* Kyoto Encyclopedia of Genes and Genomes.
|
|
|
- Brendan Sims
- 5 years ago
- Views:
Transcription
1 Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited with the National Center for Biotechnology Information Gene Expression Omnibus (GEO, ( with the accession number of GSE Figure S1. Heat map showing differential gene expression in human immature dendritic cells stimulated with rbmasnrs vs IL8 by using an NFkB specific mini-microarray. Figure S2. K.E.G.G. * Pathway: NK cell mediated cytotoxicity signal transduction pathway with key rbmasnrs- regulated genes indicated by red stars. Figure S3. K.E.G.G. Pathway: Toll-like receptor signal transduction pathway with key rbmasnrs-regulated genes indicated by red stars. Figure S4. K.E.G.G. Pathway: Chemokine signal transduction pathway with key rbmasnrs-regulated genes indicated by red stars. Figure S5. K.E.G.G. pathway: MAPK Signaling Pathway with key rbmasnrs -regulated genes indicated by red stars. * Kyoto Encyclopedia of Genes and Genomes.
2 Figure S1. Heat map of gene expression induced by IL-8 (top three rows) vs. rbmasnrs (bottom three rows) in human immature dendritic cells using an NFkB pathway-specific gene chip. Gene expression data is presented with the highest level of gene expression on the left and lowest level expression on the right in order to compare the relative effects of IL8 and rbmasnrs on the same genes. Gene abbreviations from left to right are IL1B: Interleukin 1; Stat 1:Signal transducer and activator of transcription 1; CFB: Complement factor B; ECM1: Extra Cellular Matrix protein 1; CCL2: Chemokine ligand 2; C3: Complement component 3; HMOX1:Heme oxygenase 1; TLR6:Toll-like receptor 6; NFKBA: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; IL8: Interleukin 8; IRAK1: Interleukin 1 receptor associated kinase 1; MYD88: myeloid differentiation primary response gene 88; NLRP12: NACHT, LRR and PYD domains-containing protein 12; TICAM2:Toll-like receptor adaptor molecule 2; TLR1:Toll-like receptor 1; TLR9:Toll-like receptor 9; MAPK3: Mitogen activated protein kinase 3; TICAM1:Toll-like receptor adaptor molecule 1; SLC44A2: solute carrier family 44, member 2; PPPSC: plipastatin synthetase; TLF3: Toll like receptor 3; NFKB2: nuclear factor of kappa light polypeptide gene enhancer in B-cells 2; TLR4:Toll- like receptor 4; TMED4: Putative NF-kappa-B-activating protein 156; IFNA1: Interferon-alpha/beta receptor alpha chain; LTBR: lymphotoxin beta receptor (TNFR superfamily, member 3); NFKB1: nuclear factor of kappa light polypeptide gene enhancer in B-cells 1; RELA: reticuloendotheliosis viral oncogene homolog A; JUN: Jun oncogene; BCL3: B cell leukemia/lymphoma protein 3; ICAM1:intercellular adhesion molecule 1; MAP3K7iP2: mitogen-activated protein kinase kinase kinase 7- interacting protein 2; SLC20A1: solute carrier family member 20; TLR2: Toll-like receptor 2; RHOC: ras homologue family member C; RIPK2: receptorinteracting serine-threonine kinase 2; TNFAIP3: TNF alpha induced protein 3; TRIM13: tripartite motif containing 13; TLR8: Toll-like receptor 8; IKBKG: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma; RHOA: ras homologue family A; TRAF5: TNF receptor associated factor 5; MAP3K7: mitogen-activated protein kinase kinase kinase 7; AGT: angiotensinogen; RIPK1: receptor-interacting serine threonine kinase 1; TRAF6: TNF receptor-associated factor 6; CXXC5: CXXC finger protein 5; PLK2: polo-like kinase 2; MAP2K4: mitogen-activated protein kinase kinase 4; REL: reticuloendotheliosis viral oncogene; IFNB1: infb1 hypothetical protein; MAPK8: mitogen activated protein kinase 8; MAPK14: mitogen activated protein kinase 14; CSF3: colony stimulating factor 3; CARD11: caspase recruitment domain family, member 11; GPR89A: G protein-coupled receptor 89A; ATF1: activating transcription factor 1; LTA: lymphotoxin alpha; TBK1: TANK binding kinase 1; LTAF:lipopo-lysaccharide-induced TNF factor; MAP2K6:Mitogen activated protein kinase 6; TNF: tumor necrosis factor; IKBKB: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha b ; RNFRSF10A: tumor necrosis factor receptor superfamily, member 10a; IL1R1:Interleukin 1 receptor 1; AKT1: v-akt murine thymoma viral oncogene homolog 1;TRADD: TNFRSF1A-associated via death domain; RAF1: v-raf-1 murine leukemia viral oncogene homolog 1; EDG2: endothelial differentiation gene 2; MIRC2: microrna cluster 2; TNFRSF1A: tumor necrosis factor receptor superfamily, member 1A; MAP3K14: mitogen-activated protein kinase kinase kinase 14; TNFRSF10B: tumor necrosis factor receptor superfamily, member 10b; CD40: TNF receptor superfamily member; BCL10: B-cell CLL/lymphoma 10; FASLG: Fas ligand member 6; TNFSF14:Tumor necrosis factor ligand superfamily member 14; TLR10:Toll-like receptor 10.
