Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
|
|
- Claude Thornton
- 6 years ago
- Views:
Transcription
1 5HT1a NM_ Serotonin Receptor 1a 5HT1b NM_ Serotonin Receptor 1b 5HT2a NM_ Serotonin Receptor 2a ACO-2 NM_ Aconitase 2 Adora2A NM_ Adenosine A2a Receptor Aif1 (IbaI) D Allograft Inflammatory Factor 1 ATP5b NM_ ATP Synthase BDNF I EF Brain-Derived Neurotrophic Factor, Isoform I BDNF II EF , EF , EF Brain-Derived Neurotrophic Factor, Isoform II BDNF IV EF Brain-Derived Neurotrophic Factor, Isoform IV BDNF IX EF Brain-Derived Neurotrophic Factor, Isoform IX, full length BDNF VI EF Brain-Derived Neurotrophic Factor, Isoform VI C1q, C NM_ Complement Component 1 Qc C3 ENSMUST ENSMUSG Complement Component 3 C4 ENSMUST ENSMUSG Complement Component 4 CANX NM_ , NM_ , NM_ , Calnexin CAT BC NM_ Catalase CB1 NM_ Cannabinoid Receptor 1 CD4 NM_ Cell Differentiation Antigen 4 CHAT NM_ Choline )-Acetyltransferase CHRM1 NM_ NM_ Cholinergic Recepetor 1 CHRNA4 NM_ Cholinergic Receptor a4 CHRNB2 NM_ Cholinergic Receptor b2 CTH (CSE) NM_ Cystathionine Gamma-Lyase D1A NM_ Dopamine Receptor D1 DARPP32 (PPP1R1B) NM_ Protein Phosphatase 1, Regulatory Inhibitor Subunit 1b DRD2 NM_ Dopamine Receptor D2 EEF2 NM_ Eukaryotic Translation Elongation Factor 2 EGR2 NM_ Early Growth Response 2 Eif4A2 NM_ NM_ NM_ Eukaryotic Translation Initiation Factor 4a2 FERRITIN BC BC115514:EMBL IRAMp995d1324Q Ferritin (Mitochondrial) (MITOCHONDRIAL) FTH1 (ferritin heavy chain 1) NM_ Ferritin Heavy Chain 1 FTL1 (ferritin light chain 1) NM_ Ferritin Light Chain 1
2 GABRD NM_ GABA-A Receptor delta GAD1 (GAD67) NM_ Glutamate Decarboxylase 1 GAD2 (GAD65) NM_ Glutamate Decarboxylase 2 GAPDH NM_ NM_ Glyceraldehyde-3-Phosphate Dehydrogenase GCLC NM_ Glutamate-Cystein Ligase, Catalytic Subunit GFAP NM_ NM_ Glial Fibrillary Acidic Protein HO-1 NM_ Heme Oxygenase 1 Hrh3 NM_ Histamine Receptor 3 Htt (Exon 1) NM_ Huntington Htt (knock-in) NM_ Huntington Htt (total) NM_ Huntingtin IL-10 NM_ Interleukin 10 IL-12 NM_ Interleukin 12 IL-1beta NM_ Interleukin 1 beta IL-6 NM_ Interleukin 6 inos (NOS2) NM_ Notric Oxide Synthase 2 KEAP1 NM_ , NM_ , NM_ , NM_ Kelch-Like ECH-Associated Protein 1 MAPK-1 ENSMUST Mitogen-Activated Protein Kinase 1 Matrillin1 (whole body) NM_ Matrilin 1 mglur2 (Grm2) NM_ Glutamate Receptor 2 mglur5 (Grm5) NM_ Glutamate Receptor 5 MT3 NM_ Metallothionein 3 NK1 Receptor (NK1R) NM_ Tachykinin Receptor 1 nnos (NOS1) NM_ Notric Oxide Synthase 1 NQO-1 NM_ NADPH Dehydrogenase Quinone 1 NRF-2 NM_ Nuclear Respiratory Factor 2 NT-PGC1A NR_ NM_ N-terminal isoform of PGC1a PDE10A NM_ NM_ Phosphodiesterase 10a PDE2A NM_ NM_ NM_ Phosphodiesterase 2a PDE9A NM_ NM_ Phosphodiesterase 9a PDYN (Pro-dynorphin) NM_ Prodynorphin
