Supplementary Table e-1. General characteristics of patients with nonmitochondrial

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

Supplementary Figure 1 a

Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

Supplementary Document

Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control

Supplementary Materials

Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

BIOLOGY 621 Identification of the Snorks

Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

Presentation and investigation of mitochondrial disease in children

Presentation and investigation of mitochondrial disease in children Andrew Morris Willink Unit, Manchester Mitochondrial function Carbohydrate Fat Respiratory chain Energy Mitochondria are the product

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015

Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

Mitochondrial Diseases

Mitochondrial Diseases Simon Heales SWIM Conference Taunton, November 29 th 2018 Respiratory Failure Cardiomyopathy Optic Atrophy / Retinitis Pigmentosa Seizures / Developmental delay Liver Failure Deafness

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

An Introduction to mitochondrial disease.

9 th September 2017 An Introduction to mitochondrial disease. Dr Andy Schaefer Consultant Neurologist and Clinical Lead NHS Highly Specialised Rare Mitochondrial Disease Service and Wellcome Trust Centre

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and

Supplementary Figures

Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging

MITOCHONDRIAL DISEASE. Amel Karaa, MD Mitochondrial Disease Program Massachusetts General Hospital

MITOCHONDRIAL DISEASE Amel Karaa, MD Mitochondrial Disease Program Massachusetts General Hospital Disclosures & Disclaimers United Mitochondrial Disease Foundation Research Grant North American Mitochondrial

Supplementary Figure 1

Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)

A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB

Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients

Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,

SUPPORTING INFORMATION

SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena

Nature Immunology: doi: /ni.3836

Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili

The mitochondrion and its disorders

100 PRACTICAL NEUROLOGY H O W T O U N D E R S T A N D I T The mitochondrion and its disorders Patrick F. Chinnery Department of Neurology, Regional Neurosciences Centre, Newcastle General Hospital and

Supplementary Figure 1a

Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results

www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:

PATIENTS AND METHODS. Subjects

PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients

Gaucher disease 3/22/2009. Mendelian pedigree patterns. Autosomal-dominant inheritance

Mendelian pedigree patterns Autosomal-dominant inheritance Autosomal dominant Autosomal recessive X-linked dominant X-linked recessive Y-linked Examples of AD inheritance Autosomal-recessive inheritance

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

The Organism as a system

The Organism as a system PATIENT 1: Seven-year old female with a history of normal development until age two. At this point she developed episodic vomiting, acidosis, epilepsy, general weakness, ataxia

HEPETIC SYSTEMS BIOCHEMICAL HEPATOCYTIC SYSTEM HEPATOBILIARY SYSTEM RETICULOENDOTHELIAL SYSTEM

EVALUATION OF LIVER FUNCTION R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty HEPETIC SYSTEMS BIOCHEMICAL HEPATOCYTIC SYSTEM HEPATOBILIARY SYSTEM RETICULOENDOTHELIAL SYSTEM METABOLIC FUNCTION

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code

Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza

Biochemistry of cellular organelles

Kontinkangas, L101A Biochemistry of cellular organelles Lectures: 1. Membrane channels; 2. Membrane transporters; 3. Soluble lipid/metabolite-transfer proteins; 4. Mitochondria as cellular organelles;

MITOCHONDRIAL DISORDERS IN NEUROLOGY

MITOCHONDRIAL DISORDERS IN NEUROLOGY Michio Hirano, MD Columbia University Medical Center New York, NY In the opening lecture of this course, Dr. Eric Schon will describe the molecular genetic and pathogenic

Chemistry Reference Ranges and Critical Values

Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

Chemistry Reference Ranges and Critical Values

Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.

Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking

Monitoring Hepatitis C

Monitoring Hepatitis C Section Six Monitoring Hepatitis C Screening for hepatitis C is not routinely done, so you may have to request a test from your medical provider. This usually involves an antibody

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR

CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect

Referring Physician Information Name: (Last, First, Middle):

Page 1 of 5 Patient Information Clinical Indication: Patient Name: (Last, First, Middle): DOB (M/D/Y): Sex: M F Guardian Name (for minor patients only): Address: City: State: ZIP: Phone: Ethnic Background

*To whom correspondence should be addressed. This PDF file includes:

www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,

What do you think of when you here the word genome?

