The RNA revolution: rewriting the fundamentals of genetics

Size: px
Start display at page:

Download "The RNA revolution: rewriting the fundamentals of genetics"

Transcription

1 RCH Grand Rounds - June 4 The RNA revolution: rewriting the fundamentals of genetics Ken Pang Overview 1. Genetics Recent lessons from genomics 3. The expanding world of noncoding RNAs 4. Long noncoding RNAs an area of controversy 5. I m a clinician - is any of this relevant to me? 1

2 Genetics 101 DNA: our genetic blueprint 2

3 Proteins: the building blocks of our body Image from Our genes encode the instructions to make proteins 2 Image adapted from 3

4 RNA: the middle-man of genetics DNA RNA protein The central dogma in action Transcription Translation Image from 4

5 Recent lessons from genomics The human genome has been sequenced 5

6 Our genes represent only 2% of the genome CAGAGAGAGACAGAGAGAAAATGAATGAAGGAGAGGCAATATTTGAAAAG GAAATGGGTGAGAATTTTCAGAAATTATGGAAAAATATACAGATTCATGA TGCAAAACATATATTAAACTGAAAAATAAAAGTAAAATGTACAGGACACG TCTTCTACCCTGCCTCACATCTTCTTGGCTACTGTTTACTATAATAATTG CTGCAGCAACCATCTTTCTGCAGGGACAGCTGGCAGCATCATGCCTCAGC TGCAACTCATATACCTTGCTTTTTGTCCGGTACTTCTCTGATGTATATGG GAACCTGATAGGCACCCACACATGCACCAAACCTGAAAATTCAAGGAGGT AAGCATTTAATAGAATAATCCTGACCACTGGGGAACAGAAACTGGTGGAT AAATGCTCCCTCCCCTAGTGCATGCCCACACAGCCAATTCTGAAGCACAT TCTAAAAAGCACTCAGAACGTCCCAGAGGGCTTGAGCCCCAAGTTTCCAC AAAAGTGATTAGATCAATAACGTACCCTTGCATTGGGTCTCCCTACATCC TTATTCTATTTTTCCAATCTCATTTTTCCTCTCCCTGGCCTCTATTTCCC CAAAATAAACTACCTGCCTTCAAGACTGTGTGTCAGTTAGGCTCTGATTT CTGGGGGGAATCAGAACTAATTTTAAAAAGTGAATTTCCATATATGTTGG AGAATAACTGCAAAATACCAAATATAATAGAAAGTCTTAAAACTGTTCAG AGAGAAAGAAAGAAACACCTAAAAAGAAATTATTGTAAGACTGATAGTAG ACTTCTCAACAATAAGAGAATAAAAACAATAGAAAAATACTTGAAAAGGC TGAAAGAAAACAACTATTAATCTAGAACTGTGTAACCAGAAAAACCATAT TTTAAGAGCCAGAGTAAAATTTAAAAAAATTCTAGATAAATAGAAACTGG AAAGCTTACCATCAATACATCTACATTAAAGAAATTTCTAAAGCATGTTC That s fewer than 20 DNA bases per 1000! Is the rest all junk DNA? CAGAGAGAGACAGAGAGAAAATGAATGAAGGAGAGGCAATATTTGAAAAG GAAATGGGTGAGAATTTTCAGAAATTATGGAAAAATATACAGATTCATGA TGCAAAACATATATTAAACTGAAAAATAAAAGTAAAATGTACAGGACACG TCTTCTACCCTGCCTCACATCTTCTTGGCTACTGTTTACTATAATAATTG CTGCAGCAACCATCTTTCTGCAGGGACAGCTGGCAGCATCATGCCTCAGC TGCAACTCATATACCTTGCTTTTTGTCCGGTACTTCTCTGATGTATATGG GAACCTGATAGGCACCCACACATGCACCAAACCTGAAAATTCAAGGAGGT AAGCATTTAATAGAATAATCCTGACCACTGGGGAACAGAAACTGGTGGAT AAATGCTCCCTCCCCTAGTGCATGCCCACACAGCCAATTCTGAAGCACAT TCTAAAAAGCACTCAGAACGTCCCAGAGGGCTTGAGCCCCAAGTTTCCAC AAAAGTGATTAGATCAATAACGTACCCTTGCATTGGGTCTCCCTACATCC TTATTCTATTTTTCCAATCTCATTTTTCCTCTCCCTGGCCTCTATTTCCC CAAAATAAACTACCTGCCTTCAAGACTGTGTGTCAGTTAGGCTCTGATTT CTGGGGGGAATCAGAACTAATTTTAAAAAGTGAATTTCCATATATGTTGG AGAATAACTGCAAAATACCAAATATAATAGAAAGTCTTAAAACTGTTCAG AGAGAAAGAAAGAAACACCTAAAAAGAAATTATTGTAAGACTGATAGTAG ACTTCTCAACAATAAGAGAATAAAAACAATAGAAAAATACTTGAAAAGGC TGAAAGAAAACAACTATTAATCTAGAACTGTGTAACCAGAAAAACCATAT TTTAAGAGCCAGAGTAAAATTTAAAAAAATTCTAGATAAATAGAAACTGG AAAGCTTACCATCAATACATCTACATTAAAGAAATTTCTAAAGCATGTTC 6

