CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
|
|
- Cory Warner
- 5 years ago
- Views:
Transcription
1 CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved.
2 PACBIO SMRT SEQUENCING Long Reads average 10 to 15 kb High Consensus Accuracy random errors produce QV50 consensus Uniform, Unbiased Coverage no GC% or sequence complexity bias Sequel System Epigenetic Characterization simultaneous detection of DNA methylation
3 APPLICATIONS OF SMRT SEQUENCING De novo genome assembly Full isoform sequencing Epigenetic characterization Minor variant discovery Structural variant discovery Sequel System Targeted sequencing
4 APPLICATIONS OF SMRT SEQUENCING De novo genome assembly Full isoform sequencing Epigenetic characterization Minor variant discovery Structural variant discovery Sequel System Targeted sequencing
5 cumulative percent VARIATION IN A HUMAN GENOME HG00733 SNVs 100% indels 50 bp structural variants (SVs) 80% 60% 60% 40% base pairs 20% count 0.5% 0% ,000 10, ,000 variant size (bp) Chaisson et al. (2017) biorxiv. doi: /
6 TYPES OF STRUCTURAL VARIATION deletion insertion duplication inversion translocation repeat expansion
7 STRUCTURAL VARIANTS AND DISEASE Schizophrenia Carney complex repeat expansion disorders Poor drug metabolism Breast & ovarian cancer Neurofibromatosis Chronic myeloid leukemia Richards et al. (2013) Front Mol Neurosci. doi: /fnmol
8 TECHNOLOGY TO DETECT STRUCTURAL VARIANTS Deletions Insertions Missed PacBio Illumina repeats + large insertions Bionano variants 1.5 kb 0 5,000 10,000 15,000 20,000 25,000 structural variants Chaisson et al. (2017) biorxiv. doi: /
9 A move forward to full-spectrum SV detection... will increase the diagnostic yield in patients with genetic disease, SV-mediated mutation, and repeat expansions. Chaisson et al. (2017) biorxiv. doi: /
10 PacBio Long-Read WGS for Structural Variant Discovery Targeted Enrichment without Amplification and SMRT Sequencing of Repeat-Expansion Disease Causative Genomic Regions
11 PacBio Long-Read WGS for Structural Variant Discovery Targeted Enrichment without Amplification and SMRT Sequencing of Repeat-Expansion Disease Causative Genomic Regions
12 FOR MORE INFORMATION PACB.COM/SV
13 WGS FOR STRUCTURAL VARIANT DISCOVERY Structural Variants Small Variants Sequencing PacBio Sequel System Short-read NGS Read Mapping NGMLR BWA Variant Calling pbsv GATK Visualization IGV 2.4 IGV
14 WGS FOR STRUCTURAL VARIANT DISCOVERY Structural Variants Small Variants Sequencing PacBio Sequel System Short-read NGS Read Mapping NGMLR BWA Variant Calling pbsv GATK Visualization IGV 2.4 IGV
15 SEQUENCING Library Preparation 5 µg DNA 20 kb shear + damage repair SMRTbell adapter ligation 15 kb size selection
16 SEQUENCING Sequencing polymerase binding Sequel System (5 Gb per SMRT Cell)
17 WGS FOR STRUCTURAL VARIANT DISCOVERY Structural Variants Small Variants Sequencing PacBio Sequel System Short-read NGS Read Mapping NGMLR BWA Variant Calling pbsv GATK Visualization IGV 2.4 IGV
18 penalty READ MAPPING reference biological indel affine (BWA) convex (NGMLR) PacBio read gap size BWA NGMLR Sedlazeck et al. (2017) biorxiv. doi: /
19 WGS FOR STRUCTURAL VARIANT DISCOVERY Structural Variants Small Variants Sequencing PacBio Sequel System Short-read NGS Read Mapping NGMLR BWA Variant Calling pbsv GATK Visualization IGV 2.4 IGV
