中国科技论文在线. * CFTR cl - [5]
|
|
- Gloria Wilcox
- 5 years ago
- Views:
Transcription
1 CFTR 1 * * xiaoqun1988@xysm.net CFTR PCR western blot CFTR CFTR cl - CFTR Real-time PCR 4h CFTR mrna CFTR Western blot 4h CFTR CFTR cl - 5 µm forskolin CFTR cl - forskolin 4h BECs CFTR cl - cl - CFTR cl - glibenclamide CFTR cl - DIDS cl - CFTR cl - CFTR CF (Cystic fibrosis transmembrane conductance regulator, CFTR)Cl- Cl - [1-2] Cystic fibrosis, CFCFTR Cl - [3-4] CFTR [5] CFTR 1 No:
2 CFTR 10 Wistar n540cm30cm 25cm 1.5ppm 3 1 (bronchial epithelial cells, BECs ) Gruenent DMEM/F12 10% 100Uml50ml % 4% 30min BECs 80%6h 1ml 4% 30min4PBS 3min0.5% Triton X-100 PBS 1ml 10min2% BSA PBS 1ml 60min 2% BSA PBS Ìl 372h 4PBS 5min Ìl2hPBS 5min 400PBS PCR TrizolBECsRNAAMV 2
3 TaqmanReal time PCRTaqman5 ä FAM3 ätamragapdh CFTR forward 5 - TTAAAGCTGTCAAGCCGTGTTC-3 CFTR reverse 5 -GCCAATGCAAGTCCTTCATCA -3 CFTR probe FAM+ TGGACAACTTGTTAGTCTCCTTTCC +TAMRA GAPDH forward GAPDH reverse CCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCA GAPDH probe FAM-TTGCCCTCAACGACCACTTTGTC-TAMRA 2 Ìl 50 ÌlPCR509410S 5330S7240SRNA CFTRmRNAGAPDH mrnamrna RNARNA Western blot RIPA BSA 30 Ìg SDS - PAGE (4%6%)PVDF 4 CFTR ( ) 4 HRP ( 14000) 2 h ECL X (mmol/l)145 mm NaCl4 mm CsCl1 mm CaCl 2 5 mm glucose10 mm TESPH mOsm(mmol/L)113 mm L-aspartic acid113 mm CsOH 27 mm CsCl1 mm NaCl1 mm MgCl 2 1 mm EGTA10 mm TES PH mOsm5µmol/L forskolin CFTR cl - -40mV-100mV 100mV200mS20mV2S -40mV I-V S SPSS 3
4 t P CFTR CFTR1ACFTR 1C1B A B C control negative control ozone 20 Ìm Figure 1: Immunofluorescence of CFTR in respiratory epithelium from rat trachea mucosa. Normal (A), negative control (B) and ozone stress rat (C). Bars, 20 µm. BECs CFTR Real-time PCR BECs 30min CFTR mrna (CFTR/GAPDH: control group was 1.35 ± 0.3, ozone group was 0.46 ± 0.07, P < 0.01, n=4) (2)western blot BECs CFTR CFTR Hoechest CFTR (3)Western blot 4 CFTR (CFTR/actin protein density: control group was 0.81 ± 0.02, ozone group was 0.33 ± 0.02, P < 0.01, n=5) (4) 4
5 CFTR/GAPDH control ozone RT-PCRCFTR mrna Figure 2: Real time RT-PCR analysis of mrna expression of CFTR in HBEC control ozone 10 Ìm Figure 3: Immunofluorescence of CFTR in HBEC. Bars, 10 µm control ozone CFTR actin 5
6 relative intensity 2 CFTR control ozone 4 western blot CFTR Figure 4: Expression CFTR protein in HBEC CFTR CFTR cl - 5 µm forskolincftr cl - forskolin BECs CFTR cl - (5A, B)cl - CFTR cl - glibenclamide CFTR cl - DIDS cl - CFTR cl - (5 A, C) A basal forskolin forskolin+ozone forskolin+glibenclamide forskolin+didsäúèýîþ Ä 6
7 B basal forskolin forskolin+ozone I(PA/PF) C forskolin forskolin+glibencla mide forskolin+dids I(PA/PF) 5 CFTR cl - Figure 5: CFTR current in HBEC were recorded were whole-cell patch clamp. A: Typical whole-cell currents recorded from HBEC in basal condition, in presence of 5 µm forskolin, forskolin+ozone, forskolin+glibenclamide or forskolin+dids. Step protocol consisted of 400ms voltage steps from -100 to +100 mv from a holding potential of -40 mv. B: current-voltage (I-V) curves (means ± SE) for CFTR current before, after application of forskolin and after forskolin+ozone treatment (n = 7, respectively). C: current-voltage (I-V) curves (means ± SE) for CFTR current after application of forskolin and after forskolin+glibenclamide or forskolin+dids treatment (n = 7, respectively). CF CFTR [6] CFTR Cl - CFTR camp Cl - Cl - Na + ATP CFTR CFTR airway surface liquid, ASL CFTR 7