3 penk NM_ Proenkephalin PGC1A NR_ NM_ Peroxisome Proliferator-Activated Receptor 1 alpha Pleiotrophin (PTN) NM_ Pleiotrophin Pro-enkephalin A (PENK) NM_ Pro-enkephalin A Pvalb NM_ Parvalbumin Pvalb ENSMUST ENSMUSG Dynorphin RPL13a NM_ Ribosomal Protein L13a Serpini1 NM_ Serpin Peptidase Inhibitor 1 SLc1a2 (GLT1) NM_ NM_ NM_ Solute Carrier Family 1 (Glial High Affinity Gulatmate Transporter) SMN1 NM_ Survival of Motor Neuron 1 SOD-2 NM_ Superoxide Dismutase 2 SST NM_ Somatostatin Supt4h NM_ Suppressor of Ty 4 Homolog 1 Synaptophysin (SYP) NM_ Synaptophysin TBP NM_ TATA Binding Protein TDG NM_ Thymine-DNA Glycosylase TNF-ALPHA NM_ Tumor Necrosis Factor alpha TrkB M Tyrosine Receptor Kinase B TSPO NM_ Translocator Protein UBC NM_ Ubiquitin C
4 Validated Rat Quantitative RT-PCR Genes ATP5B NM_ ATP Synthase BDNF I EF Brain-Derived Neurotrophic Factor, Isoform I BDNF IV EF Brain-Derived Neurotrophic Factor, Isoform IV BDNF IX NM_ Brain-Derived Neurotrophic Factor, Isoform IX, full length BDNF VI EF Brain-Derived Neurotrophic Factor, Isoform VI CANX NM_ Calnexin CB1 NM_ Cannabinoid Receptor 1 CREB NM_ NM_ Camp Responsive Element Binding Protein 1 Cth NM_ Cystathionine Gamma-Lyase D1A NM_ Dopamine Receptor D1 DARPP32 NM_ Protein Phosphatase 1, Regulatory Inhibitor Subunit 1b DRD2 NM_ Dopamine Receptor D2 EIF4A2 NM_ Eukaryotic Translation Initiation Factor 4a2 GAPDH NM_ Glyceraldehyde-3-Phosphate Dehydrogenase GLT1 NM_ Solute Carrier Family 1 (Glial High Affinity Gulatmate Transporter) HTT NM_ Huntingtin NRF2 NM_ Nuclear Respiratory Factor 2 PDE10A NM_ Phosphodiesterase 10a PDE2A NM_ NM_ Phosphodiesterase 2a PGC1A NM_ Peroxisome Proliferator-Activated Receptor 1 alpha TSPO NM_ Translocator Protein
5 Validated Human Quantitative RT-PCR Genes BDNF CDS NM_ Brain-Derived Neurotrophic Factor GDNF NM_ Glial Cell Derived Neurotrophic Factor Htt NM_ Huntingtin PTN NM_ Pleiotrophin SMN2 NM_ Survival Of Motor Neuron 2
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationVSL#3 sachets were refrigerated (4 C) and treatments were prepared daily using new sachets.
