Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2

Size: px

Start display at page:

Download "Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2"

Marian Patrick
5 years ago
Views:

1 Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto, Nohide Kondo, Mdok Iid, Genki Tohni, Fumiki Tnk, Shin-ichi Murmtsu & Gen Soue Contents Supplementry Note Supplementry References Supplementry Figures Nture Medicine doi:.3/nm.279

2 Supplementry Note Results The in vivo correltion etween mir-96 nd mutnt AR mrna levels. We mesured the endogenous levels of mir-96 nd mutnt AR mrna in the control (AR-24Q) nd SBMA mice (AR-97Q) t vrious ges (Supplementry Fig. ). The levels of AR mrna expression showed n inverse reltionship with those of mir-96. However, these dt do not necessrily indicte tht mir-96 is unique mirna tht regultes the levels of AR mrna expression. Other mirnas, including mir-96, my lso ffect the expression levels of AR mrna nd protein through the silencing of CELF2 (Fig.,c). Proteins other thn CELF2 hve lso een reported to interct with AR mrna,2. Monitoring the side effects of mice treted with -mir-96. To detect the side effects tht result from tretment with -mir-96, wild-type mice (C57BL/6) treted with -mir-96 were monitored over one yer nd then scrificed to exmine the presence of ny dverse effects of mir-96. Histopthologicl exmintion did not revel ny morphologicl chnges in the liver, kidney or thorcic spinl cord of the wild-type mice (C57BL/6) treted with -mir-96 or -mir-mock (Supplementry Fig. c). There re no posttrnsltionl effects of mir-96 on mutnt AR protein levels. To determine whether the enhnced degrdtion of mutnt AR ws ttriuted to protein degrdtion, we performed pulse-chse nlysis of the mutnt AR protein. The pulse-chse nlysis reveled tht mutnt AR protein ws rpidly degrded; however, there ws no significnt difference found etween the sequentil AR protein levels in the HEK293T cells treted with mir-96 nd the HEK293T cells treted with negtive control mirna (NC)

3 (Supplementry Fig. 9,). The effect of mir-96 on poptosis in Neuro2 cells. To determine whether mir-96 exhiits neuro-protective mechnism, we ssessed the effect of mir-96 on poptosis induced y the dministrtion of sturosporine, which is potent inducer of poptosis tht is typicl of neuro-toxic event in cellulr models of neurodegenertive disorders 3,4. The effect of mir-96 on poptosis in Neuro2 neuronl linege cells ws ssessed y the chnge in the reltive expression levels of the cleved cspse-3 protein, which is common mrker of poptosis. Western lotting nlyses showed tht mir-96 did not influence the expression levels of cleved cspse-3 in Neuro2 cells treted with sturosporine (Supplementry Fig. 9c). The effects of mir-96 down-regultion on mutnt AR mrna nd protein in HEK293T cells. The down-regultion of mir-96 resulted in incresed expression levels of mutnt AR mrna vi the enhncement of CELF2 expression ut exhiited slightly down-regulted expression levels of AR protein (Supplementry Fig.,). One reson for this dissocition ws the incresed expression levels of insulin-like growth fctor- (IGF-) mrna nd protein, which hve een previously reported to promote mutnt AR clernce in SBMA 5 (Supplementry Fig. c). In ddition, mir-96 hs n incomplete complementry site within the IGF- 3 UTR (Supplementry Fig. d).

4 Supplementry References. Yep, B.B. et l. Novel inding of HuR nd Poly(C)-inding protein to conserved UC-rich motif within the 3 -untrnslted region of the ndrogen receptor messenger RNA. J. Biol. Chem. 277, (22). 2. Zhou, H. et l. Post-trnscriptionl regultion of ndrogen receptor mrna y n ErB3 inding protein in prostte cncer. Nucleic Acids Res. 3, (2). 3. Yefimov, M.G., et l. Polyglutmine toxicity induces rod photoreceptor division, morphologicl trnsformtion or deth in spinocereellr txi 7 mouse retin. Neuroiol. Dis. 4, 3 24 (2). 4. Ko, A.W., et l. A neurodegenertive disese muttion tht ccelertes the clernce of poptotic cells. Proc. Ntl. Acd. Sci. USA, (2). 5. Plzzolo, I. et l. Overexpression of IGF- in muscle ttenutes disese in mouse model of spinl nd ulr musculr trophy. Neuron 63, (29).

