Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases

Size: px
Start display at page:

Download "Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases"

Transcription

1 54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of Clinical Application of Biologics, Osaka University Graduate School of Medicine, Osaka University, Osaka, Japan 2) Department of Immunopathology, WPI Immunology Frontier Research Center, Osaka University, Osaka, Japan 3) Department of Respiratory Medicine, Allergy and Rheumatic Diseases, Osaka University Graduate School of Medicine, Osaka University, Osaka, Japan 4) Laboratory of Immunoregulation, WPI Immunology Frontier Research Center, Osaka University, Osaka, Japan Interleukin-6 (IL-6), originally identified as a B cell stimulatory factor-2, is a typical cytokine featuring redundancy and pleiotropic activity. A transient expression of IL-6 participates in host defense against acute environmental stress such as infections and injuries by activating immune responses, hematopoiesis and acute phase reactions. However, its abnormal, persistent production plays an important pathological role in the development of various autoimmune inflammatory diseases, so that it was hypothesized that IL-6 blockade would constitute a novel strategy for the treatment of such diseases and to this purpose tocilizumab, a humanized anti- IL-6 receptor monoclonal antibody, was developed. Clinical trials have indeed proved the efficacy and tolerable safety of tocilizumab for patients with moderate to severe rheumatoid arthritis, and it is now used as a made-in-japan innovative biologic for rheumatoid arthritis in more than 90 countries worldwide, as well as for patients with Castleman's disease and systemic and polyarticular juvenile idiopathic arthritis. Moreover, favorable results of recent clinical trials or case reports of off-label use with tocilizumab indicate that it is likely to be broadly applicable for the treatment of various autoimmune inflammatory diseases. Its wider application for various diseases as well as clarification of the mechanism(s) through which IL-6 blockade becomes clinically efficacious and of the etiology of dysregulated persistent IL-6 production in such diseases are important issues for future studies. Rec.11/1/2012, Acc.11/26/2012, pp54-65 Correspondence should be addressed to: Tadamitsu Kishimoto, Laboratory of Immunoregulation, WPI Immunology Frontier Research Center, Osaka University, 8F IFReC Building, 3-1 Yamada-oka, Suita City, Osaka , Japan. Phone: , Fax: , kishimoto@ifrec.osaka-u.ac.jp Key words anti-interleukin-6 receptor antibody, autoimmunity, inflammation, interleukin-6, tocilizumab

2 55 Fig.1 The human IL-6 structure Schematic representation of the human IL-6 structure shows the four long -helices, from A to D and three connecting loops. Two disulfide bonds are contained in loop A-B. Site I on the C-terminal end of helix D interacts with IL-6R, site II, located on helices A and C, interacts with one gp130, while site III on the N-terminal end of helix D interacts with another gp130. Fig.2 Pleiotropic activity of IL-6 IL-6 induces specific gene expression and cell differentiation. It induces production of acute phase proteins such as CRP, serum myloid A, fibrinogen, and hepcidin, whereas it reduces synthesis of albumin in hepatocytes. In bone marrow, IL-6 induces maturation of megakaryocytes into platelets. In addition, IL-6 induces Th17 differentiation from naïve CD4- positive T cells, whereas it inhibits Treg differentiation. It also induces cytotoxic T cell differentiation from CD8-positive T cells, and immunoglobulin synthesis in activated B cells. Moreover, IL-6 acts on synovial fibroblasts to produce RANKL and VEGF, which promote differentiation of osteoclasts and angiogenesis, respectively. Finally, IL-6 stimulates dermal fibroblasts to produce collagen. CRP: C-reactive protein, Treg: regulatory T cells, RANKL: receptor activator of NF- B ligand, VEGF: vascular endothelial growth factor Discovery of interleukin-6 Biological function of IL-6

3 56 ï Signaling system of IL-6 Fig.3 The IL-6 receptor system The figure on the left shows the IL-6 receptor system. After binding of IL-6 to the IL-6 receptor (IL-6R), the IL-6/IL-6R complex associates with gp130 and induces homodimerization of gp130, which triggers activation of JAKs and tyrosine-phosphorylation of cytoplasmic part of gp130. The phosphorylated gp130 then recruits STAT3 via the SH2- domain. Tyrosine-phosphorylated gp130 also recruits SHP-2 and activates the MAPK pathway. Next, activated STAT3 translocates into the nucleus and regulates transcription for various sets of genes including SOCS, which binds to JAK or gp130 and turns off IL-6 signals. The figure on the right shows that tocilizumab binds to transmembrane and soluble IL-6R and inhibits IL-6 binding to both types of IL-6R. JAKs: Janus kinase family tyrosine kinases, STAT3: signal transducer and activator of transcription 3, SHP-2: SH2-domain containing protein tyrosine phosphatase-2, MAPKs: mitogen-activated protein kinase, SOCS: suppressor of cytokine signaling