7 Our genes are not much different from those of mice ~3.1 billion bp ~ 21,500 genes ~2.7 billion bp ~22,000 genes ~0.1 billion bp ~ 20,000 genes Moreover, >99% of our protein-coding genes have homologs in mice Data from The transcriptome may unlock the genome s secrets DNA RNA Transcriptome protein 7

8 There seems to be all this RNA that doesn t code for protein 8

9 Summary #1 Genes function by encoding proteins Our genes represent only 2% of the genome and are similar to those of other animals >90% of the RNA in our cells isn t there to make proteins The expanding world of noncoding RNAs 9

10 Noncoding RNAs (ncrnas) everywhere! rrnas trnas snrnas micrornas pirnas sirnas Other small RNAs Long ncrnas RNA successfully combines the best features of both DNA and protein base-pairs with DNA/RNA in a highly specific fashion forms 3D structures allowing direct interaction with proteins and even catalysis 10

11 Discovery of hundreds of micrornas 11

12 mirnas regulate the production of thousands of our proteins Short interfering RNAs turn off genes via RNA interference 12

13 But wait, there s more! snornas, pirnas, PASRs, TASRs Long noncoding RNAs an area of controversy rrnas trnas snrnas micrornas pirnas sirnas snornas Long ncrnas 13

14 20,714 genes encoding proteins 22,839 long noncoding RNAs What s with all these long ncrnas? Accidental by-products of transcription? A vast functional network of regulatory genes? 14

15 Tissue-specific expression of long ncrnas Gut Liver Thymus CNS Muscle Testis Genome Res 16, 11-9 (2006) Long ncrnas are co-expressed in developmentally-related tissues Gut CNS Genome Res 16, 11-9 (2006) 15

16 A search for functional long ncrnas Embryonic stem cell differentiation (0-16 days) 2 cell embryo 4 cell embryo Blastocyst Embryoid body 16d 12d 10d 8d Pool 2d 3d 4d 6d 5d T-cell differentiation and activation Unactivated T-cells Activated T-cells Unactivated Activated Naive T-cells Memory T-cells Male and female gonadal ridge development ( dpc) 10.5d 11.5d 10.5d 11.5d 10.5dpc embryo 13.5dpc male/female gonad dissections 13.5d 12.5d 13.5d 12.5d A search for functional long ncrnas C2C12 Myoblast differentiation Confluent 50 % Myoblasts (confluent) Myotubes (5d) 24h 5d Macrophage activation Unactivated (-LPS) Activated (+LPS) Unactivated Activated Neural stem cell development Postmit OL GABAN NSC Myel OL Neural Stem Cells (NSC) Oligodendrocytes (OL) Myelinating OL OLP NOP 16

17 OK, so what did we find? >1500 long ncrnas differentially expressed in at least one of the experimental systems these represent potential candidates for further functional studies Some long ncrnas might be involved in early embryonic stem (ES) cell function A 17