5 Supplementry Figure (CAG) 24 AR-24Q E Pro har poly A 5.3 k 2. k (CAG) 97 AR-97Q E Pro har poly A 5.5 k 3. k A schemtic view of the trnsgene constructs used in our experiments. The microinjected frgment ws composed of cytomeglovirus enhncer (E), chicken-ctin promoter (Pro), full-length humn AR cdna contining 24 or 97 CAGs (har) nd rit-gloin polydenyltion signl sequence (poly A). These trnsgenes lck the 3 UTR of the humn AR mrna.

6 Supplementry Figure 2 Mmu Rno Cpo Ocu Hs Ptr Mml Position of mouse CELF2 3' UTR 5'...GUUUUGGGGCAAAUGCUACCUAU... mmu-mir-96 3' GGGUUGUUGUACUUUGAUGGAU hs-mir-96 3' GGGUUGUUGUACUUUGAUGGAU Mmu Rno Cpo Ocu Hs Ptr Mml Position of mouse CELF2 3' UTR 5'...GUUUUGGGGCAAAUGCUACCUAU... mmu-mir-96 3' GGGUUGUUGUCCUUUGAUGGAU hs-mir-96 3' GGGUUGUUGUCCUUUGAUGGAU c Mouse CELF2 (MN_ 23) 3 UTR length:73 2k 4k 6k polya mir-96, mir-96 (,) Alignment of the mouse, rt, pig, rit, humn, chimpnzee nd rhesus CELF2 3 UTRs identified highly conserved region contining inding sites for mir-96 () nd -96 (), which re developmentlly restricted mirnas. The predicted mirna inding sites re indicted in red. The numers show the position within the CELF2 3 UTR. The sequences of the mture mmu-mir-96 nd -96 re the sme s those of the hsmir-96 nd -96. These oligonucleotides hve complementry site within the CELF2 3 UTR. (c) A schemtic digrm of the mouse CELF2 (ccession numer NM_23) 3 UTR indicting the loctions of the uthentic mir-96 nd -96 trget sites tht re conserved in vertertes.

thorcic spinl cord of AR97Q mice nd leled for mir-96.

7 Supplementry Figure 3 control mir-96 5 µm 5 µm Representtive in situ hyridiztion of formlin-fixed prffin-emedded sections otined from the thorcic spinl cord of AR97Q mice nd leled for mir-96. The sections were hyridized with either the LNA-miR-scrmled control (left pnel) or LNA-miR-96 (right pnel).

Supplementry Figure 4 Cervicl spinl cord Brin Age

35 Right upper lim skeletl muscle 35 Right lower lim

GFP ChAT merge µm d Cervicl spinl cord Thorcic spinl

widespred virl trnsduction throughout the entire ody

() Western lotting nlyses using n ntiody ginst

widespred distriution of the vector in the rin, spinl

SBMA mice treted with mir-96 compred to those treted

The continuous expression of EGFP ws oserved in SBMA

() Representtive immunofluorescence imges of the

expression of EGFP with GFP-specific ntiody.

neurons leled with choline cetyltrnsferse (ChAT) (in

8 Supplementry Figure 4 Cervicl spinl cord Brin Age (weeks) 35 Thorcic spinl cord 35 Lumr spinl cord Right upper lim skeletl muscle 35 Right lower lim skeletl muscle 35 GFP α-tuulin c Thorcic spinl cord GFP ChAT merge µm d Cervicl spinl cord Thorcic spinl cord i.c. i.c. Lumr spinl cord i.c. GFP α-tuulin The widespred virl trnsduction throughout the entire ody of the vector-infected mice. () Western lotting nlyses using n ntiody ginst enhnced green fluorescent protein (EGFP) showed widespred distriution of the vector in the rin, spinl cords nd skeletl muscle of the upper nd lower lims of SBMA mice treted with mir-96 compred to those treted with phosphte-uffered sline (). The continuous expression of EGFP ws oserved in SBMA mice t nd 35 weeks of ge. () Representtive immunofluorescence imges of the spinl cord of SBMA mice treted with -mir-96 showed expression of EGFP with GFP-specific ntiody. (c) EGFP expression (in green) ws detected in motor neurons leled with choline cetyltrnsferse (ChAT) (in red). (d) Western lotting nlyses showing widespred distriution of the vector in the spinl cord of SBMA mice treted with n injection of -mir-96 into the crdic chmer (ic). 2 µm