4 57 Fig.4 Transcriptional regulation of IL-6 gene IL-6 gene activation is positively or negatively regulated by transcriptional factors or micrornas. Several cisacting elements are shown. NF- B: nuclear factor kappa B, SP1: specificity protein 1, NF-IL6: nuclear factor IL-6, AP-1: activator protein 1, IRF-1: interferon regulatory factor 1, Tax: HTLV-1-derived transactivator protein, TAT: HIV-1 transactivator of the transcription, HBVX: hepatitis B virus X protein, GR: glucocorticoid receptor, ER: estrogen receptor, Rb: retinoblastoma, PPAR : peroxisome proliferator-activated receptor, Ahr: aryl hydrocarbon receptor, mir: microrna, IRAK1: interleukin-1 receptor-associated kinase 1, STAT3: signal transducer and activator of transcription 3, MRE: multiple response element Regulatory mechanism of IL-6 production

5 58 Fig.5 Posttranscriptional regulation of IL-6 mrna IL-6 expression is posttransciptionally regulated by several RNA binding proteins or micrornas. AU-rich elements (AREs) located in 3 untranslated region (UTR) of IL-6 mrna are shown. ORF: open reading frame, TTP: tristetraprolin, BRF-1: butyrate response factor-1, mir: microrna Fig.6 Arid5a counteracts the destabilizing effect of regnase-1 on IL-6 mrna Regnase-1 accerates IL-6 mrna degradation, whereas arid5a conteracts the destabilizing effect of regnase-1. The balance between arid5a and regnase- 1 plays an important role in IL-6 mrna stability. LPS: lipopolysaccharide, TLR4: Toll-like receptor 4, UTR: untranslated region

6 59 ï Pathogenesis of IL-6 in the development of autoimmune inflammatory diseases IL-6 targeting as strategy for autoimmune inflammatory diseases

7 60 Efficacy of tocilizumab for rheumatoid arthritis Efficacy of tocilizumab for systemic juvenile idiopathic arthritis

8 61 Efficacy of tocilizumab for Castleman s disease IL-6 targeting as strategy for various other autoimmune inflammatory diseases

9 62 Table 1 Ongoing clinical trials of tocilizumab for treatment of diseases other than rheumatoid arthritis and juvenile idiopathic arthritis, registered with ClinicalTrials.gov Current clinical trials of tocilizumab are listed. RA: rheumatoid arthritis, KSHV: Kaposi's sarcoma herpes virus, GVHD: graft-versus-host disease, SJIA: systemic juvenile idiopathic arthritis Conclusion and future prospects

10 63 Conflict of interest

11 64

12 65

Role of JAKs in myeloid cells and autoimmune diseases. Satoshi Kubo, Kunihiro Yamaoka and Yoshiya Tanaka

Role of JAKs in myeloid cells and autoimmune diseases. Satoshi Kubo, Kunihiro Yamaoka and Yoshiya Tanaka 131 Mini Review Role of JAKs in myeloid cells and autoimmune diseases Satoshi Kubo, Kunihiro Yamaoka and Yoshiya Tanaka The First Department of Internal Medicine, University of Occupational and Environmental

More information

Although this presentation includes information regarding pharmaceuticals (including products under development), the information is not intended as

Although this presentation includes information regarding pharmaceuticals (including products under development), the information is not intended as Although this presentation includes information regarding pharmaceuticals (including products under development), the information is not intended as any advertisement and/or medical advice. Forward-Looking

More information

The possible mode of action of Tofacitinib, a JAK inhibitor

The possible mode of action of Tofacitinib, a JAK inhibitor 129 Mini Review The possible mode of action of Tofacitinib, a JAK inhibitor Satoshi Kubo 1), Kunihiro Yamaoka 1), Keisuke Maeshima 2) and Yoshiya Tanaka 1, ) 1) The First Department of Internal Medicine,

