Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
|
|
- Prosper Malone
- 5 years ago
- Views:
Transcription
1 Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
2 Schizophrenia - background Common, complex brain disorder Presents with a significant heterogeneity of symptoms psychotic symptoms delusions and hallucinations negative symptoms affective flattening, alogia and avolition Cognitive deficits working memory, attention Age of onset: males between the age of 16 and 30 females largely presenting after the age of 30 Variable course of illness and complete remission is probably uncommon
3 Schizophrenia - background Chronic debilitating Devastating for individual, family and society Life expectancy reduced by 10 years ~20% of affected in full time employment Substantial societal burden from disease Biology poorly understood and treatments partially effective Higher incidence in men
4 Heritability of Schizophrenia
5 International Schizophrenia Consortium (ISC) GWAS study
6
7 Chromosomal Deletions Large chromosomal deletions (100Kb 3Mb) occur more frequently in schizophrenia cases compared to normal healthy controls Most of these deletions are spread across the genome and do not yet implicate specific genes in schizophrenia However, some schizophrenia deletions do cluster at certain regions, implicating specific genes in the illness
8
9 Where are the rest of the risk genes? Few replicated common SNPs for schizophrenia
10 Challenges for common disorders
11 How do we find the disease causing rare variants? Sequence whole genomes: Expensive! Sample number required for statistical power means huge costs A large portion of the genome will be non-functional and unlikely to harbour risk mutations From Mendelian disease, we know that (i) mutations causing amino acid changes account for ~60% of disease mutations (ii) small indels in genes account for ~25% of disease mutations (iii) <1% of disease mutations have been found in regulatory regions
12 Target Enrichment Best compromise Sequence portions of the genome Genomic regions of interest e.g. genes/promoters etc. Exome
13 The logical extension of sample pooling is to perform multiplexed target enrichments in which many samples are barcoded before capture
14
15 <3µg Library Preparation Ilumina SE/PE SOLiD Hybridization / Capture 0.5µg 24 hours Baits: - crna probes - Long (120bp) - Biotin labeled - User-defined (earray) - SurePrint synthesis Bead Separation Wash / Elution / Amp Page 15
16 Whole Genome Whole Exome N=200 genes 1 sample per flowcell 8 samples per flowcell 100+ samples per flowcell x3 Illumina flowcell 3Gb sequence post QC and alignment 25K per genome (direct consumables cost) 2.5K per exome (direct consumables cost) 250 per sample (direct consumables cost)
17 How to barcode/index samples?
18 Sequencing Library prep 5 3 Shear Sonicate End Repair T4 and Klenow DNA polymerases, T4 PNK Add A Base Klenow exo _ 5 A A A 3 3 A A A 5
19 Ligation of adapters 5 3 T 5 A A 5 T T A A T 3 5
20 Ligation of indexed adapters 5 3 T A A T T A A T 3 5
21 Indexing /Barcoding of DNA Samples AACCAT CAACCT GCATGT TCAGTT Target Enrichment (single Agilent SureSelect rxn) Sequencing (single lane of an Illumina GA II)
22 Sequencing Output: indexed 40bp reads AACCATTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA AACCATTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTCGATATA CAACCTTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA GCATGTTCCGTGTACTGACTGCTCGATATA Separate reads and analyze on a per-individual basis AACCATTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA CAACCTTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA SNP Detection GCATGTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA CNV Detection
23 SureSelect pilot study: combine indexed samples and target enrich using 1 capture library Targeted resequencing of 9 HapMap samples Single non-indexed sample library Single indexed sample library 3-index sample library 9-index sample library
24 Sequence coverage across PTBP2 for indexed vs non-indexed sample
25 Results: Number of sequence reads per indexed sample in sequenced libraries (pre-alignment to reference genome) 3 samples Median coverage of 41x 9 samples Median coverage of 11x Overall SNP concordance >99%
26 Target enrichment achieved non-index sample 1-index sample 3-index sample 1 9-index sample 1 Percentage reads in targeted 20% 22% 23% 19% regions +/- 50bp 2 Fold enrichment in targeted regions 3 Percentage Target bases 98% 98% 98% 93% Covered 4 Median Coverage of Target 5 169x 6 93x 6 41x 11x 1 Average values given for multi-sample libraries. 2 Number of reads uniquely mapping to the target region (+/-50bp) as a % of the number of reads uniquely mapping to hg18. 3 (Sequence reads uniquely mapping to the target regions/sequence reads mapping to hg18) x Maximum Enrichment where Maximum Enrichment is a ratio of genome length (3,080,419,510bp) to target length (377388bp) 4 Percentage of target bases covered by at least one sequence read 5 (Number of 34bp reads matching target x 34)/target length 6 The difference in median read coverage between the non-indexed and indexed sample is reflective of the higher number of clusters on the flowcell and also the higher number of clusters passing QC filters in the non-indexed sample (83.48% vs 57.65%,
27 CNV detection Targeted 17 CNVs known to be polymorphic in Hapmap samples
28 CNV detection in raw data: 9-index sample Known CNV region targeted on chr 22 Strong correlation between sequence coverage and CNV genotype in the indexed samples (rho=1, p<0.0005)
29 Development of CNV detection algorithm In cases were raw read number not even across indexed samples- how to identify CNVs?