9 Supplementry Figure 5 Mock 96 5 µm 5 µm s (µ ) 2, 5,, 5, Mock 96 An ssessment of the immunohistochemicl signl intensities of glil firillry cidic protein (GFAP) expression levels in the thorcic spinl nterior horn of SBMA mice treted with -mir-96 or -mir-mock. () A representtive imge of n individul nterior horn on trnsverse sections of thorcic spinl cord leled with GFAP. () The reltive levels of GFAP stining in the imges (n = 5). Dt re mens ± s.e.m. P <..

Supplementry Figure 6 mir-96 levels 5 Stcking gel mutnt AR Mock 96 Mock 96 CELF2 mrna levels.5 Stcking gel mutnt AR / α-tuulin.

5 Mock 96 Monomeric mutnt AR CELF2 Monomeric mutnt AR / α-tuulin.5 Mock 96 α-tuulin CELF2/ α-tuulin.

() The reltive expression levels of mir-96, CELF2 mrna, mutnt AR mrna nd the endogenous mouse AR mrna in the thorcic spinl cord of

10 Supplementry Figure 6 mir-96 levels 5 Stcking gel mutnt AR Mock 96 Mock 96 CELF2 mrna levels.5 Stcking gel mutnt AR / α-tuulin.5 Mock 96 Mock 96 Mutnt AR mrna levels.5 Mock 96 Mouse AR mrna levels.5 Mock 96 Monomeric mutnt AR CELF2 Monomeric mutnt AR / α-tuulin.5 Mock 96 α-tuulin CELF2/ α-tuulin.5 Mock 96 The effects of mir-96 on mutnt AR expression in the skeletl muscle of the right qudriceps femoris of mle AR-97Q mice. () The reltive expression levels of mir-96, CELF2 mrna, mutnt AR mrna nd the endogenous mouse AR mrna in the thorcic spinl cord of AR-97Q-miR-Mock nd AR-97Q-miR-96 mice (n = 5). () Western lot nd densitometric nlyses showing the expression levels of mutnt AR oth in the stcking nd seprting gels s well s those of CELF2. (n = 5). All dt re mens ± s.e.m. P <.5 nd P <..

11 Supplementry Figure 7 AR mrna levels CELF2 mrna levels.5.5 NC 25 nm 5 nm 96 NC 25 nm 5 nm 96 AR CELF2 α-tuulin 96 NC 25 nm 5 nm AR/ α-tuulin CELF2/ α-tuulin NC 25 nm 5 nm 96 NC 25 nm 5 nm 96 () The effects of mir-96 on norml AR mrna nd CELF2 mrna in the firolsts otined from disese control sujects (n = 3). () Western lot nd densitometric nlyses showing the expression levels of norml AR nd CELF2 (n = 3). NC; negtive control mirna. All dt re mens ± s.e.m. P <.5 nd P <..

Supplementry Figure 24Q 97Q CELF2/ α-tuulin CELF2

5 24Q 97Q AR-24Q 3 AR mrna levels mir-96 levels 3 2

(weeks) c Thorcic spinl cord Kidney Liver Mock 96

protein in the thorcic spinl cord of AR-97Q mice

mrna in the AR-24Q nd AR-97Q mice t vrious ges (n =

(c) Histopthologicl exmintion of the liver, kidney

12 Supplementry Figure 24Q 97Q CELF2/ α-tuulin CELF2 mrna levels CELF2.5 α-tuulin 24Q 97Q.5 24Q 97Q AR-24Q 3 AR mrna levels mir-96 levels AR-97Q Time (weeks) Time (weeks) c Thorcic spinl cord Kidney Liver Mock 96 µm µm µm () The expression levels of CELF2 mrna nd protein in the thorcic spinl cord of AR-97Q mice compred with those of AR-24Q mice t 5 weeks of ge (n = 3). () The endogenous expression levels of mir-96 nd AR mrna in the AR-24Q nd AR-97Q mice t vrious ges (n = 2 to 4). We nlyzed the dt t 5 weeks of ge. (c) Histopthologicl exmintion of the liver, kidney or thorcic spinl cord of wild-type mice (C57BL/6) treted with -mir-96 or -mir-mock. All dt re mens ± s.e.m. P <.5 nd P <..

