh RJ, Gregory JW, Ludgate M, John R, Persani L, Asteria C, Beck-Peccoz P, Chatterjee VK 1997 Two novel mutations in the thyrotropin (TSH) receptor gene in a child with resistance to TSH. J Clin Endocrinol Metab 82: Abramowicz MJ, Duprez L, Parma J, Vassart G, Heinrichs C 1997 Familial congenital hypothyroidism due to inactivating mutation of the thyrotropin receptor causing profound hypoplasia of the thyroid gland. J Clin Invest 99: Biebermann H, Schöneberg T, Krude H, Schultz G, Gudermann T, Grüters A 1997 Mutations of the human thyrotropin receptor gene causing thyroid hypoplasia and persistent congenital hypothyroidism. J Clin Endocrinol Metab 82: Gagné N, Parma J, Deal C, Vassart G, Van Vliet G 1998 Apparent congenital athyreosis contrasting with normal plasma thyroglobulin levels and associated with inactivating mutations in the thyrotropin receptor gene: are athyreosis and ectopic thyroid distinct entities? J Clin Endocrinol Metab 83: Tiosano D, Pannain S, Vassart G, Parma J, Gershoni-Baruch R, Mandel H, Lotan R, Zaharan Y, Pery M, Weiss RE, Refetoff S, Hochberg Z 1999 The hypothyroidism in an inbred kindred with congenital thyroid hormone and glucocorticoid deficiency is due to a mutation producing a truncated thyrotropin receptor. Thyroid 9: Tonacchera M, Agretti P, Pinchera A, Rosellini V, Perri A, Collecchi P, Vitti P, Chiovato L 2000 Congenital hypothyroidism with impaired thyroid response to thyrotropin (TSH) and absent circulating thyroglobulin: evidence for a new inactivating mutation of the TSH receptor gene. J Clin Endocrinol Metab 85: Russo D, Betterle C, Arturi F, Chiefari E, Girelli ME, Filetti S 2000 A novel mutation in the thyrotropin (TSH) receptor gene causing loss of TSH binding but constitutive receptor activation in a family with resistance to TSH. J Clin Endocrinol Metab 85: Tonacchera M, Agretti P, De Marco G, Perri A, Pinchera A, Vitti P, Chiovato L 2001 Thyroid resistance to TSH complicated by autoimmune thyroiditis. J Clin Endocrinol Metab 86: Ross DS 2000 Subclinical hypothyroidism. In: Braverman LE, Utiger RD, eds. Werner and Ingbar s The thyroid. A fundamental and clinical text, 8th ed. Philadelphia: Lippincott Williams & Wilkins; Vanderpump MPJ, Tunbridge WMG 2000 The epidemiology of thyroid diseases. In: Braverman LE, Utiger RD, eds. Werner and Ingbar s The thyroid. A fundamental and clinical text, 8th ed. Philadelphia: Lippincott Williams & Wilkins; Vitti P, Rago T, Barbesino G, Chiovato L 1999 Thyroiditis: clinical aspects and diagnostic imaging. Rays 24: Persani L, Ferretti E, Borgato S, Faglia G, Beck-Peccoz P 2000 Circulating thyrotropin bioactivity in sporadic central hypothyroidism. J Clin Endocrinol Metab 85: Persani L, Lania A, Alberti L, Romoli R, Mantovani G, Filetti S, Spada A, Conti M 2000 Induction of specific phosphodiesterase isoforms by constitutive activation of the camp pathway in autonomous thyroid adenomas. J Clin Endocrinol Metab 85: De Roux N, Misrahi M, Chatelain N, Gross B, Milgrom E 1996 Microsatellites and PCR primers for genetic studies and genomic sequencing of the human TSH receptor gene. Mol Cell Endocrinol 117: Xie J, Pannain S, Pohlenz J, Weiss RE, Moltz K, Morlot M, Asteria C, Persani L, Beck-Peccoz P, Parma J, Vassart G, Refetoff S 1997 Resistance to thyrotropin (TSH) in three families is not associated with mutations in the TSH receptor or TSH. J Clin Endocrinol Metab 82: Parma J, Van Sande J, Swillens S, Tonacchera M, Dumont J, Vassart G 1995 Somatic mutations causing constitutive activity of the thyrotropin receptor are the major cause of hyperfunctioning thyroid adenomas: identification of additional mutations activating both the cyclic adenosine 3,5 -monophosphate and inositol phosphate-ca 2 cascades. Mol Endocrinol 9: Wigler M, Silverstein S, Lee LS, Pellicer A, Cheng Y, Axel R 1977 Transfer of purified herpes virus thymidine kinase gene to cultured mouse cells. Cell 11: Parma J, Duprez L, Van Sande J, Hermans J, Rocmans P, Van Vliet G, Costagliola S, Rodien P, Dumont JE, Vassart G 1997 Diversity and prevalence of somatic mutations in the thyrotropin receptor gene and Gs genes as a cause of toxic thyroid adenomas. J Clin Endocrinol Metab 82: Costagliola S, Khoo D, Vassart G 1998 Production of bioactive amino-terminal domain of the thyrotropin receptor via insertion in the plasma membrane by a glycosylphosphatidylinositol anchor. FEBS Lett 436: Costagliola S, Sunthorntepvarakul T, Migeotte I, Van Sande J, Kajava AM, Refetoff S, Vassart G 1999 Structure-function relationships of two loss-offunction mutations of the thyrotropin receptor gene. Thyroid 9: Wadsworth HL, Russo D, Nagayama Y, Chazenbalk GD, Rapoport B 1992 Studies on the role of amino acids in the expression of a functional thyrotropin receptor. Mol Endocrinol 6: Cuddihy RM, Bryant WP, Bahan R 1995 Normal function in vivo of a homozygotic polymorphism in the human thyrotropin receptor. Thyroid 5: Chen CR, Tanaka K, Chazenbalk GD, McLachlan SM, Rapoport B 2001 A full biological response to autoantibodies in Graves disease requires a disulfide-bonded loop in the thyrotropin receptor N terminus homologue to a laminin epidermal growth factor-like domain. J Biol Chem 276: Biebermann H, Schoneberg T, Schulz A, Krause G, Gruters A, Schultz G, Gudermann T 1998 A conserved tyrosine residue (Y601) in transmembrane domain 5 of the human thyrotropin receptor serves as a molecular switch to determine G-protein coupling. FASEB J 12: Farid NR, Kascur V, Balazs C 2000 The human thyrotropin receptor is highly mutable: a review of gain-of-function mutations. Eur J Endocrinol 143:25 30