3 FIGURE S2. K.E.G.G. Pathway of Natural Killer Cell Mediated Cytotoxicity stimulated by rbmasnrs in human immature dendritic cells. Key rbmasnrs regulated genes are indicated by a red star.
4 FIGURE S3. K.E.G.G. Pathway of Toll-like receptor mediated signal transduction stimulated by rbmasnrs in human immature dendritic cells. Key rbmasnrs-regulated genes are indicated by a red star.
5 FIGURE S4. K.E.G.G. Pathway of Chemokine receptor signal transduction stimulated by rbmasnrs in human immature dendritic cells. Key rbmasnrs-regulated genes are indicated by a red star.
6 Figure S5. K.E.G.G. Pathway of MAPK signal transduction stimulated by rbmasnrs in human immature dendritic cells. Key rbmasnrs-regulated genes are indicated by a red star.
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Direct Intracellular Regulators of Apoptosis Array 1
Supplement Table A Direct Intracellular Regulators of Apoptosis 2 Mean Name Description.5 2.2.9 ATM ataxia telangiectasia mutated homolog.9.8.9 Bcl2aa B-cell leukemia/lymphoma 2 related protein Aa.6 2..9
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Applied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)
RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format
KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
Molecular basis of age-associated cytokine dysregulation in LPS-stimulated macrophages
Uncorrected Version. Published on April 6, 2006 as DOI:10.1189/jlb.0106024 Molecular basis of age-associated cytokine dysregulation in LPS-stimulated macrophages R. Lakshman Chelvarajan,*, Yushu Liu, Diana
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Supplementary Table 1: OCAC study location, type, and number of cases and controls
Supplementary Table 1: OCAC study location, type, and number of cases and controls Study Name Abbreviation Study Location Study Type N Cases N Controls Australian Ovarian Cancer Study/Australian Cancer
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Toll-like Receptor Signaling
Toll-like Receptor Signaling 1 Professor of Medicine University of Massachusetts Medical School, Worcester, MA, USA Why do we need innate immunity? Pathogens multiply very fast We literally swim in viruses
Supplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
1. TLR. TLR Toll-like receptors. Toll Toll-like receptor, TLR TLR TLR TLR. type I TLR TLR. Toll
54pp.145 152 2004 1. TLR T B TLR Toll-like receptors TLR TLR I IFN TLR T B B T Toll NF- B 1996 565-0871 3-1 TEL 06-6879-8303 FAX 06-6879-8305 E-mail uemattsu@biken.osaka-u.ac.jp Toll Toll-like receptor,
Supporting Information
Supporting Information Gorgun et al. 10.1073/pnas.0901166106 SI Text Animals, Disease Detection and Infusion of CLL Cells. Mice were examined for lymphadenopathy and splenomegaly and at specific ages or
SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish
SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,
Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in
Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin
Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive
Test Bank for The Immune System 4th Edition by Parham
Test Bank for The Immune System 4th Edition by Parham CHAPTER 3: INNATE IMMUNITY: THE INDUCED RESPONSE TO INFECTION 3 1 C-type lectins are so called because of the role of in facilitating receptor:ligand
Epigonal Conditioned Media from Bonnethead Shark, Sphyrna tiburo, Induces Apoptosis in a T-Cell Leukemia Cell Line, Jurkat E6-1
Mar. Drugs 2013, 11, 3224-3257; doi:10.3390/md11093224 Article OPEN ACCESS marine drugs ISSN 1660-3397 www.mdpi.com/journal/marinedrugs Epigonal Conditioned Media from Bonnethead Shark, Sphyrna tiburo,
Figure 1: Effects of cisplatin on survival of lung cancer cells.