20 VARIANT CALLING FIND SV SIGNATURES CLUSTER SV SIGNATURES FILTER SUMMARIZE INTO SV GENOTYPE CIGAR D & I 50 bp nearby with similar sequence 2 and 20% reads support consensus of supporting reads supporting reads / covering reads
21 VARIANT CALLING FIND SV SIGNATURES CLUSTER SV SIGNATURES FILTER SUMMARIZE INTO SV GENOTYPE CIGAR D & I 50 bp nearby with similar sequence 2 and 20% reads support consensus of supporting reads supporting reads / covering reads
22 VARIANT CALLING FIND SV SIGNATURES CLUSTER SV SIGNATURES FILTER SUMMARIZE INTO SV GENOTYPE CIGAR D & I 50 bp nearby with similar sequence 2 and 20% reads support consensus of supporting reads supporting reads / covering reads
23 VARIANT CALLING FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence FILTER 2 and 20% reads support 1 of 10 4 of 10 SUMMARIZE INTO SV consensus of supporting reads GENOTYPE supporting reads / covering reads
24 VARIANT CALLING FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence FILTER 2 and 20% reads support 1 of 10 4 of 10 SUMMARIZE INTO SV consensus of supporting reads 329 bp deletion GENOTYPE supporting reads / covering reads
25 VARIANT CALLING FIND SV SIGNATURES CIGAR D & I 50 bp CLUSTER SV SIGNATURES nearby with similar sequence FILTER 2 and 20% reads support 1 of 10 4 of 10 SUMMARIZE INTO SV consensus of supporting reads 329 bp deletion GENOTYPE supporting reads / covering reads heterozygous (4 of 10)
26 VARIANT CALLING SMRT Analysis SMRT Analysis chr ACGCGGCCGCCTCC TCCTCCGAACGTGGCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGAACGCGGCCGCCTCCTCCTCCGA A PASS IMPRECISE;SVTY PE=DEL;END=904587;SVLEN=-97;SVANN=TANDEM GT:AD:DP 0/1:9:15 SMRT Analysis SMRT Analysis
27 WGS FOR STRUCTURAL VARIANT DISCOVERY Structural Variants Small Variants Sequencing PacBio Sequel System Short-read NGS Read Mapping NGMLR BWA Variant Calling pbsv GATK Visualization IGV 2.4 IGV
28 VISUALIZATION insertion deletion Robinson et al. (2011) Nature Biotechnology. doi: /nbt.1754.
29 WGS FOR STRUCTURAL VARIANT DISCOVERY Structural Variants Small Variants Sequencing PacBio Sequel System Short-read NGS Read Mapping NGMLR BWA Variant Calling pbsv GATK Visualization IGV 2.4 IGV
30 % SVs detected HOW MUCH TO SEQUENCE? 100% 90% 80% 70% 60% 50% 40% Het Hom Human HG00733 Sequel System 211 Gb (70-fold) 30% 20% short read 10% 0% Coverage 5- to 10-fold optimal tradeoff of cost vs. performance disease gene discovery; population characterization 30- to 40-fold saturate discovery de novo variant discovery
31 CLINICAL CASE HISTORY 7 yrs 10 yrs left atrial myxoma resection, atrial repair testicular mass, right orchiectomy 13 yrs pituitary tumor 16 yrs 18 yrs 19 yrs recurrence of myxomata, resection, adrenal microadenoma recurrence of ventricular myxomata, resection, VT ACTH-independent Cushing s disease, thyroid nodules genetics suggests Carney complex PRKAR1A testing negative 21 yrs transphenoidal resection of pituitary present (26 yrs) recurrence of myxomata, consideration for heart transplant short-read whole genome sequencing negative Merker et al. (2017) Genetics in Medicine. doi: /gim
32 % SVs detected EVALUATING STRUCTURAL VARIANTS Deletions Insertions Initial call set 6,971 6, % 90% 8-fold 80% 70% 60% 50% 40% 30% 20% 10% Het Hom Merker et al. (2017) Genetics in Medicine. doi: /gim % Coverage
