Supplementary information

Size: px
Start display at page:

Download "Supplementary information"

Transcription

1 Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun Kim, Young-Kook Kim, Young-Eui Kim, Jin-Hyun Ahn, Stanley R. Riddell, Efstratios Stratikos, V. Narry Kim, and Kwangseog Ahn * * To whom correspondence should be addressed: ( ) ksahn@snu.ac.kr 1

2 Supplementary Figure 1 Supplementary Figure 1. Representation of the genomic locations of HCMV mir-us4-1, mir-us5-1, and mir-us5-2 and transfection validation for microarray (a) Schematic representation of the HCMV whole genome and mirnas within the US2-US11 region of the HCMV genome. The HCMV genome consists of 2 linked segments (L and S), each comprising a unique long and a unique short region (UL and US) flanked by inverted repeats (TRL and IRL, TRS and IRS). Three mirnas (mir-us4-1, mir-us5-1, and mir-us5-2) are located within the US2-US11 region. MiR-US4-1 is encoded between the US3 ORF and the US5 ORF with (+) transcriptional orientation. mir-us5-1 and mir-us5-2 are encoded between the US6 ORF and the US7 ORF with (+) orientation, similar to mir-us4-1. (b) Immunoblot analysis to determine the transfection efficiency for microarray analysis. A GFP-targeting sirna was used as control mirna. sirna-pdi targets the coding region of PDI mrna. 2

3 Supplementary Figure 2 Supplementary Figure 2. Sequences of ERAP1 isoforms and seed-binding region-mutated mir-us4-1 (a) Comparison of ERAP1 isoforms a and b. sierap1, sierap1a, and sierap1b binding sites are indicated in red, green, and blue, respectively. The C-terminal sequence of ERAP1a and ERAP1b is shown in black boxes. (b) The sequence of the wild-type mir-us4-1 sequence and the seed region point mutant, mir-us4-1(m). 3

4 Supplementary Figure 3 Supplementary Figure 3. PCR efficiency of primers of both ERAP1 isoforms is equal and the expression level of ERAP1b mrna is higher than that of ERAP1a mrna in various cell lines (a) The relative expression levels of ERAP1a and ERAP1b mrna in HEK293T, HeLa-K b, 4

5 U373MG, HFF, and HFF-TEL cells were analyzed using qrt-pcr and normalized to GAPDH mrna levels. Data are presented as means ± s.d., n = 3, and is representative of 3 independent experiments. (b) 10 pg of pgl3-cmv-erap1a vector DNA and pgl3-cmv-erap1b vector DNA were analyzed by qrt-pcr with primers for ERAP1a, ERAP1b, and firefly luciferase. The fold value of firefly serves as a normalization control. Relative fold value of ERAP1a and ERAP1b are calculated and presented in graph as means ± s.d., n = 3, representative of 2 independent experiments. (c) We transfected 1 µg of pgl3-cmv-erap1a vector DNA and pgl3-cmv-erap1b vector DNA into mouse embryonic fibroblast cell line, NIH3T3. After 24 h post transfection, cells were harvested and total RNA was extracted, followed by cdna synthesis. cdna was analyzed by qrt-pcr with primers for ERAP1a, ERAP1b, and GAPDH. GAPDH serves as a normalization control. Relative fold value of ERAP1a and ERAP1b are calculated and are presented in graph as means ± s.d., n = 3, representative of 2 independent experiments. 5

6 Supplementary Figure 4 Supplementary Figure 4. Dose-dependent expression of HCMV mir-us4-1 in HEK293T cells (a, b) Expression levels of HCMV mir-us4-1 (a) and mir-16 as a loading control (b) were analyzed using RNA blot analysis. A total of 40 μg total RNA extracted from the indicated cells was resolved on a 12.5% urea-polyacrylamide gel and transferred to a Zetaprobe-GT membrane. Oligonucleotide probes complementary to the mature sequence of each mirna were end-labeled using T4 polynucleotide kinase. Probes were hybridized with membranes and washed. Blots were analyzed using a BAS detector. 6