18 Some long ncrnas overlap important genes Long ncrna Hox B6 Hox B5 Hox B6 Long ncrna Some long ncrnas might exert epigenetic effects Hox B6 Hox B5 Long ncrna DNA wrapped around histone proteins Long ncrna 18

19 Summary #2 There are lots of different types of noncoding RNAs in our cells, most of which have only recently been identified Many ncrnas are small, and seem to have important regulatory roles in cells (e.g. by switching off genes) Many ncrnas are long, and at least some of them are likely to be functional I m a clinician - is any of this relevant to me? 19

20 Our genes are not much different from those of mice ~3.1 billion bp ~ 21,500 genes ~2.7 billion bp ~22,000 genes ~0.1 billion bp ~ 20,000 genes Moreover, >99% of our protein-coding genes have homologs in mice Data from Same pieces, different configuration 20

21 Same materials, different configuration Same proteins, different configuration 21

22 Junk DNA is this where the architectural plans lie? CAGAGAGAGACAGAGAGAAAATGAATGAAGGAGAGGCAATATTTGAAAAG GAAATGGGTGAGAATTTTCAGAAATTATGGAAAAATATACAGATTCATGA TGCAAAACATATATTAAACTGAAAAATAAAAGTAAAATGTACAGGACACG TCTTCTACCCTGCCTCACATCTTCTTGGCTACTGTTTACTATAATAATTG CTGCAGCAACCATCTTTCTGCAGGGACAGCTGGCAGCATCATGCCTCAGC TGCAACTCATATACCTTGCTTTTTGTCCGGTACTTCTCTGATGTATATGG GAACCTGATAGGCACCCACACATGCACCAAACCTGAAAATTCAAGGAGGT AAGCATTTAATAGAATAATCCTGACCACTGGGGAACAGAAACTGGTGGAT AAATGCTCCCTCCCCTAGTGCATGCCCACACAGCCAATTCTGAAGCACAT TCTAAAAAGCACTCAGAACGTCCCAGAGGGCTTGAGCCCCAAGTTTCCAC AAAAGTGATTAGATCAATAACGTACCCTTGCATTGGGTCTCCCTACATCC TTATTCTATTTTTCCAATCTCATTTTTCCTCTCCCTGGCCTCTATTTCCC CAAAATAAACTACCTGCCTTCAAGACTGTGTGTCAGTTAGGCTCTGATTT CTGGGGGGAATCAGAACTAATTTTAAAAAGTGAATTTCCATATATGTTGG AGAATAACTGCAAAATACCAAATATAATAGAAAGTCTTAAAACTGTTCAG AGAGAAAGAAAGAAACACCTAAAAAGAAATTATTGTAAGACTGATAGTAG ACTTCTCAACAATAAGAGAATAAAAACAATAGAAAAATACTTGAAAAGGC TGAAAGAAAACAACTATTAATCTAGAACTGTGTAACCAGAAAAACCATAT TTTAAGAGCCAGAGTAAAATTTAAAAAAATTCTAGATAAATAGAAACTGG AAAGCTTACCATCAATACATCTACATTAAAGAAATTTCTAAAGCATGTTC Noncoding RNAs and disease? 22

23 23

24 Ref. Prasanth and Spector (2007) Genes and Dev. 21:11 24

25 Noncoding RNAs and treatment? RNA interference a new therapeutic frontier? 25

26 Summary #3 ncrnas might represent the architectural plans that tell our bodies how to configure our genes ncrnas are increasingly being implicated in disease ncrnas represent a novel strategy to help treat disease Acknowledgements Institute for Molecular Bioscience, Brisbane John Mattick Marcel Dinger Tim Mercer Paolo Amaral Andrew Perkins Sean Grimmond Mark Crowe Ludwig Institute for Cancer Research, Melbourne Weisan Chen Funding bodies NHMRC Australian-American Fulbright Commission Menzies Foundation RACP CSL 26

27 Questions? 27

Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Prokaryotes and eukaryotes alter gene expression in response to their changing environment Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences

More information

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural

More information

MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM

MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer

More information

MicroRNA in Cancer Karen Dybkær 2013

MicroRNA in Cancer Karen Dybkær 2013 MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

Morphogens: What are they and why should we care?