33 % SVs detected EVALUATING STRUCTURAL VARIANTS Deletions Insertions Initial call set 6,971 6,821 Not in segdup 5,893 6, % 8-fold Not in NA12878 healthy control Overlaps RefSeq coding exon 2,476 3, % 80% 70% 60% 50% 40% Het Hom Gene linked to some disease in OMIM % 20% 10% Merker et al. (2017) Genetics in Medicine. doi: /gim % Coverage
34 HETEROZYGOUS 2.2 KB DELETION IN PRKAR1A PacBio discovery Sanger confirmation Merker et al. (2017) Genetics in Medicine. doi: /gim
35
36 PacBio Long-Read WGS for Structural Variant Discovery Targeted Enrichment without Amplification and SMRT Sequencing of Repeat-Expansion Disease Causative Genomic Regions
37 REPEAT EXPANSION DISEASES
38 CRISPR/CAS9 SYSTEM Bacterial Adaptive Immunity RNA-guided DNA Endonuclease Some in vivo applications: - Gene silencing - Homology-directed repair - Transient gene silencing or transcriptional repression - Transient activation of endogenous genes - Transgenic animals and embryonic stem cells
39 PCR-FREE TARGET ENRICHMENT VIA CAS9
40 COVERAGE ACROSS THE GENOME 1 SMRT Cell (PacBio RS II)
41 HUNTINGTON S DISEASE (HD) - Autosomal dominant neurodegenerative genetic disorder - Caused by an expansion of a CAG triplet repeat stretch in the Huntingtin (HTT) gene - polyglutamine tract
42
43 CAG REPEAT COUNTS
44 CAG REPEAT COUNTS IN HD PATIENTS Widening repeat number distribution at the mutated allele is biological Obtained roughly equal number of sequenced molecules for normal and mutated alleles Samples obtained from Vanessa Wheeler (Harvard Medical School)
45
46 FRAGILE X SYNDROME - Most common heritable form of cognitive impairment - Caused by expansion of a CGG trinucleotide repeat in the 5 UTR of the FMR1 gene fraxa.org
47 AGG INTERRUPTIONS REDUCE THE CHANCES OF PRE- TO FULL MUTATION TRANSMISSION CGG CGG CGG CGG AGG CGG Difference in risk is greatest near CGG repeats Having full sequence information is medically relevant 80% 60% 15% Yrigollen et al. (2012) Genet Med Maternal CGG repeat number 2 CGG CGG CGG CGG AGG CGG CGG CGG CGG CGG CGG CGG CGG CGG AGG CGG 1 CGG CGG CGG CGG AGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG 0 CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG CGG Yrigollen et al. (2012) Genet Med 14:
48
49
50 SUBREAD COVERAGE ON THE SEQUEL SYSTEM 1 Sequel SMRT Cell 1M
51 MULTIPLEXED SAMPLES ON THE SEQUEL SYSTEM CAG Repeat Counts from 3 Controls and 3 HD Patients
52 CONCLUSION Amplification-free enrichment with CRISPR/Cas9 and SMRT Sequencing achieves the base-level resolution required to understand the underlying biology of repeat expansion disorders - Target any hard-to-amplify genomic region regardless of sequence context - Avoid PCR bias and PCR errors - Accurately sequence through long repetitive and low-complexity regions - Count repeats and identify sequence interruptions - Detect sample mosaicism
53 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California, Inc. All rights reserved. Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, SMRTbell, Iso-Seq, and Sequel are trademarks of Pacific Biosciences. BluePippin and SageELF are trademarks of Sage Science. NGS-go and NGSengine are trademarks of GenDx. FEMTO Pulse and Fragment Analyzer are trademarks of Advanced Analytical Technologies. All other trademarks are the sole property of their respective owners.