7 Supplementary Figure 5 7

8 Supplementary Figure 5. Experimental validation of RISC IP analysis (a) Expression levels of hsa-mir-21. HEK293T cells were transfected with pcdna3.1(+) mock vector, psuperretro mock vector, pcdna3.1(+)-mir-21 vector, or psuperretro-mir-21 vector. The pcdna3.1(+)-mir-21 vector expressed endogenous human mir-21. After 3 days, total RNA was harvested using Trizol reagent and analyzed using RNA blot analysis. (b) HEK293T cells were transfected with psuperrestro-mir-21, followed by transfection of Mock or FLAGhAGOs vectors. After 48 h, RISC IP was performed, and mirnas were extracted from immunoprecipitates, followed by RPA to detect the mir-21. (c) Immunoblot for expression levels of FLAG-hAGOs. HEK293T cells were transfected with empty (Mock) or N-terminally FLAG-tagged human AGO1, 2, 3, and 4 (FLAG-hAGOs) vectors. To investigate the expression and IP, protein samples from the RISC IP were analyzed by immunoblot analysis with anti- FLAG M2 mab and anti-gapdh Ab. (d, e) qrt-pcr was performed to compare the levels of the indicated mrnas using total RNA samples from RISC IP. The value was normalized to GAPDH (d) or β-actin (e) levels. Data are presented as means ± s.e.m. of 3 independent experiments. 8

9 Supplementary Figure 6 Supplementary Figure 6. Generation of HCMV ΔUS4 The 6 nt UCGCGA sequence in the hairpin structure of mir-us4-1 was substituted with the GACAAU sequence, disrupting the cropping process of the Drosha complex in the nucleus, and finally resulting in completely diminished pre-mir-us4-1 and subsequent reduction of mature mir-us4-1 production. The HCMV REV used in this study is similar to the HCMV WT and was made using the same method used for the construction of HCMV ΔUS4 with HCMV ΔUS4 as the template. 9

10 Supplementary Figure 7 Supplementary Figure 7. The mrna level of ERAP1b is downregulated by mir-us4-1 during HCMV infection HFF cells were infected with wild-type HCMV AD169, the ΔUS4 mutant, or the revertant for 1 h at MOI = 5. The total RNA was extracted at 0 h, 24 h, 48 h, and 72 h post infection from infected cells or uninfected cells. qrt-pcr was performed to analyze the level of (a) ERAP1a, ERAP1b, and (b) IE1 mrna. GAPDH served as a normalization control. Data are presented as means ± s.e.m. of 3 independent experiments. 10

11 Supplementary Figure 8 Supplementary Figure 8. HCMV mir-us4-1 does not affect the expression of components of the MHC class I peptide loading complex Expression levels of Tapasin, MHC class I heavy chain (HC), PDI, ERp57, and GAPDH. Using aliquots from Fig. 6, cells were lysed with 1% NP-40 and analyzed by immunoblot analysis. GAPDH served as loading control. 11

12 Supplementary Figure 9 Supplementary Figure 9. MHC class I cell surface level of CP, RT, and DK donor fibroblasts infected with HCMV WT, ΔUS4, or RV798 CP, RT, and DK fibroblasts were uninfected or infected with HCMV AD169 wild-type (AD169 WT), HCMV AD169 ΔUS4 mutant (AD169 ΔUS4), or HCMV RV798 (RV798) at MOI = 2 for 1 h. At 48 h post infection, the cells were harvested and flow cytometry was performed using mab W6/32 (HLA-A-, B-, C-specific). Lines in the plots are indicated by short names. No 1st Ab indicates an untreated condition, in which the mab W6/32 was not used in the uninfected cells. 12

13 Supplementary Figure 10 Supplementary Figure 10. CP, RT, and DK fibroblasts infected with HCMV RV798 express the viral mrna of UL16, UL105, IE1, UL28, and UL23 CP, RT, and DK fibroblasts were infected with HCMV RV798 at MOI = 2 for 1 h. At 0 h and 48 h post infection, we performed RT-PCR to validate the expression of mrnas from UL16, UL105, IE1, UL28, and UL23 genes. GAPDH served as loading control. 13

14 Supplementary Figure 11 14

15 Supplementary Figure 11. Validation of ERAP1 knockdown by HCMV mir-us4-1 in fibroblasts (a) CP, (b) RT, and (c) DK fibroblasts were transfected with control mirna, mir-us4-1, or sierap1 RNA oligomer duplexes twice at 36 h intervals. At 24 h after the last transfection, cells were infected with HCMV RV798 at MOI = 2 for 1 h. At 48 h post infection, we performed qrt- PCR to analyze the levels of ERAP1a and ERAP1b mrnas. Relative fold change was normalized to GAPDH level. Data are presented as means ± s.d., n = 3, representative of 2 independent experiments. 15