Morphogens: What are they and why should we care? Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates

More information

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Human Genome: Mapping, Sequencing Techniques, Diseases

Human Genome: Mapping, Sequencing Techniques, Diseases Human Genome: Mapping, Sequencing Techniques, Diseases Lecture 4 BINF 7580 Fall 2005 1 Let us review what we talked about at the previous lecture. Please,... 2 The central dogma states that the transfer

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Unit 8.1: Human Chromosomes and Genes

Unit 8.1: Human Chromosomes and Genes Unit 8.1: Human Chromosomes and Genes Biotechnology. Gene Therapy. Reality or fiction? During your lifetime, gene therapy may be mainstream medicine. Here we see a representation of the insertion of DNA

More information

Small RNAs and how to analyze them using sequencing

Small RNAs and how to analyze them using sequencing Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for

More information

RNA- seq Introduc1on. Promises and pi7alls

RNA- seq Introduc1on. Promises and pi7alls RNA- seq Introduc1on Promises and pi7alls RNA gives informa1on on which genes that are expressed How DNA get transcribed to RNA (and some1mes then translated to proteins) varies between e. g. - Tissues

More information

Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016

Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016 Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need

More information

Transcription and RNA processing

Transcription and RNA processing Transcription and RNA processing Lecture 7 Biology 3310/4310 Virology Spring 2018 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at the

More information

Alan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design

Alan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design Alan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design Crick's "Central Dogma"? DNA makes RNA makes protein Crick's "Central Dogma"? DNA makes

More information

DNA codes for RNA, which guides protein synthesis.

DNA codes for RNA, which guides protein synthesis. Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription

More information

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Differential Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions In multicellular eukaryotes,

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

EPIGENETIC CHANGES IN RADIATION- INDUCED GENOME INSTABILITY AND CARCINOGENESIS: POWER, PROMISE AND OPPORTUNITIES

EPIGENETIC CHANGES IN RADIATION- INDUCED GENOME INSTABILITY AND CARCINOGENESIS: POWER, PROMISE AND OPPORTUNITIES EPIGENETIC CHANGES IN RADIATION- INDUCED GENOME INSTABILITY AND CARCINOGENESIS: POWER, PROMISE AND OPPORTUNITIES Olga Kovalchuk, MD/PhD University of Lethbridge, AB, Canada Sources of radiation exposure:

More information

Today. Genomic Imprinting & X-Inactivation

Today. Genomic Imprinting & X-Inactivation Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic

More information

Campbell Biology 10. A Global Approach. Chapter 18 Control of Gene Expression

Campbell Biology 10. A Global Approach. Chapter 18 Control of Gene Expression Lecture on General Biology 2 Campbell Biology 10 A Global Approach th edition Chapter 18 Control of Gene Expression Chul-Su Yang, Ph.D., chulsuyang@hanyang.ac.kr Infection Biology Lab., Dept. of Molecular

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

MicroRNAs: a new source of biomarkers in radiation response. Simone Moertl, Helmholtz Centre Munich

MicroRNAs: a new source of biomarkers in radiation response. Simone Moertl, Helmholtz Centre Munich MicroRNAs: a new source of biomarkers in radiation response Simone Moertl, Helmholtz Centre Munich The RNA World mrna rrna coding snorna trna scarna RNA snrna noncoding lincrna rasirna RNAi anti-sense

More information

The Biology and Genetics of Cells and Organisms The Biology of Cancer

The Biology and Genetics of Cells and Organisms The Biology of Cancer The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

More information

Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale

Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental

More information

Where Splicing Joins Chromatin And Transcription. 9/11/2012 Dario Balestra

Where Splicing Joins Chromatin And Transcription. 9/11/2012 Dario Balestra Where Splicing Joins Chromatin And Transcription 9/11/2012 Dario Balestra Splicing process overview Splicing process overview Sequence context RNA secondary structure Tissue-specific Proteins Development

More information

Small RNA Sequencing. Project Workflow. Service Description. Sequencing Service Specification BGISEQ-500 SERVICE OVERVIEW SAMPLE PREPARATION