What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment

A basic helix loop helix transcription factor controls cell growth

A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources

Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3

Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and

Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health

Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour

Viral hepatitis, which affects half a billion people

GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor

Supplementary Materials and Methods

DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze

Investigating and Referring Incidental Findings of Abnormal Liver Tests

Investigating and Referring Incidental Findings of Abnormal Liver Tests Note on Referral Guidelines: these revised guidelines are presented as a tool to aid appropriate referral and management of common

I have no disclosures relevant to this presentation LIVER TESTS: WHAT IS INCLUDED? LIVER TESTS: HOW TO UTILIZE THEM OBJECTIVES

LIVER TESTS: HOW TO UTILIZE THEM I have no disclosures relevant to this presentation José Franco, MD Professor of Medicine, Surgery and Pediatrics Medical College of Wisconsin OBJECTIVES Differentiate

Integration Solutions

Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide

Hepatocytes produce. Proteins Clotting factors Hormones. Bile Flow

R.J.Bailey MD Hepatocytes produce Proteins Clotting factors Hormones Bile Flow Trouble.. for the liver! Trouble for the Liver Liver Gall Bladder Common Alcohol Hep C Fatty Liver Cancer Drugs Viruses Uncommon

In the past 13 years, a new chapter of human genetics, mitochondrial genetics, has opened

ARTICLE The Other Human Genome Alan L. Shanske, MD; Sara Shanske, PhD; Salvatore DiMauro, MD In the past 13 years, a new chapter of human genetics, mitochondrial genetics, has opened up and is becoming

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10

J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By

Supplementary Information

Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

Supplementary Figure 1

Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated

BASED ON A PAPER READ TO SEC77ON OF PAEDIATRICS, 25 JANUARY Table 1. Disease

The investigation of mitochondrial respiratory chain disease A A M Morris MRCP M J Jackson MRCP L A Bindoff MD MRCP D M Turnbull MD FRCP J R Soc Med 1995;88:217P-222P Keywords: mitochondria; respiratory

Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia

elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The

Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.

Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,

Finding protein sites where resistance has evolved

Finding protein sites where resistance has evolved The amino acid (Ka) and synonymous (Ks) substitution rates Please sit in row K or forward The Berlin patient: first person cured of HIV Contracted HIV

7 Medical Genetics. Hemoglobinopathies. Hemoglobinopathies. Protein and Gene Structure. and Biochemical Genetics

SESSION 7 Medical Genetics Hemoglobinopathies and Biochemical Genetics J a v a d F a s a J a m s h i d i U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 Hemoglobinopathies

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed

Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in

Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/10/473/eaai7696/dc1 Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions

Glecaprevir-Pibrentasvir in Non-Cirrhotic Genotype 2 ENDURANCE-2

Phase 3 Treatment Naïve or Experienced Glecaprevir-Pibrentasvir in Non-Cirrhotic Genotype 2 ENDURANCE-2 *ENDURANCE-2: Study Features ENDURANCE-2 Trial Design: Randomized, double-blind, placebo-controlled

Supplementary materials

Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark

Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark Study of Prognosis of PSC Difficulties: Disease is rare The duration of the course of disease may be very

Copy Number Analysis of Complement C4A, C4B and C4A Silencing Mutation by Real-Time Quantitative Polymerase Chain Reaction

Copy Number Analysis of Complement C4A, C4B and C4A Silencing Mutation by Real-Time Quantitative Polymerase Chain Reaction Riitta Paakkanen 1,2 *, Hanna Vauhkonen 1, Katja T. Eronen 1, Asko Järvinen 3,

MUTATIONS, MUTAGENESIS, AND CARCINOGENESIS. (Start your clickers)

MUTATIONS, MUTAGENESIS, AND CARCINOGENESIS (Start your clickers) How do mutations arise? And how do they affect a cell and its organism? Mutations: heritable changes in genes Mutations occur in DNA But

The Cell T H E C E L L C Y C L E C A N C E R

The Cell T H E C E L L C Y C L E C A N C E R Nuclear envelope Transcription DNA RNA Processing Pre-mRNA Translation mrna Nuclear pores Ribosome Polypeptide Transcription RNA is synthesized from DNA in

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

Supplementary Data. Clinical Setup. References. Program for Embryo Donation

Supplementary Data Clinical Setup Notwithstanding their value in stem cell research, the source of supernumerary human blastocysts for the derivation of new stem cell lines and the modalities of their

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH

Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott

Mutation analysis of a Chinese family with oculocutaneous albinism

/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia

Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still

157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

Approach to the Patient with Liver Disease

Approach to the Patient with Liver Disease Diagnosis of liver disease Careful history taking Physical examination Laboratory tests Radiologic examination and imaging studies Liver biopsy Liver diseases