Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
|
|
- Neal Gibbs
- 5 years ago
- Views:
Transcription
1 Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski, Aaron K. Grant, Soumya Ullas, Kevin Rhee, Jillian D. Cavanaugh, Neermala Poudel Neupane, Camilla L. Christensen, Jan M. Herter, G. Mike Makrigiorgos, F. Stephen Hodi, Gordon J. Freeman, Glenn Dranoff, Peter S. Hammerman, Alec C. Kimmelman, and Kwok-Kin Wong Supplementary Figure 1 5 Supplementary ables 1
2 Supplementary Figure 1 A H Pre-treatment 8 weeks post 14 weeks post B Pre-treatment H 8 weeks post 2 weeks post L Supplementary Figure 1 umor growth kinetics in response to R and αpd-1 treatment in Kras-mutant murine NSCLC. (A) Representative MR images of a responsive (left lung) Kras-driven tumor at different time points (baseline, 8, and 14 weeks post treatment initiation). Contralateral tumor growth in the right lung (n=7). (B) Representative MR images of a resistant (left lung) Kras-driven tumor at different time points (baseline, 8, and 2 weeks post treatment initiation) (n=3). H (heart) circled in red. L (liver) circled in green. (tumor) circled with white/blue dotted line. 2
3 Supplementary Figure 2 A R refractory + αpd-1 R refractory B R refractory + αpd-1 R refractory cell exhaustion/inhibition cell recruitment/ activation Btla Eomes Ctla4 Lag3 Pd-1 Il1b Ccl5 Ifng Gzmb log2 M1-associated genes M2-associated genes Lrp1 Irf4 Mrc1 Socs1 Cd36 Arg1 gfb1 Il13 Il1 Il4 Ifnb1 Ifna4 Ifna2 Ifna1 Vegfc Vegfa Il6 nf Il23a Il12b Il12a Nos log2 Supplementary Figure 2 reatment of R-refractory K tumors with αpd-1 induces marker of cell inhibition. (A) Expression of selected cell-associated genes in Rrelapsed and R-relapsed αpd-1-treated tumors. (B) Expression of selected macrophage-associated genes in R-relapsed and R-relapsed αpd-1-treated tumors. Representative data are shown from mouse ncounter PanCancer Immune Profiling Panel conducted with RNA from 4 R-treated and 4 R-refractory αpd-1-treated mice (A, and B). Data are represented as mean ± SEM. Btla, B- and -lymphocyte attenuator; Eomes, Eomesodermin; Il1b, Interleukin 1 beta; Ccl5, Chemokine (C-C motif) ligand 5; Ifng, Interferon gamma; Gzmb, granzyme B; Lrp1, Low density lipoprotein receptor-related protein 1; Irf4, Interferon regulatory factor 4; Mrc1, Mannose receptor, C ype 1; Socs1, Suppressor of cytokine signaling 1; CD36, CD36 Molecule/hrombospondin receptor; Arg1, Arginase 1; gfb1, transforming growth factor beta-1; Il13, Interleukin 13; Il1, Interleukin 1; Il4, Interleukin 4; Ifnb1, Interferon beta 1; Ifna4, Interferon alpha 4; Ifna2, Interferon alpha 2; Ifna1, Interferon alpha 1; Vegfc, Vascular endothelial growth factor C; Vegfa, Vascular endothelial growth factor A; Il6, Interleukin 6; nf, umor necrosis factor; Il23a, Interleukin 23 alpha; Il12b, Interleukin 12 beta; Il12a, Interleukin 12 alpha; Nos2, Nitric oxide synthase 2. 3
4 Supplementary Figure 3 reatment response to R of Kras tumors 3 umour volume change (%) Weeks Supplementary Figure 3 umor growth kinetics in response to R in Kras-mutant murine NSCLC. umor volume kinetics of R-treated tumors. Each line represents one mouse (n=5). Data of this cohort was previously published (Herter-Sprie et al., 214). 4