Small RNA Sequencing. Project Workflow. Service Description. Sequencing Service Specification BGISEQ-500 SERVICE OVERVIEW SAMPLE PREPARATION BGISEQ-500 SERVICE OVERVIEW Small RNA Sequencing Service Description Small RNAs are a type of non-coding RNA (ncrna) molecules that are less than 200nt in length. They are often involved in gene silencing

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

Processing of RNA II Biochemistry 302. February 18, 2004 Bob Kelm

Processing of RNA II Biochemistry 302. February 18, 2004 Bob Kelm Processing of RNA II Biochemistry 302 February 18, 2004 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation Discovered by P. Sharp and R. Roberts in late 1970s

More information

Small RNAs and how to analyze them using sequencing

Small RNAs and how to analyze them using sequencing Small RNAs and how to analyze them using sequencing Jakub Orzechowski Westholm (1) Long- term bioinforma=cs support, Science For Life Laboratory Stockholm (2) Department of Biophysics and Biochemistry,

More information

Workgroup Webinar Tuesday, May 26, :00 p.m.

Workgroup Webinar Tuesday, May 26, :00 p.m. NIDA Strategic Planning Gene x Environment x Development Interactions (GEDI) Co-Chairs: Naimah Weinberg and Jonathan Pollock SPB Coordinator: Michele Rankin Workgroup Webinar Tuesday, May 26, 2015 3:00

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6 Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early

More information

Eukaryotic Genetics. Expression & Regulation

Eukaryotic Genetics. Expression & Regulation Eukaryotic Genetics Expression & Regulation Molecular Basis of Inheritance I.Main Idea: Bacteria often respond to environmental change by regulating transcription. Regulating Gene Expression A cell s genome

More information

CRS4 Seminar series. Inferring the functional role of micrornas from gene expression data CRS4. Biomedicine. Bioinformatics. Paolo Uva July 11, 2012

CRS4 Seminar series. Inferring the functional role of micrornas from gene expression data CRS4. Biomedicine. Bioinformatics. Paolo Uva July 11, 2012 CRS4 Seminar series Inferring the functional role of micrornas from gene expression data CRS4 Biomedicine Bioinformatics Paolo Uva July 11, 2012 Partners Pharmaceutical company Fondazione San Raffaele,

More information

Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation

Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation RESEARCH ARTICLE Open Access Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation Tim R Mercer 1, Irfan A Qureshi 2,3,6, Solen Gokhan 2,3,6, Marcel E Dinger 1,

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

A Genetic Program for Embryonic Development

A Genetic Program for Embryonic Development Concept 18.4: A program of differential gene expression leads to the different cell types in a multicellular organism During embryonic development, a fertilized egg gives rise to many different cell types

More information

Transcription and RNA processing

Transcription and RNA processing Transcription and RNA processing Lecture 7 Biology W3310/4310 Virology Spring 2016 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at

More information

RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R.

RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R. RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R. October 20, 2017 Safe Harbor Statement This presentation contains forward-looking

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. 1 of 17 12/10/2003 11:33 AM Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm, Room 438 Library Admin Building

More information

BIOLOGY. Regulation of Gene Expression CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson

BIOLOGY. Regulation of Gene Expression CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Regulation of Gene Expression Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Differential Expression of Genes

More information

V16: involvement of micrornas in GRNs

V16: involvement of micrornas in GRNs What are micrornas? V16: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,

More information

Grand Rounds 6. Lesson Summary: Student Learning Objectives: Standards: Materials:

Grand Rounds 6. Lesson Summary: Student Learning Objectives: Standards: Materials: Grand Rounds 6 Lesson Summary: Building on the previous activity, students will present a summary of their patient case along with the lab results they found in a grand rounds fashion. This activity allows

More information

Human Genome Complexity, Viruses & Genetic Variability

Human Genome Complexity, Viruses & Genetic Variability Human Genome Complexity, Viruses & Genetic Variability (Learning Objectives) Learn the types of DNA sequences present in the Human Genome other than genes coding for functional proteins. Review what you

More information

High AU content: a signature of upregulated mirna in cardiac diseases

High AU content: a signature of upregulated mirna in cardiac diseases https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High