Supplementary Materials and Methods VSL#3 administration VSL#3 sachets were refrigerated (4 C) and treatments were prepared daily using new sachets. Rats were placed into individual cages daily between
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationBiomarkers for Hypothesis Testing
Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationPost-translational modifications of proteins in gene regulation under hypoxic conditions
203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and
More informationBiological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
More informationSupplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and
Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and resveratrol are not direct activators of SIRT1 Supplementary Figure Legends Figure S1. Determination of SIRT1 K
More informationChapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary
More informationCOGNITIVE SCIENCE 107A
COGNITIVE SCIENCE 107A Neurotransmitters Jaime A. Pineda, Ph.D. Exocytosis ~20 Amino Acids Used for Protein Synthesis Non-essential (Our bodies can make them) Alanine (A) Arginine (R) Asparagine (N) Aspartate
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationNature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
More informationGenetic Contributors to Alcohol Use and Misuse in Young People
Genetic Contributors to Alcohol Use and Misuse in Young People Marianne BM van den Bree Professor of Psychological Medicine Institute of Psychological Medicine and Clinical Neurosciences MRC Centre for
More informationFunctional Cell-Based Assays
2017 Page 1/8 Axxam S.p.A. (Italy) offers functional cell-based assays for protein targets of relevance to drug discovery research, including challenging targets such as multi subunit ion channels and
More informationKaram Darwish. Saleh Fayez AL-jbour. Diala
1 Karam Darwish Saleh Fayez AL-jbour Diala Neurotransmitters Note: anything written with the italic font and present between brackets is from the slides. A neurotransmitter is a chemical substance that
More informationCornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
More informationAVAILABLE BIOMARKER ASSAYS
AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationAdvanced Neurotransmitters & Neuroglia
Advanced Neurotransmitters & Neuroglia Otsuka Pharmaceutical Development & Commercialization, Inc. 2017 Otsuka Pharmaceutical Development & Commercialization, Inc., Rockville, MD Lundbeck, LLC. February
More informationMitochondria and ATP Synthesis
Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy
More informationSupporting Information
Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng
More informationNeurobiology of Addiction
Neurobiology of Addiction Domenic A. Ciraulo, MD Director of Alcohol Pharmacotherapy Research Center for Addiction Medicine Department of Psychiatry Massachusetts General Hospital Disclosure Neither I
More informationPETER L. LUTZ. Red-eared slider Trachemys scripta elegans
www.carleton.ca/~kbstorey PETER L. LUTZ Red-eared slider Trachemys scripta elegans Lutz PL, Storey KB. 1997. Handbook of Physiology (Dantzler WH, ed) Oxford Univ. Press, Vol. 2, pp. 1479-1522. 1 Relative
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationMechanistic Toxicology
SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi
More informationOxidation and Methylation in Human Brain: Implications for vaccines
Oxidation and Methylation in Human Brain: Implications for vaccines 1 Life can be viewed through the perspective of oxidation and reduction, which involves the loss and gain of electrons, respectively.
More informationNBCE Mock Board Questions Biochemistry
1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationPCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationCognitive and Behavioral Phenotypes: SNPs of Interest
Cognitive and Behavioral Phenotypes: SNPs of Interest Chr Apolipoprotein E (APOE) 19 Trait Associated with the Alzheimer s Disease, Cognitive Function SNP Position 1,2,5,6,7, 11,20,23, 24,30,34,35 coded_a
More informationProtein carbonylation: a marker of oxidative stress damage
Protein carbonylation: a marker of oxidative stress damage ITN-TREATMENT Metabolic Dysfunctions associated with Pharmacological Treatment of Schizophrenia TREATMENT Protein carbonyl formation: Metal-Catalyzed
More informationProteasomes. When Death Comes a Knock n. Warren Gallagher Chem412, Spring 2001
Proteasomes When Death Comes a Knock n Warren Gallagher Chem412, Spring 2001 I. Introduction Introduction The central dogma Genetic information is used to make proteins. DNA RNA Proteins Proteins are the
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationSection: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n):
Section: Chapter 5: Multiple Choice 1. The structure of synapses is best viewed with a(n): p.155 electron microscope. light microscope. confocal microscope. nissle-stained microscopic procedure. 2. Electron
More informationNeurotransmitter Systems III Neurochemistry. Reading: BCP Chapter 6
Neurotransmitter Systems III Neurochemistry Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the most important
More informationPETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER
PETER PAZMANY CATHOLIC UNIVERSITY SEMMELWEIS UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAZMANY
More informationBiochemistry of neurotransmitters. Dr. Mamoun Ahram Neuroscience 2015
Biochemistry of neurotransmitters Dr. Mamoun Ahram Neuroscience 2015 References This lecture Mark s Basic Medical Biochemistry, 4 th ed, pp. 908-918 http://what-whenhow.com/neuroscience/neurotransmitters-theneuron-part-1/
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationNEUROBIOLOGY ALCOHOLISM
NEUROBIOLOGY ALCOHOLISM THERE HAS BEEN A MAJOR THEORETICAL SHIFT IN MEDICATION DEVELOPMENT IN ALCOHOLISM Driven by animal models of intermittent ethanol administration followed by termination, then access
More informationPhenotypic analysis of primary colorectal cancer to inform the management of metastatic disease
Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease Paul Sutton CR(UK) Clinical Research Training Fellow Chester Colorectal Research Disclosures Holder of CR(UK)
More informationCharacterisation of neurons derived from a cortical human neural stem cell. line CTX0E16
Characterisation of neurons derived from a cortical human neural stem cell line CTX0E16 Greg W. Anderson 1 *, P. J. Michael Deans 1 *, Ruth D. T. Taylor 2, Ding Chen 1, Pooja Raval 1, Harrison Lowder 1,
More informationMaturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
More informationReview of Neurochemistry
Review of Neurochemistry UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY PBL MBBS YEAR III SEMINAR VJ Temple 1 CEREBRAL METABOLISM What are some
More informationCitric acid cycle and respiratory chain. Pavla Balínová
Citric acid cycle and respiratory chain Pavla Balínová Mitochondria Structure of mitochondria: Outer membrane Inner membrane (folded) Matrix space (mtdna, ribosomes, enzymes of CAC, β-oxidation of FA,
More informationChapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
More informationnumber Done by Corrected by Doctor Nayef Karadsheh
number 11 Done by حسام أبو عوض Corrected by Moayyad Al-Shafei Doctor Nayef Karadsheh 1 P a g e General Regulatory Aspects in Metabolism: We can divide all pathways in metabolism to catabolicand anabolic.