Figure 1 Figure 1: Effects of cisplatin on survival of lung cancer cells. To determine the IC 50 concentration of cisplatin, cells were treated with various concentrations of cisplatin and cell survival
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
Newly Recognized Components of the Innate Immune System
Newly Recognized Components of the Innate Immune System NOD Proteins: Intracellular Peptidoglycan Sensors NOD-1 NOD-2 Nod Protein LRR; Ligand Recognition CARD RICK I-κB p50 p65 NF-κB Polymorphisms in Nod-2
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.
Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
MAPK Pathway
MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth
Signaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
CHAPTER INTRODUCTION
CHAPTER 6 IDENTIFICATION OF RHEUMATOID ARTHRITIS SIGNIFICANT TARGET PROTEINS AND THEIR PATHWAYS THROUGH THE COMBINATORIAL APPROACH (RA-GIM, RA-DTP AND MICROARRAY DATANALYSIS OF RA) 6.1 INTRODUCTION The
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
Structure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
silent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.
Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4
Generation of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
2. Innate immunity 2013
1 Innate Immune Responses 3 Innate immunity Abul K. Abbas University of California San Francisco The initial responses to: 1. Microbes: essential early mechanisms to prevent, control, or eliminate infection;
7/6/2009. The study of the immune system and of diseases that occur as a result of inappropriate or inadequate actions of the immune system.
Diseases of Immunity 2009 CL Davis General Pathology Paul W. Snyder, DVM, PhD Purdue University Acknowledgements Pathologic Basis of Veterinary Disease, 4 th Ed Veterinary Immunology, An Introduction 8
T cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
1. Activated receptor tyrosine kinases (RTKs) phosphorylates themselves
Enzyme-coupled receptors Transmembrane proteins Ligand-binding domain on the outer surface Cytoplasmic domain acts as an enzyme itself or forms a complex with enzyme 1. Activated receptor tyrosine kinases
Mon, Wed, Fri 11:00 AM-12:00 PM. Owen, Judy, Jenni Punt, and Sharon Stranford Kuby-Immunology, 7th. Edition. W.H. Freeman and Co., New York.
Course Title: Course Number: Immunology Biol-341/541 Semester: Fall 2013 Location: HS 268 Time: Instructor: 8:00-9:30 AM Tue/Thur Dr. Colleen M. McDermott Office: Nursing Ed 101 (424-1217) E-mail*: mcdermot@uwosh.edu
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Chapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Supplementary figures
Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second
Interpreting Diverse Genomic Data Using Gene Sets
Interpreting Diverse Genomic Data Using Gene Sets giovanni parmigiani@dfci.harvard.edu FHCRC February 2012 Gene Sets Leary 2008 PNAS Alterations in the combined FGF, EGFR, ERBB2 and PIK3 pathways. Red:
Interpreting Diverse Genomic Data Using Gene Sets
Interpreting Diverse Genomic Data Using Gene Sets giovanni parmigiani@dfci.harvard.edu FHCRC February 2012 Gene Sets Leary 2008 PNAS Alterations in the combined FGF, EGFR, ERBB2 and PIK3 pathways. Red:
Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,
Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with
بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition
The death receptors: signaling and modulation
The death receptors: signaling and modulation 1 1 The extrinsic cell death pathway 2 Nat Rev Drug Discov. 2008 Dec;7(12):1001-12. 2 Death receptors Belong to the tumor necrosis factor (TNF) receptor gene
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
The Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding
Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in
The T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
A Systems Biology Approach to the Analysis of Subset- Specific Responses to Lipopolysaccharide in Dendritic Cells
A Systems Biology Approach to the Analysis of Subset- Specific Responses to Lipopolysaccharide in Dendritic Cells David G. Hancock 1,2, Elena Shklovskaya 1,2, Thomas V. Guy 1,2, Reza Falsafi 3, Chris D.
Time course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
Intrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics
Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics Dr Sarah Sasson SydPATH Registrar 23 rd June 2014 TLRs: Introduction Discovered in 1990s Recognise conserved structures in pathogens Rely
Guide to Signal Pathways in Immune Cells
Guide to Signal Pathways in Immune Cells E. Nigel Wardle, MD Guide to Signal Pathways in Immune Cells E. Nigel Wardle The Royal Society of Medicine London, W1G 0AE United Kingdom nigel@edwinwardle.freeserve.co.uk
Infectious disease: bad luck or bad genes?