More information

Non-messenger RNAs. Karin Lagesen

Non-messenger RNAs. Karin Lagesen Non-messenger RNAs Karin Lagesen Outline RNA is not DNA Kinds of non-messenger RNAs sirna, mirna trnas, rrnas ncrnas: Finding non-messenger RNA trnascan-se, RNammer RFAM RNA basepairing RNA is not DNA

More information

RNA- seq Introduc1on. Promises and pi7alls

RNA- seq Introduc1on. Promises and pi7alls RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes

More information

MicroRNA and Male Infertility: A Potential for Diagnosis

MicroRNA and Male Infertility: A Potential for Diagnosis Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

RNA and Protein Synthesis Guided Notes

RNA and Protein Synthesis Guided Notes RNA and Protein Synthesis Guided Notes is responsible for controlling the production of in the cell, which is essential to life! o DNARNAProteins contain several thousand, each with directions to make

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

The Generation of Specific Immunity

The Generation of Specific Immunity The Generation of Specific Immunity Antibody structure! Antibodies classified by specificity (antigen, binding site) and class (general structure, function)! Differences in variable regions produce different

More information

Novel RNAs along the Pathway of Gene Expression. (or, The Expanding Universe of Small RNAs)

Novel RNAs along the Pathway of Gene Expression. (or, The Expanding Universe of Small RNAs) Novel RNAs along the Pathway of Gene Expression (or, The Expanding Universe of Small RNAs) Central Dogma DNA RNA Protein replication transcription translation Central Dogma DNA RNA Spliced RNA Protein

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information

Pailin Group Executive Search Assistant Investigator: Cancer Genetics, Epigenetics and Biomarkers Dallas, TX

Pailin Group Executive Search Assistant Investigator: Cancer Genetics, Epigenetics and Biomarkers Dallas, TX Pailin Group Executive Search Assistant Investigator: Cancer Genetics, Epigenetics and Biomarkers Dallas, TX An Assistant Investigator position is available for immediate recruitment for a highly motivated

More information

REGULATED AND NONCANONICAL SPLICING

REGULATED AND NONCANONICAL SPLICING REGULATED AND NONCANONICAL SPLICING RNA Processing Lecture 3, Biological Regulatory Mechanisms, Hiten Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice site consensus sequences do have

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms. PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs

More information

Interaktionen von RNAs und Proteinen

Interaktionen von RNAs und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig May 5, 2017 RNA-protein binding vs. DNA-protein binding Is binding of proteins to RNA the same as binding of proteins to DNA? Will the same rules

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects

More information

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,

More information

Sexual Reproduction. For most diploid eukaryotes, sexual reproduction is the only mechanism resulting in new members of a species.

Sexual Reproduction. For most diploid eukaryotes, sexual reproduction is the only mechanism resulting in new members of a species. Sex Determination Sexual Reproduction For most diploid eukaryotes, sexual reproduction is the only mechanism resulting in new members of a species. Meiosis in the sexual organs of parents produces haploid

More information

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during

More information

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA

More information

Processing of RNA II Biochemistry 302. February 13, 2006

Processing of RNA II Biochemistry 302. February 13, 2006 Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:

More information

Dissecting gene regulation network in human early embryos. at single-cell and single-base resolution

Dissecting gene regulation network in human early embryos. at single-cell and single-base resolution Dissecting gene regulation network in human early embryos at single-cell and single-base resolution Fuchou Tang BIOPIC, College of Life Sciences Peking University 07/10/2015 Cockburn and Rossant, 2010

More information

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture

More information

The Inheritance of Complex Traits

The Inheritance of Complex Traits The Inheritance of Complex Traits Differences Among Siblings Is due to both Genetic and Environmental Factors VIDEO: Designer Babies Traits Controlled by Two or More Genes Many phenotypes are influenced

More information

Eukaryotic small RNA Small RNAseq data analysis for mirna identification

Eukaryotic small RNA Small RNAseq data analysis for mirna identification Eukaryotic small RNA Small RNAseq data analysis for mirna identification P. Bardou, C. Gaspin, S. Maman, J. Mariette, O. Rué, M. Zytnicki INRA Sigenae Toulouse INRA MIA Toulouse GenoToul Bioinfo INRA MaIAGE