16 Supplementary Table 1. Primers or DNA oligomers used in this paper Control mirna Forward GATCCCCGGTTATGTACAGGAACGCATTCAAGA (sigfp) GATGCGTTCCTGTACATAACCTTTTTTTA Reverse AGCTTAAAAAAAGGTTATGTACAGGAACGCATC TCTTGAATGCGTTCCTGTACATAACCGGG mir-us4-1 Forward GATCCCCCGTCTTCGACGTGCAGGGGGATTTCA AGAGAATCCCCCTGCACGTCCATGTCGTTTTTA Reverse AGCTTAAAAA CGACATGGACGTGCAGGGGGATTCTCTTGAAAT CCCCCTGCACGTCCATGTCGGGG mir-us4-1(m) Forward GATCCCC CGACATGGACGTGCAGGGGGATTTCAAGAGAAT CCCCCTGCACGTCCATGTCGTTTTTA Reverse AGCTTAAAAA CGACATGGACGTGCAGGGGGATTCTCTTGAAAT CCCCCTGCACGTCGAAGACGGGG sierap1 Forward GATCCCCAACGTAGTGATGGGACACCATTTTTCA AGAGAAAATGGTGTCCCATCACTACGTTTTTTTA Reverse AGCTTAAAAAAACGTAGTGATGGGACACCATTT TCTCTTGAAAAATGGTGTCCCATCACTACGTTGG G sierap1a Forward GATCCCCCATCTAGCAAATGAGGCACTGTTCTTT CAAGAGAAGAACAGTGCCTCATTTGCTAGATGT TTTTA Reverse AGCTTAAAAACATCTAGCAAATGAGGCACTGTT CTTCTCTTGAAAGAACAGTGCCTCATTTGCTAGA TGGGG 16

17 sierap1b Forward GATCCCCGGGCTGACTTGTAAAGGCCAAGTCAT TCAAGAGATGACTTGGCCTTTACAAGTCAGCCC TTTTTA Reverse AGCTTAAAAAGGGCTGACTTGTAAAGGCCAAGT CATCTCTTGAATGACTTGGCCTTTACAAGTCAGC CCGGG ERAP1a 3 -UTR Forward CTAGCTAGCAAATCCATCAGAATCTCAGACTACA G Reverse AACTGCAGTCATTTTATGTGTTAATTTTTTATTAA AT ERAP1b 3 -UTR Forward GCTCTAGAAAATTCCTCCCTTGCCAGGTTCCTG Reverse AACTGCAGGGTTTCTGCACATTGTTGTGGCAAT ERAP1 C -term Forward GGAAATTCCATATGAATGAAGTGGAAACTCAATT CAAGGC Reverse CCGCTCGAGCATACGTTCAAGCTTTTCACTTTGC AG US4 mutagenesis Forward GTGCGGATTAGTGGTCGTGGACAACCATGGACG TGCAGGGGG Reverse CCCCCTGCACGTCCATGGTTGTCCACGACCACT AATCCGCAC US4 homologous Forward CGTCAAGAGTCACGTCAGTCGCCCACCCCCATT arm ACACGGCGATATCCCGAGGCCTGGTGATGATGG CGGGATCG Reverse TATTTTTTCTGTCGCGATAGTCGACGATATGTCGC GATAGACAACTCCGGTCAGAAGAACTCGTCAAG AAGGCG UL56 (RT-PCR) Forward CACAAGAGTCTGCCTGTGGA Reverse GCATTTGACCAAATCGTCCT UL28 (RT-PCR) Forward GCCTCGTCAGTGTGTACGAA 17