5 Supplementary Figure 4 A CD45+ /EpCAM+ ratio [per mg tumor] unirradiated αpd-1 R+αPD-1 R B H Pre-treatment 4 weeks post R + αpd-1 6 weeks post R + αpd-1 D count/mg 3 Kras Kras/Lkb1 ** * 2 1 AM AN 8 % on CD8+ cells 4 Markers on tumor infiltrating CD8+ cells 6 * ** ** 4 2 Pd-1 Lag3 im3 6 % on CD4+ cells C Ctla4 Markers on tumor infiltrating CD4+ cells 4 2 Pd-1 Lag3 im3 Ctla4 Supplementary Figure 4 umor growth kinetics in response to R and αpd-1 treatment in Kras/Lkb1-mutant murine NSCLC and differences in tumor-associated immune cell populations compared to Kras-mutant murine NSCLC. (A) CD45+/EpCAM+ ratio calculated from Figure 5B (3 unirradiated, 3 R-treated, 3 αpd-1-treated, and 4 R+αPD-1-treated mice). (B) MR images of a progressive Kras/Lkb1 tumor at different time points (baseline, 4, and 6 weeks post treatment initiation) (n=2). H (heart) circled in red. (tumor) circled with white/blue dotted line. (C) Representative flow cytometry data (live/single/total CD45+ cells). otal numbers of tumor-infiltrating myeloid cells of unirradiated Kras and Kras/Lkb1 tumors (taken from Figure 2B and Figure 5B). (D) Expression of inhibitory cell markers on CD8+ and CD4+ cells of unirradiated Kras and Kras/Lkb1 tumors (taken from Figure 2E and Figure 5D). Representative data are shown conducted with 5 unirradiated Kras, and 3 unirradiated Kras/Lkb1 mice (C and D). Data are represented as mean ± SEM. P values were calculated using two-tailed Student s t-test. ***P<.1, **P<.1, *P<.5. 5
6 Supplementary Figure 5 adapted from Koyama et al., Cancer Res., 216 Alveolar macrophages (umor-associated macrophages: AM) umor cells CD13 + DC CD45 CD11c Live/Single cell gating Neutrophils (umor-associated neutrophils: AN) CD13 EpCAM or SSC-A CD45 CD11c Ly-6G CD19 FSC-A FSC-A CD11b CD11b CXCR2 NKp46 CD3 SSC-A SSC-A CD8a DX5 FSC-A Ly-6C Siglec-F CCR3 CD4 CD3 Eosinophils Ly-6C hi monocytes CD8 + cells NK cells Other myeloid cells (CD11b + DC, tissue macrophages, Ly-6C lo monocytes, etc.) 6 B cells CD4 + cells
7 Supplementary able 1 Antigen Clone Source Antigen Clone Source CD45 3-F11 BioLegend Siglec F E5-244 BD Biosciences CD3ε 145-2C11 BioLegend PD-1 29F.1A12 BioLegend CD4 RM4-5 BioLegend IM-3 RM3-23 BioLegend CD8a BioLegend LAG-3 C9B7W BioLegend CD19 6D5 BioLegend CD13 2E7 BioLegend DX5 DX5 BioLegend PD-L1 1F.9G2 BioLegend NKp46 29A1.4 BioLegend EpCAM G8.8 BioLegend CD11c N418 BioLegend CD16/32 2.4G2 BioLegend CD11b M1/7 BioLegend Ly-6G 1A8 BioLegend FOXP3 FJK-16s ebioscience Ly-6C HK1.4 BioLegend CLA-4 UC1-4B9 ebioscience Supplementary able 1 List of murine antibodies used for flow cytometry analysis. 7
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.
Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationTo compare the relative amount of of selected gene expression between sham and
Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationSupporting Information
Supporting Information Aldridge et al. 10.1073/pnas.0900655106 Fig. S1. Flow diagram of sublethal (a) and lethal (b) influenza virus infections. (a) Infection of lung epithelial cells by influenza virus
More informationSupplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and
More informationSUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
More informationSupplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).
Intra Immune nalysis Surface Supplementary Figure 1. Flow cytometry panels used for D Canto () and D Fortessa (). Name Fluorochrome ID F488 PE PerCp-Cy5.5 PC Paclue PE-Cy7 PC-H7 Lympho* 1 CD56 CD8 CD16
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationInterferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation
Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart,, Werner Müller, Giorgio Trinchieri J Clin Invest. 2013;123(11):4859-4874. https://doi.org/10.1172/jci65180.