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationBinding Calculator Parameters
Binding Calculator Parameters Quick Reference Card The Binding Calculator assists in sample preparation by providing instructions for primer annealing, polymerase binding and sample loading based on the
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationSVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationDetection of low-frequent mitochondrial DNA variants using SMRT sequencing
Detection of low-frequent mitochondrial DNA variants using SMRT sequencing Marjolein J.A. Weerts SMRT Leiden 2018 June 13 Content Mitochondrial DNA & liquid biopsy in oncology Pitfalls when studying human
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationLEIDEN, THE NETHERLANDS
Full-length CYP2D6 diplotyping for better drug dosage and response management Henk Buermans, PhD Leiden University Medical Center Human Genetics, LGTC LEIDEN, THE NETHERLANDS CYP2D6 Function Metabolism
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationComprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing
Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Maria Nattestad Schatz + McCombie + Hicks at Cold Spring Harbor Laboratory McPherson
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationORIGINAL RESEARCH ARTICLE American College of Medical Genetics and Genomics
ORIGINAL RESEARCH ARTICLE American College of Medical Genetics and Genomics Molecular genetic testing for fragile X syndrome: laboratory performance on the College of American Pathologists proficiency
More informationCalling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017
1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationMMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco
MMB (MGPG) 2017 Non traditional Inheritance Epigenetics A.Turco NON TRADITIONAL INHERITANCE EXCEPTIONS TO MENDELISM - Genetic linkage (2 loci close to each other) - Complex or Multifactorial Disease (MFD)
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationGenetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationHLA and new technologies. Vicky Van Sandt
HLA and new technologies. Vicky Van Sandt Life-threatning malignant and non malignant blood disorders can be cured by hematopoetic stem cell transplantation (HSCT). GVHD is the 2nd most prevalent cause
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
More informationDeep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationRapid genomic screening of embryos using nanopore sequencing
Rapid genomic screening of embryos using nanopore sequencing Daniel J Turner, PhD Senior Director of Applications Oxford Nanopore Technologies Forman EJ & Scott RT Jr Contemporary OB/GYN () 2014 Euploid
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationFragile X full mutation expansions are inhibited by one or more AGG interruptions in premutation carriers
American College of Medical Genetics and Genomics Original Research Article Open Fragile X full mutation expansions are inhibited by one or more AGG interruptions in premutation carriers Sarah L. Nolin,
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGlobal assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping
RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank
More informationCPT Codes for Pharmacogenomic Tests
CPT s for Pharmacogenomic Tests The table below lists CPT codes and lab fee information for pharmacogenomic tests as established by the Centers for Medicare and Medicaid Services. It was compiled by the
More informationSUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.
SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationFragile X One gene, three very different disorders for which Genetic Technology is essential. Significance of Fragile X. Significance of Fragile X
Fragile X One gene, three very different disorders for which Genetic Technology is essential Martin H. Israel Margaret E. Israel mhi@wustl.edu meisrael@sbcglobal.net uel L. Israel Association of Genetic
More informationNGS in neurodegenerative disorders - our experience
Neurology Clinic, Clinical Center of Serbia Faculty of Medicine, University of Belgrade Belgrade, Serbia NGS in neurodegenerative disorders - our experience Marija Branković, MSc Belgrade, 2018 Next Generation
More informationVictor Guryev. European Research Institute for the Biology of Ageing
Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam /a /g Low coverage whole genome and deep
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationPopulation Screening for Fragile X Syndrome
Population Screening for Fragile X Syndrome FLORA TASSONE PH.D. DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR MEDICINE AND MIND INSTITUTE UC DAVIS, CALIFORNIA USA Molecular Pathology: Principles in Clinical
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationPSSV User Manual (V2.1)
PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationPSSV User Manual (V1.0)
PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationProteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Translational Gastrointestinal Oncology Collect clinical samples (Tumor) tissue Blood Stool
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationTP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
More informationSupplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationInference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
More informationStudying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy
Kavya Puchhalapalli CALS Honors Project Report Spring 2017 Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Abstract Malignant brain tumors including medulloblastomas and primitive neuroectodermal
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationTOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationSingle-Cell Sequencing in Cancer. Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018
Single-Cell Sequencing in Cancer Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018 Lecture will focus on technology for and applications of single-cell RNA-seq
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More informationNature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationReducing INDEL calling errors in whole genome and exome sequencing data.
Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max
More information