More informationProtein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
More informationMITOCHONDRIA LECTURES OVERVIEW
1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The
More informationTable S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
More informationREACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
More informationNeuropharmacology NOTES
Neuropharmacology NOTES Contents Topic Page # Lecture 1- Intro to Neurochemical Transmission & Neuromodulation 2 Lecture 2- Serotonin & Noradrenaline 7 Lecture 3- Acetylcholine & Dopamine 14 Lecture 4-
More information1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled
Protein Targeting Objectives 1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled As a protein is being synthesized, decisions
More informationSupplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
More informationSignal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
More informationElectron Transport Chain and Oxidative phosphorylation
Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly
More informationBiologic Oxidation BIOMEDICAL IMPORTAN
Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron
More informationCoenzymes, vitamins and trace elements 209. Petr Tůma Eva Samcová
Coenzymes, vitamins and trace elements 209 Petr Tůma Eva Samcová History and nomenclature of enzymes 1810, Gay-Lussac made an experiment with yeats alter saccharide to ethanol and CO 2 Fermentation From
More informationDiosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
More informationSupplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
More informationScantron Instructions
BIOLOGY 1A MIDTERM # 1 February 17 th, 2012 NAME SECTION # DISCUSSION GSI 1. Sit every other seat and sit by section number. Place all books and paper on the floor. Turn off all phones, pagers, etc. and
More informationSynapses and Neurotransmitters.
Synapses and Neurotransmitters Loai.physiology@yahoo.com Communication Between Neurons Synapse: A specialized site of contact, and transmission of information between a neuron and an effector cell Anterior
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationCellular Neurobiology / BIPN 140
SECOND MIDTERM EXAMINATION Fall, 2015 GENERAL INSTRUCTIONS 1. Please write your name on ALL 6 pages. 2. Please answer each question IN THE SPACE ALLOTTED. 1) /10 pts 2) /10 pts 3) /15 pts 4) /15 pts 5)
More informationDeveloping a clinically feasible personalized medicine approach to pediatric
Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott
More informationChapter 10. 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation)
Chapter 10 이화작용 : 에너지방출과보존 (Catabolism: Energy Release and Conservation) 1 Fueling Processes Respiration 1 Most respiration involves use of an electron transport chain As electrons pass through the electron
More informationOxidative Phosphorylation
Oxidative Phosphorylation Energy from Reduced Fuels Is Used to Synthesize ATP in Animals Carbohydrates, lipids, and amino acids are the main reduced fuels for the cell. Electrons from reduced fuels are
More informationINTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
More informationAn excess dietary vitamin E concentration does not influence Nrf2 signaling in the liver of rats fed either soybean oil or salmon oil
Eder et al. Nutrition & Metabolism (2017) 14:71 DOI 10.1186/s12986-017-0225-z RESEARCH Open Access An excess dietary vitamin E concentration does not influence Nrf2 signaling in the liver of rats fed either
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More information2. You will need a Scantron and a pencil for this exam.