8 CF AHR CFTR BECs Cl - CFTR [7-8] CFTR mrna CFTR mrna TNF- Á Ã- CFTR mrna CFTR mrna [9-10] mrna CFTR CFTR mrna CFTR CFTR CFTR Cl - CFTR CFTR CF CF CFTR [1] Mall M, Bleich M, Schurlein M, et al. Cholinergic ion secretion in human colon requires coactivation by camp[j]. Am J Physiol Gastrointestinal Liver Physiology, 38, G1274-G [2] Ballard S, Trout L, Bebok Z, et al. CFTR involvement in chloride, bicarbonate, and liquid secretion by airway submucosal glands[j]. Am J Physiol Lung Cell Mol Physiol, 277, L694-L [3] Dahl M, Tybjaerg-Hansen A, Lange P, et al. F508 heterozygosity in cystic fibrosis and susceptibility to asthma[j]. Lancet, 351, [4] Tzetis M, Efthymiadou A, Strofalis S, et al. CFTR gene mutations including three novel nucleotide substitutions and haplotype background in patients with asthma, disseminated brochiectasis and chronic obstructive pulmonary disease[j]. Hum Genet, 108, [5] Taouil K, Hinnrasky J, Hologne C, et al. Stimulation of beta 2-Adrenergic Receptor Increases Cystic Fibrosis Transmembrane Conductance Regulator Expression in Human Airway Epithelial Cells through a camp/protein Kinase A-independent Pathway[J]. J Biol Chem, 278, [6] Widdicombe J. Regulation of the depth and composition of airway surface liquid[j]. J Anat, 201, [7] Cowley E & Linsdell P. Oxidant stress stimulates anion secretion from the human airway epithelial cell line Calu-3: implications for cystic fibrosis lung disease[j]. J Physiol, 543, [8] Jung J, Lee JY, Oh SO, et al. Effect of t-butylhydroperoxide on chloride secretion in rat tracheal epithelia[j]. Pharmacol Toxicol, 82, [9] Besancon F, Przewlocki G, Baro I, Hongre AS, Escande D, Edelman A. Interferon- Ã 8
9 downregulates CFTR gene expression in epithelial cells[j]. Am J Physiol Cell Physiol, 267, C1398-C [10] Nakamura H, Yoshimura K, Bajocchi G, et al. Tumor necrosis factor modulation of expression of the cystic fibrosis transmembrane conductance regulator gene[j]. FEBS Lett, 314, Ozone Stress Down-regulates the Gating Function of Cystic Fibrosis Transmembrane Conductance Regulator in Human Bronchial Epithelial Cells QU Fei, QIN Xiaoqun *, XIANG Yang, TAN Yurong, LIU Huijun Department of Physiology, Central South University Xiangya Medical School, Changsha, Abstract To investigate abnormalities of cystic fibrosis transmembrane conductance regulator (CFTR) expression in chronic inflammatory airway diseases, the present study was designed to observe the expression of CFTR, CFTR chloride current in in vitro and in vivo bronchial epithelium by using real-time PCR, immunofluorescence, western blot and whole cell patch-clamp. The results demonstrated that CFTR staining was decreased in rat airway epithelium under ozone stress. Ozone stress also down-regulated CFTR protein and mrna expression and CFTR chloride current in cultured human bronchial epithelial cells (HBEC). These negative effects on CFTR function could potentially contribute to CF-like symptoms in a variety of inflammatory airway diseases. Our results provide support for studies investigating CFTR function in inflammatory lung diseases other than cystic fibrosis. Key words: cystic fibrosis transmembrane conductance regulator; human bronchial epithelial cells; ozone stress; airway hyperresponsiveness 9
ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium
ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium Martin C, Coolen N, Wu YZ, Thévenot G, Touqui L, PrulièreEscabasse V, Papon JF, Coste
More informationSelective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl - and HCO 3 - Conductances
JOP. J. Pancreas (Online) 2001; 2(4 Suppl):212218. Selective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl and HCO 3 Conductances MallaReddy M Reddy 1, Paul M Quinton 1,2 1 Department
More informationRespiratory Pharmacology: Treatment of Cystic Fibrosis
Respiratory Pharmacology: Treatment of Cystic Fibrosis Dr. Tillie-Louise Hackett Department of Anesthesiology, Pharmacology and Therapeutics University of British Columbia Associate Head, Centre of Heart
More informationCl - CFTR Cl - 3. (DPC) 52nitro222(32phenylpropylamino)2benzoate (NPPB) [3 ],, , Na + Ca 2 + [2