LINACRE LECTURE Clinical Medicine 2012, Vol 12, No 6: s12 s16 Infectious disease: bad luck or bad genes? Stephen J Chapman Introduction Infectious disease has been a leading cause of death throughout human
REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
Supporting Information
Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department
Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))
Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :
Identification of Microbes
Identification of Microbes Recognition by PRR (pattern recognition receptors) Recognize conserved molecular patterns on microbes called pathogen associated molecular patterns (PAMPs) which are not present
SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans
SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
Index. neurosurgery.theclinics.com. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A A Complimentary Trial of an Immunotherapy Vaccine Against Tumor-specific EGFRvIII (ACTIVATE), 90 91 Active immunotherapy, 5 8, 96. See
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Supplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific
Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
T cells III: Cytotoxic T lymphocytes and natural killer cells
T cells III: Cytotoxic T lymphocytes and natural killer cells Margrit Wiesendanger Division of Rheumatology, CUMC September 17, 2008 Killer cells: CD8 + T cells (adaptive) vs. natural killer (innate) Shared
Role of death receptors in the regulation of hepatocyte proliferation and apoptosis during rat liver regeneration
Role of death receptors in the regulation of hepatocyte proliferation and apoptosis during rat liver regeneration Y. Zhou 1,2, J.C. Xu 2, Y.F. Jia 1 and C.S. Xu 1 1 Key Laboratory for Cell Differentiation
Post-translational modifications of proteins in gene regulation under hypoxic conditions
203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and
To compare the relative amount of of selected gene expression between sham and
Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter
Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
Immunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up. Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins
Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins The hostile immune microenvironment within a tumor Stat3 Stat3 NK Lytic
T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009
T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells
Lecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
HTG EdgeSeq Immuno-Oncology Assay Gene List
A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK
Preconditioning reprograms TLR signaling following cerebral ischemia the emergence of a neuroprotective program
Oregon Health & Science University OHSU Digital Commons Scholar Archive September 2008 Preconditioning reprograms TLR signaling following cerebral ischemia the emergence of a neuroprotective program Brenda
Lung Reperfusion Injury
Lung Reperfusion Injury Michael S. Mulligan, M.D. Professor of Surgery Chief, Section of Thoracic Surgery Director, Lung Transplant Program University of Washington Medical Center Guiding Principles in
Gout and Nucleic Acid Metabolism Vol.33 No
Gout and Nucleic Acid Metabolism Vol.33 No.1 2009 1 1 2 3 in vitro 14 IgM 1 IgM IgM 1 PAMPs Pattern recognition receptors PRRs PRRs PRRs PAMPs Toll Toll-like receptor TLR PAMPs Nod Nod-like receptor NLR
Signal transduction networks in cancer. Prof. Dr. Thomas Wirth Institute of Physiological Chemistry Ulm University
Signal transduction networks in cancer Prof. Dr. Thomas Wirth Institute of Physiological Chemistry Ulm University How is a cancer cell characterized? Hanahan/Weinberg: The new hallmarks of cancer (Altered)
Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
The Pennsylvania State University The Graduate School Graduate Program in Integrative Biosciences PHYSIOLOGICAL AND PATHOLOGICAL ACTIVATION OF IKK AND
The Pennsylvania State University The Graduate School Graduate Program in Integrative Biosciences PHYSIOLOGICAL AND PATHOLOGICAL ACTIVATION OF IKK AND IKK-RELATED KINASES A Dissertation in Integrative
Chapter 3 The Induced Responses of Innate Immunity
Chapter 3 The Induced Responses of Innate Immunity Pattern recognition by cells of the innate immune system Pattern recognition by cells of the innate immune system 4 main pattern recognition receptors
Think Tank on Molecular Targets: Survival and Death Pathways in Cancer
Think Tank on Molecular Targets: Survival and Death Pathways in Cancer Oncogenes Induce Cell Proliferation & Cell Death Proliferation Mitogens ONCOGENES Apoptosis Adapted from G Evan Survival Signals Block
The Innate Immune Response is Conserved Throughout Evolution and is Triggered by Pattern Recognition. Lipopolysaccharide = Lipid + Polysaccharide
The Innate Immune Response is Conserved Throughout Evolution and is Triggered by Pattern Recognition Lipopolysaccharide = Lipid + Polysaccharide E.coli Cell wall organization Lipopolysaccharide Outer membrane