Supplementry Figure 9 Time (h) AR-97Q NC 96 3 6 3 6 AR-97Q remining..6.4.2 NC 96 3 36 69 Time (h) c DMSO STS µm Cspse-3 Cleved cspse-3 NC 96 NC 96 Cleved cspse-3 / α-tuulin.

13 Supplementry Figure 9 Time (h) AR-97Q NC AR-97Q remining NC Time (h) c DMSO STS µm Cspse-3 Cleved cspse-3 NC 96 NC 96 Cleved cspse-3 / α-tuulin.5 NC 96 STS µm α-tuulin The posttrnsltionl nd nti-poptotic effects of mir-96. () The mounts of AR-97Q remining in the sence nd presence of mir-96 re indicted. () The sequentil AR protein levels in the HEK293T cells treted with mir-96 or negtive control mirna (NC) (n = 5). (c) A western lot nd densitometric nlysis showing the expression levels of cleved cspse-3, which is common mrker of poptosis, induced y tretment with sturosporine (STS) in Neuro2 cells (n = 5). All dt re mens ± s.e.m.

Supplementry Figure mir-96 levels.5 NC 96-s CELF2 mrna levels 2.5.5 NC 96-s AR mrna levels 2.5.5 NC 96-s AR CELF2 α-tuulin NC 96-s CELF2/ α-tuulin 2.5.5 NC 96-s AR/ α-tuulin.

UGUCAUCUACCUACCUCAAAGGGGUGGCAUGAG - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - UGUCAUCUACCUACCUCAAAGGGGUGGUAUAAG UGUCAUCUACCUACCUCAAAGGGGUGGUAUAAG

.. mmu-mir-96 3' GGGUUGUUGUACUUUGAUGGAU hs-mir-96 3' GGGUUGUUGUACUUUGAUGGAU The effects of the down-regultion of mir-96 on AR mrna nd protein in HEK293T cells.

14 Supplementry Figure mir-96 levels.5 NC 96-s CELF2 mrna levels NC 96-s AR mrna levels NC 96-s AR CELF2 α-tuulin NC 96-s CELF2/ α-tuulin NC 96-s AR/ α-tuulin.5 NC 96-s c IGF- α-tuulin NC 96-s IGF-/ α-tuulin NC 96-s IGF- mrna levels NC 96-s d Mmu Rno Cpo Ocu Hs Ptr Mml 39 4 UGUCAUCUACCUACCUCAAAGGGGUGGUAUGAA UGCCAUCUACCUACCUCAAAGGGGUGGUAUGAA UGUCAUCUACCUACCUCAAAGGGGUGGCAUGAG UGUCAUCUACCUACCUCAAAGGGGUGGUAUAAG UGUCAUCUACCUACCUCAAAGGGGUGGUAUAAG UGUCAUCUACCUACCUCAAAGGGGUGGUAUAAG Position of mouse IGF- 3' UTR 5'... CAUCUACCUACCU... mmu-mir-96 3' GGGUUGUUGUACUUUGAUGGAU hs-mir-96 3' GGGUUGUUGUACUUUGAUGGAU The effects of the down-regultion of mir-96 on AR mrna nd protein in HEK293T cells. () The levels of AR mrna nd CELF2 mrna expression in HEK293T cells treted with the down-regultion of mir-96 using n nti-mir-96 ntisense (n = 5). NC; negtive control mirna. () The expression levels of AR nd CELF2 (n = 5). (c) The expression levels of insulin-like growth fctor- (IGF-) mrna nd protein in HEK293T cells treted with the down-regultion of mir-96 using n nti-mir-96 ntisense (n = 5). (d) Alignment of the mouse, rt, pig, humn, chimpnzee nd rhesus IGF- (ccession numer NM_274 ) 3 UTRs identified highly conserved region tht contins inding site for mir-96. All dt re mens ± s.e.m. P <.5, P <. nd P <..

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus