Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Size: px
Start display at page:

Download "Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection"

Transcription

1 Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

2 Schizophrenia - background Common, complex brain disorder Presents with a significant heterogeneity of symptoms psychotic symptoms delusions and hallucinations negative symptoms affective flattening, alogia and avolition Cognitive deficits working memory, attention Age of onset: males between the age of 16 and 30 females largely presenting after the age of 30 Variable course of illness and complete remission is probably uncommon

3 Schizophrenia - background Chronic debilitating Devastating for individual, family and society Life expectancy reduced by 10 years ~20% of affected in full time employment Substantial societal burden from disease Biology poorly understood and treatments partially effective Higher incidence in men

4 Heritability of Schizophrenia

5 International Schizophrenia Consortium (ISC) GWAS study

6

7 Chromosomal Deletions Large chromosomal deletions (100Kb 3Mb) occur more frequently in schizophrenia cases compared to normal healthy controls Most of these deletions are spread across the genome and do not yet implicate specific genes in schizophrenia However, some schizophrenia deletions do cluster at certain regions, implicating specific genes in the illness

8

9 Where are the rest of the risk genes? Few replicated common SNPs for schizophrenia

10 Challenges for common disorders

11 How do we find the disease causing rare variants? Sequence whole genomes: Expensive! Sample number required for statistical power means huge costs A large portion of the genome will be non-functional and unlikely to harbour risk mutations From Mendelian disease, we know that (i) mutations causing amino acid changes account for ~60% of disease mutations (ii) small indels in genes account for ~25% of disease mutations (iii) <1% of disease mutations have been found in regulatory regions

12 Target Enrichment Best compromise Sequence portions of the genome Genomic regions of interest e.g. genes/promoters etc. Exome

13 The logical extension of sample pooling is to perform multiplexed target enrichments in which many samples are barcoded before capture

14

15 <3µg Library Preparation Ilumina SE/PE SOLiD Hybridization / Capture 0.5µg 24 hours Baits: - crna probes - Long (120bp) - Biotin labeled - User-defined (earray) - SurePrint synthesis Bead Separation Wash / Elution / Amp Page 15

16 Whole Genome Whole Exome N=200 genes 1 sample per flowcell 8 samples per flowcell 100+ samples per flowcell x3 Illumina flowcell 3Gb sequence post QC and alignment 25K per genome (direct consumables cost) 2.5K per exome (direct consumables cost) 250 per sample (direct consumables cost)

17 How to barcode/index samples?

18 Sequencing Library prep 5 3 Shear Sonicate End Repair T4 and Klenow DNA polymerases, T4 PNK Add A Base Klenow exo _ 5 A A A 3 3 A A A 5

19 Ligation of adapters 5 3 T 5 A A 5 T T A A T 3 5

20 Ligation of indexed adapters 5 3 T A A T T A A T 3 5

21 Indexing /Barcoding of DNA Samples AACCAT CAACCT GCATGT TCAGTT Target Enrichment (single Agilent SureSelect rxn) Sequencing (single lane of an Illumina GA II)

22 Sequencing Output: indexed 40bp reads AACCATTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA AACCATTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTCGATATA CAACCTTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA GCATGTTCCGTGTACTGACTGCTCGATATA Separate reads and analyze on a per-individual basis AACCATTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA AACCATTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA CAACCTTCCGTGTACTGACTGCTCGATATA CAACCTTCCGTGTACTGACTGCTCGATCTA SNP Detection GCATGTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA GCATGTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA TCAGTTTCCGTGTACTGACTGCTCGATATA CNV Detection

23 SureSelect pilot study: combine indexed samples and target enrich using 1 capture library Targeted resequencing of 9 HapMap samples Single non-indexed sample library Single indexed sample library 3-index sample library 9-index sample library

24 Sequence coverage across PTBP2 for indexed vs non-indexed sample

25 Results: Number of sequence reads per indexed sample in sequenced libraries (pre-alignment to reference genome) 3 samples Median coverage of 41x 9 samples Median coverage of 11x Overall SNP concordance >99%

26 Target enrichment achieved non-index sample 1-index sample 3-index sample 1 9-index sample 1 Percentage reads in targeted 20% 22% 23% 19% regions +/- 50bp 2 Fold enrichment in targeted regions 3 Percentage Target bases 98% 98% 98% 93% Covered 4 Median Coverage of Target 5 169x 6 93x 6 41x 11x 1 Average values given for multi-sample libraries. 2 Number of reads uniquely mapping to the target region (+/-50bp) as a % of the number of reads uniquely mapping to hg18. 3 (Sequence reads uniquely mapping to the target regions/sequence reads mapping to hg18) x Maximum Enrichment where Maximum Enrichment is a ratio of genome length (3,080,419,510bp) to target length (377388bp) 4 Percentage of target bases covered by at least one sequence read 5 (Number of 34bp reads matching target x 34)/target length 6 The difference in median read coverage between the non-indexed and indexed sample is reflective of the higher number of clusters on the flowcell and also the higher number of clusters passing QC filters in the non-indexed sample (83.48% vs 57.65%,

27 CNV detection Targeted 17 CNVs known to be polymorphic in Hapmap samples

28 CNV detection in raw data: 9-index sample Known CNV region targeted on chr 22 Strong correlation between sequence coverage and CNV genotype in the indexed samples (rho=1, p<0.0005)

29 Development of CNV detection algorithm In cases were raw read number not even across indexed samples- how to identify CNVs?