, 1999 6, 51 (3), 297 302 297 Acta Physiologica Sinica Cl - CFTR Cl - 3 (, 710032), Cl - (CFTR) Cl -, 92AC ( ISO) CFTR Cl -, 52nitro222( 32phenylpropylamino) 2benzoate (NPPB) (DPC) ISO CFTR Cl - NPPB ISO,
More informationThe Amiloride-inhibitable Na
The Amiloride-inhibitable Na Conductance Is Reduced by the Cystic Fibrosis Transmembrane Conductance Regulator in Normal But Not in Cystic Fibrosis Airways M. Mall, M. Bleich, R. Greger, R. Schreiber,
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationSLC26A9 is a constitutively active, CFTR-regulated anion conductance in human bronchial epithelia
Published Online: 16 March, 2009 Supp Info: http://doi.org/10.1085/jgp.200810097 Downloaded from jgp.rupress.org on August 18, 2018 ARTICLE SLC26A9 is a constitutively active, CFTR-regulated anion conductance
More informationAn excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
More informationTHE ROLE OF CFTR MUTATIONS IN CAUSING CYSTIC FIBROSIS (CF)
THE ROLE OF CFTR MUTATIONS IN CAUSING CYSTIC FIBROSIS (CF) Vertex Pharmaceuticals Incorporated, 50 Northern Avenue, Boston, MA 02210. Vertex and the Vertex triangle logo are registered trademarks for Vertex
More information150 mm HCO How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell
JOP. J. Pancreas (Online) 2001; 2(4 Suppl):198202. 150 mm How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell Yoshiro Sohma 1, Michael A Gray 2, Yusuke Imai 1, Barry E Argent 2
More informationPseudohalide anions reveal a novel extracellular site for potentiators to increase CFTR function
1062..1075 British Journal of Pharmacology DOI:10.1111/j.1476-5381.2012.02041.x www.brjpharmacol.org RESEARCH PAPERbph_2041 Pseudohalide anions reveal a novel extracellular site for potentiators to increase
More informationThe cystic fibrosis transmembrane conductance regulator
CFTR and Bicarbonate Secretion to Epithelial Cells Martin J Hug, 1 Tsutomu Tamada, 2 and Robert J Bridges 2 1 Institute of Physiology, University of Münster, D-48149 Münster, Germany; and 2 Department
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationCystic Fibrosis. Na+ 2Cl - K+ Na+ Na+
1 Cystic Fibrosis I. Overview of cystic fibrosis Among Caucasians, about one out of twenty people carry the gene for cystic fibrosis (CF), and one of 2,000 to 4,000 people is afflicted with the recessive
More informationTHE ROLE OF CFTR MUTATIONS IN CAUSING CYSTIC FIBROSIS (CF)
THE ROLE OF CFTR MUTATIONS IN CAUSING CYSTIC FIBROSIS (CF) Vertex Pharmaceuticals Incorporated, 50 Northern Avenue, Boston, MA 02210. Vertex and the Vertex triangle logo are registered trademarks of Vertex
More informationCystic Fibrosis the future
Cystic Fibrosis the future Pathophysiologic cascade Abnormal Gene Abnormal CFTR Therapy Gene replacement Protein replacement Gene read through therapy Abnormal sodium chloride & water movement through
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationRole of anion exchangers in Cl and HCO 3 secretion by the human airway epithelial cell line Calu-3
Am J Physiol Cell Physiol 307: C208 C219, 2014. First published June 4, 2014; doi:10.1152/ajpcell.00083.2014. Role of anion exchangers in Cl and secretion by the human airway epithelial cell line Calu-3
More informationWe describe a novel student course in membrane physiology in which
MEASUREMENT OF HUMAN NASAL POTENTIAL DIFFERENCE TO TEACH THE THEORY OF TRANSEPITHELIAL FLUID TRANSPORT Ulrich Kersting, 1 Albrecht Schwab, 2 and Alexandra Hebestreit 3 1 Institute of Clinical Biochemistry
More informationDiseases of the gastrointestinal system. H Awad Lecture 2: small intestine/ part 2 and appendix