Exam III Chemistry 306 Fall 2009 Roper Name Exam Number Instructions: 1. Please turn in your chapter 21 and 23 homework. 2. You will need a Scantron and a pencil for this exam. 3. Please bring your backpacks
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationبسم هللا الرحمن الرحيم
بسم هللا الرحمن الرحيم -Please refer to the slides from (4-20) -Slides (4, 5) -Oxidative phosphorylation consists of 2 parts: 1.electron transport chain (series of electron transport proteins much filled
More informationAmino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
More information2. (12 pts) Given the following metabolic pathway (as it occurs in the cell):
Answer Sheet 1 (Gold) 1. (1 pt) Write your exam ID (A) in the blank at the upper right of your answer sheet. 2. (12 pts) Given the following metabolic pathway (as it occurs in the cell): a. Would you expect
More informationBiochemistry of Neurotransmitters. Dr. Diala Abu-Hassan CNS
Biochemistry of Neurotransmitters Dr. Diala Abu-Hassan CNS References Mark s Basic Medical Biochemistry, 4 th ed, pp. 908-918 http://what-whenhow.com/neuroscience/neurotransmitters-theneuron-part-1/ What
More informationNutraHacker. Complete Gene Mutation Report for Customer: 4c72ce3a-1fff-4f58-981c-b4946d512e3b. Instructions:
NutraHacker Complete Gene Mutation Report for Customer: 4c72ce3a-1fff-4f58-981c-b4946d512e3b Instructions: NutraHacker reports mutations (single nucleotide polymorphisms) in this uploaded genome. Genes
More informationMohammad Tarek. Wahab Al-tekreeti Tamer Barakat. Faisal Mohammad
15 Mohammad Tarek Wahab Al-tekreeti Tamer Barakat Faisal Mohammad Things to remember Types of synapse: Neuron types and neurotransmitters When it happens between an axon and dendrites it is called axodendritic
More informationnumber Done by Corrected by Doctor Nafeth Abu Tarboush
number 8 Done by Ali Yaghi Corrected by Mamoon Mohamad Alqtamin Doctor Nafeth Abu Tarboush 0 P a g e Oxidative phosphorylation Oxidative phosphorylation has 3 major aspects: 1. It involves flow of electrons
More informationBIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
More informationLIST OF FIGURES AND TABLES
ii LIST OF FIGURES AND TABLES GENERAL INTRODUCTION Fig. 1 Effect of Pb on antioxidant enzymes and cofactors leading to inactivation of enzyme activity Fig. 2 Rationale between Pb exposures among low SES
More informationMoh Tarek + Faisal Massad. Tala Saleh ... Naif
19 Moh Tarek + Faisal Massad Tala Saleh... Naif Last lecture we ve talked about the main antioxidant system which are the enzymes found in our body, mainly: 1. Glutathione peroxidase 2. Super oxide dismutase(sod)
More informationCellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationReactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh
Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%
More informationOmar Ismail. Dana Almanzalji. Faisal Mohammad
11 Omar Ismail Dana Almanzalji Faisal Mohammad Neuronal classification: Neurons are responsible for transmitting the action potential to the brain. The speed at which the action potential is transmitted
More informationHeme-based CO sensors. CooA. Cystathionine b-synthase (CBS)
Heme-based CO sensors CooA Cystathionine b-synthase (CBS) 1 Carbon monoxide (CO): Simple! Heme Fe(II) complex, Metal complex NO, H 2 S : Complicated! Heme iron complex, Protein modification, Other molecules
More informationRedox regulated transcription factors
Redox regulated transcription factors, MD PhD Division of Biochemistry Medical Biochemistry and Biophysics Karolinska Institutet Stockholm, Sweden Elias.Arner@ki.se Redox regulation A process of regulated
More informationChapter-5 Respiration in Plants Very Short Answers Questions: 1. Different substrates get oxidized during respiration. How does respiratory quotient (RQ) indicate which type of substrate i.e. carbohydrate,
More informationMyokines, Exercise, Metabolism. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Myokines, Exercise, Metabolism ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview: Why? Evolutionary perspective How? Myokines: what they are and what they do Exercise and physiology Energy restriction
More informationBIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
More informationROLE OF ASTROGLIAL α7 NICOTINIC ACETYLCHOLINE RECEPTORS IN NEUROINFLAMMATION AND OXIDATIVE STRESS. Thesis presented. Hiral B.
ROLE OF ASTROGLIAL α7 NICOTINIC ACETYLCHOLINE RECEPTORS IN NEUROINFLAMMATION AND OXIDATIVE STRESS Thesis presented By Hiral B. Patel To The Bouve Graduate School of Health Sciences in Partial Fulfillment
More information