30 Development of CNV detection algorithm Step 1: Normalise read counts

31 Development of CNV detection algorithm Step 2: Identify regions where normalised read counts differ significantly between samples

32 Application to schizophrenia and autism Agilent earray Design Coding Exons (210 genes): 687,784bp Expanded Exons: 742,017bp exons <121bp in size were expanded to 121bp so that all exonic sequenced would be targeted by 2 crna baits Baited sequence: 1,033,568bp Coverage of exons by crna baits: 98%

33 How many DNA samples can be indexed in a single enrichment and sequencing reaction? Specificity and sensitivity of enrichment rxn (target = ~1Mb) samples per lane Quantity of sequence reads post QC and alignment (80bp PE seq)

34 Acknowledgements Dr Derek Morris Dr Paul Cormican Dr Eleisa Heron William Gilks Sarah Furlong Dr Colm O Dushlaine Dr Carlos Pinto Dr Ric Anney Dr Aiden Corvin Dr Louise Gallagher Prof Michael Gill

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Back to the Basics: Methyl-Seq 101

Back to the Basics: Methyl-Seq 101 Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Detection of copy number variations in PCR-enriched targeted sequencing data

Detection of copy number variations in PCR-enriched targeted sequencing data Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11396 A total of 2078 samples from a large sequencing project at decode were used in this study, 219 samples from 78 trios with two grandchildren who were not also members of other trios,

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii

More information

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)

More information

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED

More information

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi 2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000

More information

Agilent s Copy Number Variation (CNV) Portfolio

Agilent s Copy Number Variation (CNV) Portfolio Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human

More information

On Missing Data and Genotyping Errors in Association Studies

On Missing Data and Genotyping Errors in Association Studies On Missing Data and Genotyping Errors in Association Studies Department of Biostatistics Johns Hopkins Bloomberg School of Public Health May 16, 2008 Specific Aims of our R01 1 Develop and evaluate new

More information

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Copy Number Varia/on Detec/on Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Today s Goals Understand the applica5on and capabili5es of using targe5ng sequencing and CNV calling

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Introduction to the Genetics of Complex Disease

Introduction to the Genetics of Complex Disease Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Identification of genomic alterations in cervical cancer biopsies by exome sequencing

Identification of genomic alterations in cervical cancer biopsies by exome sequencing Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,

More information

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0298 TITLE: MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families PRINCIPAL INVESTIGATOR: Xudong Liu, PhD CONTRACTING

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Mapping by recurrence and modelling the mutation rate

Mapping by recurrence and modelling the mutation rate Mapping by recurrence and modelling the mutation rate Shamil Sunyaev Broad Institute of M.I.T. and Harvard Current knowledge is from Comparative genomics Experimental systems: yeast reporter assays Potential

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Van test naar diagnose naar

Van test naar diagnose naar Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

PG-Seq NGS Kit for Preimplantation Genetic Screening

PG-Seq NGS Kit for Preimplantation Genetic Screening Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Human Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980

Human Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Identification of regions with common copy-number variations using SNP array

Identification of regions with common copy-number variations using SNP array Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration

More information

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA

UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science

More information

ncounter TM Analysis System

ncounter TM Analysis System ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance

More information

Victor Guryev. European Research Institute for the Biology of Ageing

Victor Guryev. European Research Institute for the Biology of Ageing Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam /a /g Low coverage whole genome and deep

More information

!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&

!##$%#&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;& !!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'&#91!!

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

Genetics and Genomics in Medicine Chapter 8 Questions

Genetics and Genomics in Medicine Chapter 8 Questions Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional

More information

Implementation of BRCA Oncomine panel for germline and somatic variant analysis

Implementation of BRCA Oncomine panel for germline and somatic variant analysis Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University

More information

SureSelect Cancer All-In-One Custom and Catalog NGS Assays

SureSelect Cancer All-In-One Custom and Catalog NGS Assays SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis

More information

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

Structural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill

Structural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)

More information

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY

More information

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators

More information

LTA Analysis of HapMap Genotype Data

LTA Analysis of HapMap Genotype Data LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans

Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans Haraksingh et al. BMC Genomics (2017) 18:321 DOI 10.1186/s12864-017-3658-x RESEARCH ARTICLE Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

Viral genome sequencing: applications to clinical management and public health. Professor Judy Breuer

Viral genome sequencing: applications to clinical management and public health. Professor Judy Breuer Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in

More information

Single-Cell Sequencing in Cancer. Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018

Single-Cell Sequencing in Cancer. Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018 Single-Cell Sequencing in Cancer Peter A. Sims, Columbia University G4500: Cellular & Molecular Biology of Cancer October 22, 2018 Lecture will focus on technology for and applications of single-cell RNA-seq

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter

More information

The Importance of Coverage Uniformity Over On-Target Rate for Efficient Targeted NGS

The Importance of Coverage Uniformity Over On-Target Rate for Efficient Targeted NGS WHITE PAPER The Importance of Coverage Uniformity Over On-Target Rate for Efficient Targeted NGS Yehudit Hasin-Brumshtein, Ph.D., Maria Celeste M. Ramirez, Ph.D., Leonardo Arbiza, Ph.D., Ramsey Zeitoun,

More information

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank

More information

ncounter Data Analysis Guidelines for Copy Number Variation (CNV) Molecules That Count NanoString Technologies, Inc.

ncounter Data Analysis Guidelines for Copy Number Variation (CNV) Molecules That Count NanoString Technologies, Inc. ncounter Data Analysis Guidelines for Copy Number Variation (CNV) NanoString Technologies, Inc. 530 Fairview Ave N Suite 2000 Seattle, Washington 98109 www.nanostring.com Tel: 206.378.6266 888.358.6266

More information

Most severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).

Most severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment). SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:

More information