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationFluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)
Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In the manuscript Rational Combination of CXCL11-Expressing Oncolytic Virus and PD-L1 Blockade Works Synergistically to Enhance Therapeutic Efficacy
More informationAn interleukin-17-mediated paracrine network promotes tumor resistance to anti-angiogenic therapy
CORRECTION NOTICE Nat. Med. 9, 111 113 (13) An interleukin-17-mediated paracrine network promotes tumor resistance to anti-angiogenic therapy Alicia S Chung, Xiumin Wu, Guanglei Zhuang, Hai Ngu, Ian Kasman,
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationEosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
More informationNature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.
Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small
More informationSupplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,
a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow
More informationPHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE.
SUPPLEMENTARY FIGURES, TABLES AND VIDEOS PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE. Clément Ricard 1,2,3,4, Aurélie Tchoghandjian 2,4, Hervé Luche 5, Pierre
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationChitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells
Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,
More informationQuestion 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?
Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes
More informationA fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue
A fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue Soner Altiok, MD, PhD Chief Scientific Officer Nilogen Oncosystems Tampa, Florida - Nilogen Oncosystems,
More informationSUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
More informationWelcome. Nanostring Immuno-Oncology Summit. September 21st, FOR RESEARCH USE ONLY. Not for use in diagnostic procedures.
Welcome Nanostring Immuno-Oncology Summit September 21st, 2017 1 FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. Agenda 4:00-4:30
More informationCB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response
CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, CA Arginine Depletion by Arginase
More informationHuman Immune System (HIS) mouse models for translational research. Barbara Joyce-Shaikh
Human Immune System (HIS) mouse models for translational research Barbara Joyce-Shaikh Humanized Immune System (HIS) Mouse Models Goals Enable clinically relevant in vivo studies of human cells, tissues,
More informationImmune reprogramming via PD-1 inhibition enhances early-stage lung cancer survival
Immune reprogramming via PD-1 inhibition enhances early-stage lung cancer survival Geoffrey J. Markowitz, 1,2,3 Lauren S. Havel, 1,2,3 Michael J.P. Crowley, 3,4 Yi Ban, 1,2,3 Sharrell B. Lee, 1,3 Jennifer
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationManipulating the Tumor Environment
Manipulating the Tumor Environment Vincenzo Bronte Verona University Hospital vincenzo.bronte@univr.it Escape from immune control can be viewed as one of the «Hallmarks of Cancer» D. Hanahan and R. A.
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationImmunology. Antibodies for immunology research
Immunology Antibodies for immunology research antibodies for immunology research BP0169 BP0003-1 BP0004-1 BP0061 CD4 + T cells Control LOB12.3 Relative Cell Number CD4 (55 kda) CD8α (35 kda) CD8α (35 kda)
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationSupplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,
More informationTumor Microenvironment and Immune Suppression
Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation
More informationCD44
MR1-5-OP-RU CD24 CD24 CD44 MAIT cells 2.78 11.2 WT RORγt- GFP reporter 1 5 1 4 1 3 2.28 1 5 1 4 1 3 4.8 1.6 8.1 1 5 1 4 1 3 1 5 1 4 1 3 3.7 3.21 8.5 61.7 1 2 1 3 1 4 1 5 TCRβ 2 1 1 3 1 4 1 5 CD44 1 2 GFP
More informationCategorical analysis of human T cell heterogeneity with One-SENSE
1 2 3 4 Supplementary Information Categorical analysis of human T cell heterogeneity with One-SENSE 5 6 Running title: T cell Analysis by One-SENSE 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26
More informationFigure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
More informationDISCOVER MORE WITH LESS SAMPLE. nanostring.com/3d
nanostring.com/3d DISCOVER MORE WITH LESS SAMPLE. WHY COMPROMISE? ncounter Vantage ASSAYS POWERED BY 3D BIOLOGY TECHNOLOGY Don t let sample volume limit your analytical aspirations. Quantify DNA, RNA,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More information1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.
938 939 940 941 942 Figure S1 Schematic of the in silico TCRminer and MiXCR validation. 1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created. Then, 100,000 simulated 80 bp
More informationRegulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.
Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationExpanded View Figures
Gregory T Ellis et al Lung damage by monocyte TRIL allows coinfection EMO reports Expanded View Figures % survival Clinical score Influenza Matrix /HPRT (log ) CFU/L (log ) 3 irway early.7.7 + h Survival
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Johnson DB, Balko JM, Compton ML, et al. Fulminant myocarditis
More informationDarwinian selection and Newtonian physics wrapped up in systems biology
Darwinian selection and Newtonian physics wrapped up in systems biology Concept published in 1957* by Macfarland Burnet (1960 Nobel Laureate for the theory of induced immune tolerance, leading to solid
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationCancer Research. Abstract. Introduction
Priority Report Cancer Research STK11/LKB1 Deficiency Promotes Neutrophil Recruitment and Proinflammatory Cytokine Production to Suppress T-cell Activity in the Lung Tumor Microenvironment Shohei Koyama
More informationTable S1. Viral load and CD4 count of HIV-infected patient population
Table S1. Viral load and CD4 count of HIV-infected patient population Subject ID Viral load (No. of copies per ml of plasma) CD4 count (No. of cells/µl of blood) 28 7, 14 29 7, 23 21 361,99 94 217 7, 11
More informationOnline supplement. Phenotypic, functional and plasticity features of classical and alternatively activated
Online supplement Phenotypic, functional and plasticity features of classical and alternatively activated human macrophages Abdullah Al Tarique*, Jayden Logan *, Emma Thomas *, Patrick G Holt *, Peter
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More informationSupplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
More informationInterferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation
Research article Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation C. Andrew Stewart, 1 Hannah Metheny, 1 Noriho Iida, 1 Loretta Smith, 1 Miranda Hanson, 1 Folkert Steinhagen,
More informationHuman Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4
Human Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4 Ankita Garg, Rodney Trout and Stephen A. Spector,,* Department
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationNature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kennedy GA, Varelias A, Vuckovic S, et al.
More informationGene expression profiling in pediatric septic shock: biomarker and therapeutic target discovery
Gene expression profiling in pediatric septic shock: biomarker and therapeutic target discovery Hector R. Wong, MD Division of Critical Care Medicine Cincinnati Children s Hospital Medical Center Cincinnati
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): This manuscript builds on the recently published observation by the same investigators that TNBC tumors with Ras/MAPK activation have decreased
More information4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
More informationTim-3 as a target for tumor immunotherapy
Tim-3 as a target for tumor immunotherapy Ana Carrizosa Anderson Brigham and Women s Hospital Harvard Medical School Disclosures A portion of the work has been performed as part of a sponsored research
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationSupplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
More informationJanuary 25, 2017 Scientific Research Process Name of Journal: ESPS Manuscript NO: Manuscript Type: Title: Authors: Correspondence to
January 25, 2017 Scientific Research Process Name of Journal: World Journal of Gastroenterology ESPS Manuscript NO: 31928 Manuscript Type: ORIGINAL ARTICLE Title: Thiopurine use associated with reduced
More informationNKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationHD1 (FLU) HD2 (EBV) HD2 (FLU)
ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127
More informationSupplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
More informationTitle. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
More informationRadiation Therapy as an Immunomodulator
Radiation Therapy as an Immunomodulator Yvonne Mowery, MD, PhD February 20, 2017 Tumor/Immune System Balance Kalbasi, JCI 2013 UNC-Duke-NC State-Wake Forest Spring 2017 2 RT Can Shift Balance Toward Elimination
More informationCLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM
CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM CANCER RESEARCH CENTRE, UNIVERSITY AND UNIVERSITY HOSPITAL OF SALAMANCA (SPAIN)( Sao Paulo, 18th of April, 2009 IDENTIFICATION OF HPC (I) 1.- In vivo
More informationEffector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
More informationFOCiS. Lecture outline. The immunological equilibrium: balancing lymphocyte activation and control. Immunological tolerance and immune regulation -- 1
1 Immunological tolerance and immune regulation -- 1 Abul K. Abbas UCSF FOCiS 2 Lecture outline Principles of immune regulation Self-tolerance; mechanisms of central and peripheral tolerance Inhibitory
More informationAsian Zika virus strains target CD14 + blood monocytes and induce M2-skewed immunosuppression during pregnancy
SUPPLEMENTARY INFORMATION Articles DOI:./s-7-- In the format provided y the authors and unedited. Asian Zika virus strains target CD + lood monocytes and induce M-skewed immunosuppression during pregnancy
More information