18 Reverse GCCCTCTACGATCTCATCCA UL23 (RT-PCR) Forward ACTTCATCACCGTCCCAGAG Reverse AGGTTCCACGTGGTTACTGC UL16 (RT-PCR) Forward TGGGTAGCAAGTCCTCCAAC Reverse CAACCACAGGTCAACCACAG UL105 (RT-PCR) Forward CAAGAGGAGACCCACGACAT Reverse GAAAAATGTCGCGGAAGGTA UL123(IE1) (qrt- Forward CAAGAGGAGACCCACGACAT PCR and RT-PCR) Reverse GAAAAATGTCGCGGAAGGTA GAPDH (qrt- Forward AGAAGGCTGGGGCTCATTTG PCR) Reverse AGGGGCCATCCACAGTCTTC beta-actin (qrt- Forward GAAAAATGTCGCGGAAGGTA PCR) Reverse GAAAAATGTCGCGGAAGGTA pcdna3.1-mir-21 Forward CGGAATTCTGGGGTTCGATCTTAACAGGCCAG Reverse CCGCTCGAGACCAGACAGAAGGACCAGAGTTT CT PDCD4 (qrt-pcr) Forward GAAAATGCTGGGACTGAGGA Reverse TGGACTGGTTGGCACAGTTA Maspin (qrt-pcr) Forward CACAGATGGCCACTTTGAGA Reverse GGCCTCCATGTTCATCATCT TPM1 (qrt-pcr) Forward TCATCATTGAGAGCGACCTG Reverse CTCAGCCTCCTTCAGCTTGT SPRY2 (qrt-pcr) Forward CCCCTCTGTCCAGATCCATA Reverse CCCAAATCTTCCTTGCTCAG RECK (qrt-pcr) Forward GCAGGGGAAGTTGGTTGTTA Reverse TGCCAGCAAAACAAGAACAG PTEN (qrt-pcr) Forward ACCAGGACCAGAGGAAACCT Reverse GCTAGCCTCTGGATTTGACG 18

Human cytomegalovirus microrna mir-us4-1 inhibits CD8 + T cell responses by targeting the aminopeptidase ERAP1

Human cytomegalovirus microrna mir-us4-1 inhibits CD8 + T cell responses by targeting the aminopeptidase ERAP1 Human cytomegalovirus microrna inhibits CD8 + T cell responses by targeting the aminopeptidase ERAP1 211 Nature America, Inc. All rights reserved. Sungchul Kim 1, Sanghyun Lee 1, Jinwook Shin 2, Youngkyun

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus. Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Yoon et al, page Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Je-Hyun Yoon,, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka,

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

33VASTVNGATSANNHGEPPS51PADARPR58

33VASTVNGATSANNHGEPPS51PADARPR58 Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28 Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4

More information

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Supplementary Figures

Supplementary Figures MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Conditional and reversible disruption of essential herpesvirus protein functions

Conditional and reversible disruption of essential herpesvirus protein functions nature methods Conditional and reversible disruption of essential herpesvirus protein functions Mandy Glaß, Andreas Busche, Karen Wagner, Martin Messerle & Eva Maria Borst Supplementary figures and text:

More information

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)

More information

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.10/nature10195 NCBI gene: Tagged Subunit(s: HA-Vpx; FLAG-Cul4 HA-DCAF1 FLAG-Cul4 HA-FLAG-Vpx Mock Vpx (SIVmac 100 (a ; 0.159 (b ; 0.05 DCAF1 DDB1 DDA1 Cul4A 1; 0.024591

More information

Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19

Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19 Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19 1 MicroRNA biogenesis 1. Pri mirna: primary mirna 2. Drosha: RNaseIII 3. DCR 1: Dicer 1 RNaseIII

More information

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected

More information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Inventory of Supplemental Data: Supplemental Figures 1-7. Supplemental Tables 1-8. Supplemental References. Supplemental Video:

Inventory of Supplemental Data: Supplemental Figures 1-7. Supplemental Tables 1-8. Supplemental References. Supplemental Video: Inventory of Supplemental Data: Supplemental Figures -7 Supplemental Tables -8 Supplemental References Supplemental Video: Note that the video shows JHU-9 cells transfected with mir-93a antagomir or control

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Published online 17 July 2010 Nucleic Acids Research, 2010, Vol. 38, No doi: /nar/gkq637

Published online 17 July 2010 Nucleic Acids Research, 2010, Vol. 38, No doi: /nar/gkq637 Published online 17 July 2010 Nucleic Acids Research, 2010, Vol. 38, No. 21 7673 7688 doi:10.1093/nar/gkq637 GAM/ZFp/ZNF512B is central to a gene sensor circuitry involving cell-cycle regulators, TGFb

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information