Diseases of the gastrointestinal system H Awad Lecture 2: small intestine/ part 2 and appendix Malabsorption most important causes of malabsorption: Celiac disease tropical sprue Lactase deficiency Whipple
More informationAssessment of CFTR chloride channel openers in intact normal and cystic brosis murine epithelia
British Journal of Pharmacology (2001) 132, 659 ± 668 ã 2001 Nature Publishing Group All rights reserved 0007 ± 1188/01 $15.00 Assessment of CFTR chloride channel openers in intact normal and cystic brosis
More informationIndex. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Donaldson SH, Bennett WD, Zeman KL, et al. Mucus clearance
More informationBIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
More informationEvaluation of Patients with Diffuse Bronchiectasis
Evaluation of Patients with Diffuse Bronchiectasis Dr. Patricia Eshaghian, MD Assistant Clinical Professor of Medicine Director, UCLA Adult Cystic Fibrosis Affiliate Program UCLA Division of Pulmonary
More informationEffects of different dust particles on calcium current in the neurons of dorsal root ganglia of rats
Effects of different dust particles on calcium current in the neurons of dorsal root ganglia of rats Yong Mei, Haibing Yang, Jingzhi Sun, Xiao Yin, Xiang Guo, Zhenglun Wang, Lei Yang * Department of Occupational
More informationCystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Asians with chronic pulmonary disease: A pilot study B
Journal of Cystic Fibrosis 5 (2006) 159 164 www.elsevier.com/locate/jcf Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Asians with chronic pulmonary disease: A pilot study
More informationLumen. -60 mv, ph 7.3 Cl - (E Cl CFTR HCO mv, ph 7.3 HCO HCO. Channel or Other electrogenic HCO 3- up to a 80-mM concentration when [Cl - ] i
. Proximal Duct 1 Cl HCO 8 Cl 8 HCO Lumen CFTR AE 6 mv, ph 7. Cl (E Cl = 712 ) Cl 2 HCO 2 lood ph HCO. Distal Duct 2 Cl 128 HCO >14 HCO? 6 mv, ph 7. Cl (E Cl = 47 ) Cl HCO HCO 5 2 HCO HCO Channel or Other
More informationBicarbonate Secretion in the Murine Gallbladder - Lessons for the Treatment of Cystic Fibrosis
Bicarbonate Secretion in the Murine Gallbladder Lessons for the Treatment of Cystic Fibrosis Alan W Cuthbert Department of Medicine, University of Cambridge, Addenbrooke's Hospital, Hill's Road. Cambridge,
More informationIN SCHOOL ARTICLE Vitamin D3 Blocks NFkB Activation in an In Vitro Model of Cystic Fibrosis
IN SCHOOL ARTICLE Vitamin D3 Blocks NFkB Activation in an In Vitro Model of Cystic Fibrosis Andrea Maria Vargas Guerra 1 * and Christine Marshall-Walker 2 Student 1, Teacher 2 : Phillips Academy, 180 Main
More informationCystic Fibrosis Transmembrane Conductance Regulator Currents in Guinea Pig Pancreatic Duct Cells: Inhibition by Bicarbonate Ions
GASTROENTEROLOGY 2000;118:1187 1196 Cystic Fibrosis Transmembrane Conductance Regulator Currents in Guinea Pig Pancreatic Duct Cells: Inhibition by Bicarbonate Ions CATHERINE M. O REILLY, JOHN P. WINPENNY,
More informationPULMONARY SURFACTANT, ALPHA 1 ANTITRYPSIN INHIBITOR DEFICIENCY, AND CYSTIC FIBROSIS DR. NABIL BASHIR BIOCHEMISTRY/RESPIRATORY SYSTEM
PULMONARY SURFACTANT, ALPHA 1 ANTITRYPSIN INHIBITOR DEFICIENCY, AND CYSTIC FIBROSIS DR. NABIL BASHIR BIOCHEMISTRY/RESPIRATORY SYSTEM Pulmonary surfactant Pulmonary surfactant is (phospholipoprotein) complex
More informationThe role of Lipoxin A4 in Cystic Fibrosis Lung Disease
Volume No: 6, Issue: 7, March 2013, e201303018, http://dx.doi.org/10.5936/csbj.201303018 CSBJ The role of Lipoxin A4 in Cystic Fibrosis Lung Disease Valérie Urbach a,b,*, Gerard Higgins a, Paul Buchanan
More informationInflammation-Induced Airway Hypersensitivity: From Ion Channels to Patients
Inflammation-Induced Airway Hypersensitivity: From Ion Channels to Patients Lu-Yuan Lee, Ph.D. Airway Sensory Neurobiology Laboratory Department of Physiology University of Kentucky Medical Center BACKGROUND
More informationSupplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
More information3 The abbreviations used are: CF, cystic fibrosis; AE, anion exchange; CFTR,
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 47, pp. 41069 41082, November 25, 2011 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Novel Role for Pendrin
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationMucilAir: a Novel Human 3D Airway Epithelium Model for Long Term Toxicity Testing
MucilAir: a Novel Human 3D Airway Epithelium Model for Long Term Toxicity Testing Samuel Constant, Ph.D., COO samuel.constant@epithelix.com Sàrl 14, Chemin des Aulx CH-1228 Plan les Ouates Genève - Switzerland
More informationHuman TRPC6 Ion Channel Cell Line
TECHNICAL DATA SHEET ValiScreen Ion Channel Cell Line Caution: For Laboratory Use. A research product for research purposes only Human TRPC6 Ion Channel Cell Line Product No.: AX-012-C Lot No.: 512-548-A
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationcamp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways
Related Commentary, page 3093 Research article camp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways Robert J. Lee 1 and J. Kevin Foskett
More informationCystic Fibrosis. Jennifer McDaniel, BS, RRT-NPS
Cystic Fibrosis Jennifer McDaniel, BS, RRT-NPS Overview Cystic fibrosis is the most common fatal, inherited disease in the U. S. CF results from a defective autosomal recessive gene One copy of gene =
More informationSTEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationOxidant stress suppresses CFTR expression
Am J Physiol Cell Physiol 290: C262 C270, 2006. First published September 14, 2005; doi:10.1152/ajpcell.00070.2005. Oxidant stress suppresses CFTR expression André M. Cantin, 1 Ginette Bilodeau, 1 Cristine
More informationWhat is the inheritance pattern (e.g., autosomal, sex-linked, dominant, recessive, etc.)?
Module I: Introduction to the disease Give a brief introduction to the disease, considering the following: the symptoms that define the syndrome, the range of phenotypes exhibited by individuals with the
More informationA Quick Guide to the. I507del. Mutation CFTR SCIENCE
A Quick Guide to the I507del Mutation CFTR SCIENCE 2016 Vertex Pharmaceuticals Incorporated VXR-HQ-02-00045a(1) 03/2016 Loss of CFTR activity is the underlying cause of cystic fibrosis (CF) 1 Spectrum
More informationCharacterization of Ion and Fluid Transport in Human Bronchioles
Characterization of Ion and Fluid Transport in Human Bronchioles Sabine Blouquit, Hugues Morel, Jocelyne Hinnrasky, Emmanuel Naline, Edith Puchelle, and Thierry Chinet Laboratoire de Biologie et Pharmacologie
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Membrane transport. Time Allowed: 2 hours
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Membrane transport Time Allowed: 2 hours Marking Scheme: Total
More informationnachr α 4 β 2 CHO Cell Line
B SYS GmbH nachr α 4 β 2 CHO Cell Line Cell Culture Conditions B SYS GmbH B SYS GmbH nachr α 4 β 2 CHO Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Human Nicotinic Acetylcholine Receptors...3 1.2 B SYS
More informationRelative Ion Permeability of Normal and Cystic Fibrosis Nasal Epithelium
Relative Ion Permeability of Normal and Cystic Fibrosis Nasal Epithelium MICHAEL KNOWLES, JOHN GATZY, and RICHARD BOUCHER, Departments of Medicine and Pharmacology, School of Medicine, University of North
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
Cystic Fibrosis Transmembrane Page 1 of 11 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Prime Therapeutics
More information1. Introduction. Obstructive lung disease remains the leading cause of morbidity and mortality in cystic fibrosis