More information

Up-regulation of hepcidin by interleukin-6 contributes to anemia of inflammation in multicentric Castleman's disease (MCD)

Up-regulation of hepcidin by interleukin-6 contributes to anemia of inflammation in multicentric Castleman's disease (MCD) 99 Mini Review Up-regulation of hepcidin by interleukin-6 contributes to anemia of inflammation in multicentric Castleman's disease (MCD) Nakazawa-Soken J. Song and Kazuyuki Yoshizaki Immuno-Medical Science,

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

IL-6: A New Era for the Treatment of Autoimmune Inflammatory Diseases

IL-6: A New Era for the Treatment of Autoimmune Inflammatory Diseases IL-6: A New Era for the Treatment of Autoimmune Inflammatory Diseases Tadamitsu Kishimoto, Sujin Kang, and Toshio Tanaka Abstract A series of studies have revealed that IL-6 has pleiotropic activity in

More information

Interleukin-6; Back to the Future Prof. Tadamitsu Kishimoto

Interleukin-6; Back to the Future Prof. Tadamitsu Kishimoto Interleukin-6 Back to the Future 1 MD, Ph.D. Graduate School of Frontier Biosciences, Osaka University Humanized anti-il-6r mab therapy for JIA Before treatment HT 17cm, BW 23 kg 18 months after treatment

More information

Post-translational modifications of proteins in gene regulation under hypoxic conditions

Post-translational modifications of proteins in gene regulation under hypoxic conditions 203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and

More information

1. TLR. TLR Toll-like receptors. Toll Toll-like receptor, TLR TLR TLR TLR. type I TLR TLR. Toll

1. TLR. TLR Toll-like receptors. Toll Toll-like receptor, TLR TLR TLR TLR. type I TLR TLR. Toll 54pp.145 152 2004 1. TLR T B TLR Toll-like receptors TLR TLR I IFN TLR T B B T Toll NF- B 1996 565-0871 3-1 TEL 06-6879-8303 FAX 06-6879-8305 E-mail uemattsu@biken.osaka-u.ac.jp Toll Toll-like receptor,

More information

Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,

Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins, Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Regulatory role of mesenchymal stem cells in osteoclast differentiation. , Masahiro Kondo and Yoshiya Tanaka 1, )

Regulatory role of mesenchymal stem cells in osteoclast differentiation. , Masahiro Kondo and Yoshiya Tanaka 1, ) 217 Mini Review Regulatory role of mesenchymal stem cells in osteoclast differentiation Koichi Oshita 1, 2), Kunihiro Yamaoka 1) 1, 2), Masahiro Kondo and Yoshiya Tanaka 1, ) 1) The First Department of

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

More information

IL-17 in health and disease. March 2014 PSO13-C051n

IL-17 in health and disease. March 2014 PSO13-C051n IL-17 in health and disease March 2014 PSO13-C051n Originally Researchers Suggested That IL-12 and IL-4 drove Th Cell Differentiation Naïve CD4 + T cell Question: Which of these cell types is responsible

More information

Intrinsic cellular defenses against virus infection

Intrinsic cellular defenses against virus infection Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses

More information

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

More information

Chapter 13: Cytokines

Chapter 13: Cytokines Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

More information

Signal Transduction Pathway Smorgasbord

Signal Transduction Pathway Smorgasbord Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.

More information

Clinical Policy: Tocilizumab (Actemra) Reference Number: ERX.SPMN.44

Clinical Policy: Tocilizumab (Actemra) Reference Number: ERX.SPMN.44 Clinical Policy: (Actemra) Reference Number: ERX.SPMN.44 Effective Date: 10/16 Last Review Date: 09/16 Coding Implications Revision Log See Important Reminder at the end of this policy for important regulatory

More information

Index. E Ectodysplasin, 104 EPO. See Erythropoietin Erythropoietin (EPO), receptor, 47 48

Index. E Ectodysplasin, 104 EPO. See Erythropoietin Erythropoietin (EPO), receptor, 47 48 A AKT g chain family cytokine signaling, 9 T-cell development role, 279 AMPs. See Antimicrobial peptides Antimicrobial peptides (AMPs), 456 Arid5a, 94 Atopic dermatitis interleukin-17 studies, 130 interleukin-22

More information

Receptors Functions and Signal Transduction- L4- L5

Receptors Functions and Signal Transduction- L4- L5 Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway

More information

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf

More information

T Lymphocyte Activation and Costimulation. FOCiS. Lecture outline

T Lymphocyte Activation and Costimulation. FOCiS. Lecture outline 1 T Lymphocyte Activation and Costimulation Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline T cell activation Costimulation, the B7:CD28 family Inhibitory receptors of T cells Targeting costimulators for

More information

T Cell Activation, Costimulation and Regulation

T Cell Activation, Costimulation and Regulation 1 T Cell Activation, Costimulation and Regulation Abul K. Abbas, MD University of California San Francisco 2 Lecture outline T cell antigen recognition and activation Costimulation, the B7:CD28 family

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

Interleukin-6 (IL-6) is a multifunctional cytokine that

Interleukin-6 (IL-6) is a multifunctional cytokine that S11 Interleukin-6 A Key Mediator of Systemic and Local Symptoms in Rheumatoid Arthritis Bruce N. Cronstein, M.D. Abstract Interleukin-6 (IL-6) is a pleiotropic cytokine, present at elevated levels in patients

More information

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How

More information

DNA vaccine, peripheral T-cell tolerance modulation 185

DNA vaccine, peripheral T-cell tolerance modulation 185 Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory

More information

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive

More information

Tolerance, autoimmunity and the pathogenesis of immunemediated inflammatory diseases. Abul K. Abbas UCSF

Tolerance, autoimmunity and the pathogenesis of immunemediated inflammatory diseases. Abul K. Abbas UCSF Tolerance, autoimmunity and the pathogenesis of immunemediated inflammatory diseases Abul K. Abbas UCSF Balancing lymphocyte activation and control Activation Effector T cells Tolerance Regulatory T cells

More information

Biol220 Cellular Signalling. Non-receptor tyrosine kinases

Biol220 Cellular Signalling. Non-receptor tyrosine kinases Biol220 Cellular Signalling Non-receptor tyrosine kinases The 7TM receptors initiate signal transducton pathways through changes in tertiary structure that are induced by ligand binding. A fundamentally

More information

Novel mechanism of hepatocyte growth factor against prevention of inflammation and oxidative

Novel mechanism of hepatocyte growth factor against prevention of inflammation and oxidative 136 Mini Review Novel mechanism of hepatocyte growth factor against prevention of inflammation and oxidative stress Kazutaka Shimizu 1), Yoshiaki Taniyama 1, 2, ), Fumihiro Sanada 1), Masaaki Iwabayashi

More information

Newly Recognized Components of the Innate Immune System

Newly Recognized Components of the Innate Immune System Newly Recognized Components of the Innate Immune System NOD Proteins: Intracellular Peptidoglycan Sensors NOD-1 NOD-2 Nod Protein LRR; Ligand Recognition CARD RICK I-κB p50 p65 NF-κB Polymorphisms in Nod-2

More information

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation

REACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802

More information

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

More information

JAK-STAT Pathway - Role in Immunology. JAK-STAT pathway activation P JAK JAK P P JAK JAK P JAK

JAK-STAT Pathway - Role in Immunology. JAK-STAT pathway activation P JAK JAK P P JAK JAK P JAK Immunology Newsletter May 2018 Volume 2, Issue 1 SMARTImmunology The Immunology Newsletter from SMARTANALYST JAK-STAT athway - Role in Immunology The Janus kinase (JAK) signal transducer and activator

More information

Mechanisms of Autontibodies

Mechanisms of Autontibodies Mechanisms of Autontibodies Production in Rheumatic Diseases Eisa Salehi PhD Tehran University of Medical Sciences Immunology Department Introduction Rheumatic diseases: Cause inflammation, swelling, and

More information

Environmental Exposures and Immune Function

Environmental Exposures and Immune Function Environmental Exposures and Immune Function Presented by Dr. B Paige Lawrence Professor of Environmental Medicine and of Microbiology & Immunology University of Rochester School of Medicine and Dentistry

More information

Antiviral Chemotherapy

Antiviral Chemotherapy Viruses are intimate intracellular parasites and their destruction may cause destruction of infected cells. Many virus infections were considered to be self-limited. Most of the damage to cells in virus

More information

NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc.

NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. NTD Vaccine Design Toolkit and Training Workshop Providence, RI January 05, 2011 Cytokines Leslie P. Cousens, PhD EpiVax, Inc. Cytokines Properties of Cytokines Cytokines are proteins with specific roles

More information

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. Mechanisms of Immune Tolerance ACTIVATION (immunity) SUPPRESSION (tolerance)

More information

Mechanisms of Immune Tolerance

Mechanisms of Immune Tolerance Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. ACTIVATION (immunity) SUPPRESSION (tolerance) Autoimmunity Immunodeficiency

More information

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors

Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma

More information

Immune Regulation and Tolerance

Immune Regulation and Tolerance Immune Regulation and Tolerance Immunoregulation: A balance between activation and suppression of effector cells to achieve an efficient immune response without damaging the host. Activation (immunity)

More information

Mini Review Periodontal regeneration and FGF-2

Mini Review Periodontal regeneration and FGF-2 72 Mini Review Periodontal regeneration and FGF-2 Yuko Kojima, Manabu Yanagita, Satoru Yamada, Masahiro Kitamura and Shinya Murakami Department of Periodontology, Graduate School of Dentistry, Osaka University,

More information

Toll-like Receptor Signaling

Toll-like Receptor Signaling Toll-like Receptor Signaling 1 Professor of Medicine University of Massachusetts Medical School, Worcester, MA, USA Why do we need innate immunity? Pathogens multiply very fast We literally swim in viruses

More information

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:

More information

silent epidemic,. (WHO),

silent epidemic,. (WHO), Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining

More information

NFκB What is it and What s the deal with radicals?

NFκB What is it and What s the deal with radicals? The Virtual Free Radical School NFκB What is it and What s the deal with radicals? Emily Ho, Ph.D Linus Pauling Institute Scientist Department of Nutrition and Food Management Oregon State University 117

More information

EBV infection B cells and lymphomagenesis. Sridhar Chaganti

EBV infection B cells and lymphomagenesis. Sridhar Chaganti EBV infection B cells and lymphomagenesis Sridhar Chaganti How EBV infects B-cells How viral genes influence the infected B cell Differences and similarities between in vitro and in vivo infection How

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology

Attribution: University of Michigan Medical School, Department of Microbiology and Immunology Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

ACTEMRA (tocilizumab)

ACTEMRA (tocilizumab) RATIONALE FOR INCLUSION IN PA PROGRAM Background Actemra is an agent in the class of drugs known as biologic disease modifiers. It is used to treat adult onset rheumatoid (RA) arthritis, polyarticular

More information

March 19 th Batool Aqel

March 19 th Batool Aqel March 19 th - 2013 6 Batool Aqel Hormones That Bind to Nuclear Receptor Proteins Hormones bind to their receptors.whether the receptor is found in the nucleus or the cytoplasm, at the end they are translocated

More information

The Gateway Theory: How Regional Neural Activation Creates a Gateway for Immune Cells via an Inflammation Amplifier

The Gateway Theory: How Regional Neural Activation Creates a Gateway for Immune Cells via an Inflammation Amplifier Review Article 269 The Gateway Theory: How Regional Neural Activation Creates a Gateway for Immune Cells via an Inflammation Amplifier Hideki Ogura, Yasunobu Arima, Daisuke Kamimura, Masaaki Murakami The

More information

VIRUSES AND CANCER Michael Lea

VIRUSES AND CANCER Michael Lea VIRUSES AND CANCER 2010 Michael Lea VIRAL ONCOLOGY - LECTURE OUTLINE 1. Historical Review 2. Viruses Associated with Cancer 3. RNA Tumor Viruses 4. DNA Tumor Viruses HISTORICAL REVIEW Historical Review

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Structure and Function of Antigen Recognition Molecules

Structure and Function of Antigen Recognition Molecules MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

More information

Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells

Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells ICI Basic Immunology course Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells Abul K. Abbas, MD UCSF Stages in the development of T cell responses: induction

More information

Supplementary Material Correlation matrices on FP and FN profiles

Supplementary Material Correlation matrices on FP and FN profiles Supplementary Material Correlation matrices on FP and FN profiles The following two tables give the correlation coefficients for the FP profiles and the FN profiles of a single tagging solutions against

More information

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly

More information

CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.

CELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM. !! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)

More information

Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation

Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation Introduction Feng-Yen Lin, Ph.D. 1, and Shing-Jong Lin, M.D., PhD. 2, 1 Department

More information

Potential Role of Sphingosine 1-Phosphate in the. Pathogenesis of Rheumatoid Arthritis

Potential Role of Sphingosine 1-Phosphate in the. Pathogenesis of Rheumatoid Arthritis Potential Role of Sphingosine 1-Phosphate in the Pathogenesis of Rheumatoid Arthritis COMMENTARY for Zhao, C., Fernandes, M.J., Turgeon, M., Tancrede, S., Di Battista, J., Poubelle, P.E. and Bourgoin,

More information

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis. Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)

More information

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade

Signal-Transduction Cascades - 2. The Phosphoinositide Cascade Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan

Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan 96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

MicroRNAs: novel regulators in skin research

MicroRNAs: novel regulators in skin research MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,

More information

Immunology for the Rheumatologist

Immunology for the Rheumatologist Immunology for the Rheumatologist Rheumatologists frequently deal with the immune system gone awry, rarely studying normal immunology. This program is an overview and discussion of the function of the

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

Signaling Through Immune System Receptors (Ch. 7)

Signaling Through Immune System Receptors (Ch. 7) Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling

More information

Innate Immunity & Inflammation

Innate Immunity & Inflammation Innate Immunity & Inflammation The innate immune system is an evolutionally conserved mechanism that provides an early and effective response against invading microbial pathogens. It relies on a limited

More information

Alcoholic hepatitis is a drug-induced disorder

Alcoholic hepatitis is a drug-induced disorder Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute

More information

Immunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells

Immunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There

More information

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by

More information

Effects of Second Messengers

Effects of Second Messengers Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many

More information

Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco

Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco Determinants of Immunogenicity and Tolerance Abul K. Abbas, MD Department of Pathology University of California San Francisco EIP Symposium Feb 2016 Why do some people respond to therapeutic proteins?

More information

T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009

T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009 T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells

More information

HIV AND INFLAMMATION: A NEW THREAT

HIV AND INFLAMMATION: A NEW THREAT HIV AND INFLAMMATION: A NEW THREAT KAP ANNUAL SCIENTIFIC CONFERENC MAY 2013 DR JOSEPH ALUOCH FRCP,EBS Basic Components of the Immune System Immunology: cells and tissues involved in recognizing and attacking

More information

CYTOKINES. Marion C. Cohen, Ph.D. MSB C

CYTOKINES. Marion C. Cohen, Ph.D. MSB C CYTOKINES Marion C. Cohen, Ph.D. MSB C538 973-972-5995 cohenma@umdnj.edu Last week s EMT group was at full strength, although they were now tossing around phrases like cytokines and pyruvic acid. A Few

More information

CHAPTER 18: Immune System

CHAPTER 18: Immune System CHAPTER 18: Immune System 1. What are four characteristics of the specific immune system? a. b. c. d. 2. List the two main types of defense mechanisms and briefly describe features of each. 3. Give examples

More information

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company. 12 Signal Transduction 2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

More information

Tolerance 2. Regulatory T cells; why tolerance fails. FOCiS. Lecture outline. Regulatory T cells. Regulatory T cells: functions and clinical relevance

Tolerance 2. Regulatory T cells; why tolerance fails. FOCiS. Lecture outline. Regulatory T cells. Regulatory T cells: functions and clinical relevance 1 Tolerance 2. Regulatory T cells; why tolerance fails Abul K. Abbas UCSF FOCiS 2 Lecture outline Regulatory T cells: functions and clinical relevance Pathogenesis of autoimmunity: why selftolerance fails

More information

The T cell receptor for MHC-associated peptide antigens

The T cell receptor for MHC-associated peptide antigens 1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system

Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds

More information

Modulation of the IL-6 System and STAT-3 Activation in Lymphocytes of Lean and Obese Women

Modulation of the IL-6 System and STAT-3 Activation in Lymphocytes of Lean and Obese Women Modulation of the IL-6 System and STAT-3 Activation in Lymphocytes of Lean and Obese Women BY MARGARET M. SULLIVAN B.A., St. Mary s College, 1992 B.S., University of Illinois, Chicago, 1995 THESIS Submitted

More information

Under the Radar Screen: How Bugs Trick Our Immune Defenses

Under the Radar Screen: How Bugs Trick Our Immune Defenses Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 7: Cytokines Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research HHV-8 Discovered in the 1980 s at the

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

Antigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS

Antigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS 1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family

More information