30 Development of CNV detection algorithm Step 1: Normalise read counts
31 Development of CNV detection algorithm Step 2: Identify regions where normalised read counts differ significantly between samples
32 Application to schizophrenia and autism Agilent earray Design Coding Exons (210 genes): 687,784bp Expanded Exons: 742,017bp exons <121bp in size were expanded to 121bp so that all exonic sequenced would be targeted by 2 crna baits Baited sequence: 1,033,568bp Coverage of exons by crna baits: 98%
33 How many DNA samples can be indexed in a single enrichment and sequencing reaction? Specificity and sensitivity of enrichment rxn (target = ~1Mb) samples per lane Quantity of sequence reads post QC and alignment (80bp PE seq)
34 Acknowledgements Dr Derek Morris Dr Paul Cormican Dr Eleisa Heron William Gilks Sarah Furlong Dr Colm O Dushlaine Dr Carlos Pinto Dr Ric Anney Dr Aiden Corvin Dr Louise Gallagher Prof Michael Gill
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationBack to the Basics: Methyl-Seq 101
Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationDetection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11396 A total of 2078 samples from a large sequencing project at decode were used in this study, 219 samples from 78 trios with two grandchildren who were not also members of other trios,
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationImplementation of the DDD/ClinGen OGT (CytoSure v3) Microarray
Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationTOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationAgilent s Copy Number Variation (CNV) Portfolio
Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human
More informationOn Missing Data and Genotyping Errors in Association Studies
On Missing Data and Genotyping Errors in Association Studies Department of Biostatistics Johns Hopkins Bloomberg School of Public Health May 16, 2008 Specific Aims of our R01 1 Develop and evaluate new
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationCopy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015
Copy Number Varia/on Detec/on Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Today s Goals Understand the applica5on and capabili5es of using targe5ng sequencing and CNV calling
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationIdentification of genomic alterations in cervical cancer biopsies by exome sequencing
Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,
More informationPROGRESS: Beginning to Understand the Genetic Predisposition to PSC
PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0298 TITLE: MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families PRINCIPAL INVESTIGATOR: Xudong Liu, PhD CONTRACTING
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationMapping by recurrence and modelling the mutation rate
Mapping by recurrence and modelling the mutation rate Shamil Sunyaev Broad Institute of M.I.T. and Harvard Current knowledge is from Comparative genomics Experimental systems: yeast reporter assays Potential
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationVan test naar diagnose naar
Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
More informationPG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationFor the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationUNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science
More informationncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
More informationVictor Guryev. European Research Institute for the Biology of Ageing
Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam /a /g Low coverage whole genome and deep
More information!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&
!!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'[!!
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationImplementation of BRCA Oncomine panel for germline and somatic variant analysis
Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University
More informationSureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationCNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.
Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More informationStructural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill
Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)
More informationSelective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
More informationSession 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationAnalysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing
www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationComprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans
Haraksingh et al. BMC Genomics (2017) 18:321 DOI 10.1186/s12864-017-3658-x RESEARCH ARTICLE Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationSingle-Cell Sequencing in Cancer. Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018
Single-Cell Sequencing in Cancer Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018 Lecture will focus on technology for and applications of single-cell RNA-seq
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationThe Importance of Coverage Uniformity Over On-Target Rate for Efficient Targeted NGS
WHITE PAPER The Importance of Coverage Uniformity Over On-Target Rate for Efficient Targeted NGS Yehudit Hasin-Brumshtein, Ph.D., Maria Celeste M. Ramirez, Ph.D., Leonardo Arbiza, Ph.D., Ramsey Zeitoun,
More informationGlobal assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping
RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank
More informationncounter Data Analysis Guidelines for Copy Number Variation (CNV) Molecules That Count NanoString Technologies, Inc.
ncounter Data Analysis Guidelines for Copy Number Variation (CNV) NanoString Technologies, Inc. 530 Fairview Ave N Suite 2000 Seattle, Washington 98109 www.nanostring.com Tel: 206.378.6266 888.358.6266
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More information