TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

* Kyoto Encyclopedia of Genes and Genomes.

Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain

Chapter 11 CYTOKINES

Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:

For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

Intrinsic cellular defenses against virus infection

Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2

Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China

Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective

BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna

NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.

NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles

An integrated transcriptomic and functional genomic approach identifies a. type I interferon signature as a host defense mechanism against Candida

Supplementary information for: An integrated transcriptomic and functional genomic approach identifies a type I interferon signature as a host defense mechanism against Candida albicans in humans Sanne

Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.

Table S1 Differentially expressed genes showing > 2 fold changes and p

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,

Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under

The death receptors: signaling and modulation

The death receptors: signaling and modulation 1 1 The extrinsic cell death pathway 2 Nat Rev Drug Discov. 2008 Dec;7(12):1001-12. 2 Death receptors Belong to the tumor necrosis factor (TNF) receptor gene

Chapter 32. Non specific (Innate) Host Resistance ( 비특이적 ( 내재 ) 숙주방어 )

Chapter 32 Non specific (Innate) Host Resistance ( 비특이적 ( 내재 ) 숙주방어 ) Host Resistance Overview Immune system ( 면역계 ) Composed of widely distributed cells, tissues, and organs Recognizes foreign substances

The T cell receptor for MHC-associated peptide antigens

1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph

Chapter 13: Cytokines

Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.

Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up. Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins

Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins The hostile immune microenvironment within a tumor Stat3 Stat3 NK Lytic

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary

Pathogenesis of Pulmonary Disease In Ebola Virus-Infected Pigs

Pathogenesis of Pulmonary Disease In Ebola Virus-Infected Pigs Charles Nfon 1, Anders Leung 2, Greg Smith 1, Carissa Embury-Hyatt 1, Gary Kobinger 2,3,4 and Hana Weingartl 1,3 1 National Centre for Foreign

7/6/2009. The study of the immune system and of diseases that occur as a result of inappropriate or inadequate actions of the immune system.

Diseases of Immunity 2009 CL Davis General Pathology Paul W. Snyder, DVM, PhD Purdue University Acknowledgements Pathologic Basis of Veterinary Disease, 4 th Ed Veterinary Immunology, An Introduction 8

Table 1: NFkB Target Gene Sets 1.Genes included in the subset of 15k genes selected according to a MAD-based variation filter

Supplementary Information NFkB target gene sets The NFkB target gene sets are listed below (Table1). In addition to the previously performed mapping of Affymetrix probesets and corresponding Lymphochip

Signal Transduction: G-Protein Coupled Receptors

Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,

12/10/2009. Department of Pathology, Case Western Reserve University. Mucosal Cytokine Network in IBD

Cytokine-Mediated Inflammation in IBD Theresa T. Pizarro Department of Pathology, Case Western Reserve University Mucosal Cytokine Network in IBD Andoh, et al., 2008 1 Interleukin-1 (IL-1) Family Cytokine

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding

Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

Adaptive Immunity. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R

CSLO7. Describe functions of host defenses and the immune system in combating infectious diseases and explain how immunizations protect against specific diseases. PowerPoint Lecture Presentations prepared

Cell Signaling part 2

15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

silent epidemic,. (WHO),

Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

Generation of the Immune Response

Generation of the Immune Response Sheet 18 immunity I only added extra notes that were explained in the lecture, refer back to the slides. SLIDE 3: In the generation of Immune response whether by B or

SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish

SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

Table 1A. Genes enriched as over-expressed in DPM treatment group

Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597

Adaptive Immunity. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R

PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 16 Adaptive Immunity The Body s Third Line of Defense Adaptive Immunity Adaptive immunity

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones

Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological

Chapter 9. Cellular Signaling

Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,

Structure and Function of Antigen Recognition Molecules

MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

2. Innate immunity 2013

1 Innate Immune Responses 3 Innate immunity Abul K. Abbas University of California San Francisco The initial responses to: 1. Microbes: essential early mechanisms to prevent, control, or eliminate infection;

A bioinformatics driven cancer study

The 11th China-Japan-Korea Bioinformatics Training Course & Symposium, June 16-18, Suzhou, China A bioinformatics driven cancer study Chao Li and Yixue Li yxli@sibs.ac.cn Shanghai Institutes for Bio-Medicine

Biosignals, Chapter 8, rearranged, Part I

Biosignals, Chapter 8, rearranged, Part I Nicotinic Acetylcholine Receptor: A Ligand-Binding Ion Channel Classes of Receptor Proteins in Eukaryotes, Heterotrimeric G Proteins Signaling View the Heterotrimeric

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

Test Bank for The Immune System 4th Edition by Parham

Test Bank for The Immune System 4th Edition by Parham CHAPTER 3: INNATE IMMUNITY: THE INDUCED RESPONSE TO INFECTION 3 1 C-type lectins are so called because of the role of in facilitating receptor:ligand

Innate Immunity. Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 2 August 2016

Innate Immunity Hathairat Thananchai, DPhil Department of Microbiology Faculty of Medicine Chiang Mai University 2 August 2016 Objectives: Explain how innate immune system recognizes foreign substances

Signal Transduction Cascades

Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,

Cell signaling. How do cells receive and respond to signals from their surroundings?

Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a

Supplementary Information

Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,

5% of patients with genetic immunodeficiency develop a cancer during their lifetime (200x)

Immune surveillance 5% of patients with genetic immunodeficiency develop a cancer during their lifetime (200x) Transplanted patients following an immunosuppressor therapy are 80 times more likely to develop

Basis of Immunology and

Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

Chapter 3 The Induced Responses of Innate Immunity

Chapter 3 The Induced Responses of Innate Immunity Pattern recognition by cells of the innate immune system Pattern recognition by cells of the innate immune system 4 main pattern recognition receptors

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome

DNA Genome Complexity RNA Transcriptome Systems Biology Linking all the components of a cell in a quantitative and temporal manner Protein Proteome Metabolites Metabolome Where are the functional elements?

Cells communicate with each other via signaling ligands which interact with receptors located on the surface or inside the target cell.

BENG 100 Frontiers of Biomedical Engineering Professor Mark Saltzman Chapter 6 SUMMARY In this chapter, cell signaling was presented within the context of three physiological systems that utilize communication

M.Sc. III Semester Biotechnology End Semester Examination, 2013 Model Answer LBTM: 302 Advanced Immunology

Code : AS-2246 M.Sc. III Semester Biotechnology End Semester Examination, 2013 Model Answer LBTM: 302 Advanced Immunology A. Select one correct option for each of the following questions:- 2X10=10 1. (b)

Significance of the MHC

CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

Contents The Cytokine System The Discovery of the Brain Immunomodulators

Contents 1 The Cytokine System... 1 1.1 Inducible Character of Cytokine Formation and Reception... 1 1.2 Locality of Cytokine Action... 2 1.3 Superfluity of Cytokine System... 2 1.4 Interrelationship and

Maturity-onset diabetes of the young (MODY) is a heterogeneous group

Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.

!! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)

Cross-regulation of host STATs for the survival of Toxoplasma gondii

JITMM2010&IMC2010, 1-3 December 2010 Cross-regulation of host STATs for the survival of Toxoplasma gondii Ho-Woo Nam 1, Dong-Soo Kim 2, Sung-Jong Hong 3 Department of arasitology, College of Medicine,

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

By the name of Allah

By the name of Allah Receptors function and signal transduction ( Hormones and receptors Types) We were talking about receptors of the neurotransmitters; we have 2 types of receptors: 1- Ionotropic receptors

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

Under the Radar Screen: How Bugs Trick Our Immune Defenses

Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 8: Apoptosis Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research Myxoma virus Poxvirus Infects rabbits

Mon, Wed, Fri 11:00 AM-12:00 PM. Owen, Judy, Jenni Punt, and Sharon Stranford Kuby-Immunology, 7th. Edition. W.H. Freeman and Co., New York.

Course Title: Course Number: Immunology Biol-341/541 Semester: Fall 2013 Location: HS 268 Time: Instructor: 8:00-9:30 AM Tue/Thur Dr. Colleen M. McDermott Office: Nursing Ed 101 (424-1217) E-mail*: mcdermot@uwosh.edu

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution

Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.

Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system

Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by

Immunology for the Rheumatologist

Immunology for the Rheumatologist Rheumatologists frequently deal with the immune system gone awry, rarely studying normal immunology. This program is an overview and discussion of the function of the

CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.

CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins

JPEMS Nantes, Basic Immunology INNATE IMMUNITY

JPEMS Nantes, 2014- Basic Immunology INNATE IMMUNITY Teacher: Pr. Régis Josien, Laboratoire d Immunologie and INSERM U1064, CHU Nantes Regis.Josien@univ-nantes.fr 1 Contents 1. General features and specificity

Significance of the MHC

CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

MICROBIO320 EXAM 1-Spring 2011 Name True/False (1 point each) T 2. T cell receptors are composed of constant and variable regions.

True/False (1 point each) T 1. Mature T cells (lymphocytes) bind only to processed antigen. T 2. T cell receptors are composed of constant and variable regions. F 3. Natural Killer cells do not proliferate

SINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR

A Name: Group: SINGLE CHOICE 1. Which is the most important ligand of TLR5? A endospore B flagellin C polysaccharide capsule D DNA E pilus 2. The antibody-binding site is formed primarily by... A the constant

Toll-like Receptor Signaling

Toll-like Receptor Signaling 1 Professor of Medicine University of Massachusetts Medical School, Worcester, MA, USA Why do we need innate immunity? Pathogens multiply very fast We literally swim in viruses

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire

Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond

Prepared by Cyrus H. Nozad, MD, University of Tennessee and John Seyerle, MD, Ohio State University

Allergy and Immunology Review Corner: Chapter 21 of Middleton s Allergy Principles and Practice, Seventh Edition, edited by N. Franklin Adkinson, et al. Chapter 21: Antigen-Presenting Dendritic Cells (Pages

Micr-6005, Current Concepts of Immunology (Rutgers course number: 16:681:543) Spring 2009 Semester

Micr-6005, Current Concepts of Immunology (Rutgers course number: 16:681:543) (3 Credits) Spring 2009 Semester Course Director: (732-235-4501, ) Please note that this course is offered once every 2 years.

T cell maturation. T-cell Maturation. What allows T cell maturation?

T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

Innate immunity. Abul K. Abbas University of California San Francisco. FOCiS

1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome

Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide

Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide pulsed T2 cells. clone avidity by 4-hour 51 Cr-release assay 50% lysis at E:T 10:1 [LML peptide, M] #24

Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)

RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format