More information

MicroRNAs and metabolic programming

MicroRNAs and metabolic programming MicroRNAs and metabolic programming María Elizabeth Tejero, PhD National Institute of Genomic Medicine Mexico City May 25th 2016 Ø Introduction to non-coding RNAs Talk overview Ø Introduction to micrornas

More information

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice. Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper

More information

BIOLOGY. Regulation of Gene Expression CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson

BIOLOGY. Regulation of Gene Expression CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Regulation of Gene Expression Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick 2014 Pearson Education, Inc.

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Name: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization

Name: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization Name: Xueming Zhao Professional Title: Professor Telephone:86-010-62815892 Fax:86-010-62895971 E-mail: zhaoxueming@caas.cn Website: http://www.iascaas.net.cn/yjspy/dsjj/sssds/dwyzyzypz1/62040.htm Research

More information

Chapter 11 How Genes Are Controlled

Chapter 11 How Genes Are Controlled Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary

More information

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7 The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure

More information

The Blueprint of Life: DNA to Protein

The Blueprint of Life: DNA to Protein The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA

More information

Processing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm

Processing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm Processing of RNA II Biochemistry 302 February 14, 2005 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation (non proteincoding sequence) Discovered by P. Sharp

More information

Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C

Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription

More information

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ

More information

the future demands for animal-

the future demands for animal- Nutrigenomics a tool to meet the future demands for animal- derived d foods Mark Gaffney, Ph.D. Alltech Bioscience Center, Ireland 23 rd June 2011 Are we ready for 9 billion??? The World needs to double

More information

Profiling of MicroRNA Expression in Obese and Diabetic-Induced Mice for Biomarker Discovery

Profiling of MicroRNA Expression in Obese and Diabetic-Induced Mice for Biomarker Discovery Transactions on Science and Technology Vol. 4, No. 3-3, 391-395, 2017 Profiling of MicroRNA Expression in Obese and Diabetic-Induced Mice for Biomarker Discovery Janan N. Hadi, Mohammad Iqbal, Vijay Kumar

More information

Prediction of micrornas and their targets

Prediction of micrornas and their targets Prediction of micrornas and their targets Introduction Brief history mirna Biogenesis Computational Methods Mature and precursor mirna prediction mirna target gene prediction Summary micrornas? RNA can

More information

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit 15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional

More information

HOMOSEXYALITY AS A CONSEQUENCE OF EPIGENETICALLY CANALIZED SEXUAL DEVELOPMENT. W.R.Rice, U.Freiberg, S.Gavrilets. December 2012

HOMOSEXYALITY AS A CONSEQUENCE OF EPIGENETICALLY CANALIZED SEXUAL DEVELOPMENT. W.R.Rice, U.Freiberg, S.Gavrilets. December 2012 HOMOSEXYALITY AS A CONSEQUENCE OF EPIGENETICALLY CANALIZED SEXUAL DEVELOPMENT W.R.Rice, U.Freiberg, S.Gavrilets December 2012 Used terms: Epi-marks means changes in chromatin structure that influence the

More information

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018 DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018 Director:, DVM, Ph.D. 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve

More information

Comparative profiling of small RNAs of pig seminal plasma and ejaculated and. Running title: Pig sperm and seminal plasma small RNAs

Comparative profiling of small RNAs of pig seminal plasma and ejaculated and. Running title: Pig sperm and seminal plasma small RNAs Page 1 of 46 Reproduction Advance Publication first posted on 17 March 2017 as Manuscript REP-17-0014 1 2 Comparative profiling of small RNAs of pig seminal plasma and ejaculated and epididymal sperm 3

More information

Chapter 10 - Post-transcriptional Gene Control

Chapter 10 - Post-transcriptional Gene Control Chapter 10 - Post-transcriptional Gene Control Chapter 10 - Post-transcriptional Gene Control 10.1 Processing of Eukaryotic Pre-mRNA 10.2 Regulation of Pre-mRNA Processing 10.3 Transport of mrna Across

More information

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies

More information