1. Introduction Obstructive lung disease remains the leading cause of morbidity and mortality in cystic fibrosis (CF) [1]. With time it has become increasingly clear that CF lung disease is present very
More informationGenotype analysis by Southern blots of nine independent recombinated ES cell clones by
Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with
More informationCYSTIC FIBROSIS Risk Factors Epidemiology Pathogenesis Defective protein synthesis (10%) Abnormal protein folding, processing & trafficking
CYSTIC FIBROSIS Risk Factors Caucasian Family history of CF Infection Exposure to allergens and tobacco Epidemiology Carrier frequency of 1 in 25 for Caucasians The most common lethal genetic disease affecting
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationCystic fibrosis: hitting the target
Cystic fibrosis: hitting the target Heartland Collaborative Annual Meeting Friday, October 5, 2012 Thomas Ferkol MD 1938 1953 Cystic fibrosis: a historical timeline Cystic fibrosis (CF) of the pancreas
More informationNew Models of the Tracheal Airway Define the Glandular Contribution to Airway Surface Fluid and Electrolyte Composition
New Models of the Tracheal Airway Define the Glandular Contribution to Airway Surface Fluid and Electrolyte Composition Xiaorong Wang, Yulong Zhang, Anson Amberson, and John F. Engelhardt Departments of
More informationCystic Fibrosis Foundation Patient Registry 2013
5/9/2015 Targeting CFTR to Treat Cystic Fibrosis: Small Molecule Therapy Mary Ellen Kleinhenz, MD Director, UCSF Adult Cystic Fibrosis Program Professor of Medicine UCSF Division of Pulmonary, Critical
More informationOptical method for quantifying rates of mucus secretion from single submucosal glands
Am J Physiol Lung Cell Mol Physiol 281: L458 L468, 2001. Optical method for quantifying rates of mucus secretion from single submucosal glands NAM SOO JOO, 1 JIN V. WU, 1 MAURI E. KROUSE, 1 YAMIL SAENZ,
More informationAstragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationTransformational Treatments. PRESTON W. CAMPBELL, III, M.D. Executive Vice President for Medical Affairs
Transformational Treatments PRESTON W. CAMPBELL, III, M.D. Executive Vice President for Medical Affairs Symptom-based CF Therapies 45 Median Predicted Survival Age of US Patients with Cystic Fibrosis 41
More informationAll biological membranes are bilayers of phospholipid. The proteins in each type of membrane give it its unique properties.
Many important drugs affect cell surface transport proteins DRUG TARGET PROTEIN DISEASE Omeprazole (Losec) gastric H + /K + ATPase ulcers, gastric reflex oral rehydration therapy intestinal Na + glucose
More informationInfection with respiratory syncytial virus alters peptidergic innervation in the lower airways of guinea-pigs
1284 Exp Physiol 93.12 pp 1284 1291 Experimental Physiology Research Paper Infection with respiratory syncytial virus alters peptidergic innervation in the lower airways of guinea-pigs Yurong Tan, Tao
More informationCost-effectiveness of Ivacaftor (Kalydeco ) for the treatment of cystic fibrosis in patients age 6 years and older who have the G551D mutation
Cost-effectiveness of Ivacaftor (Kalydeco ) for the treatment of cystic fibrosis in patients age 6 years and older who have the G551D mutation January 2013 1. A rapid review submission on the drug ivacaftor
More informationExperience in Southeast Asia with cases of secretory
GASTROENTEROLOGY 1999;116:1342 1347 Characterization of the Inhibitory Effect of Boiled Rice on Intestinal Chloride Secretion in Guinea Pig Crypt Cells CERI J. MATHEWS,* R. JOHN MACLEOD,, SHU XIAN ZHENG,*
More informationPolarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia
Polarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia Anthony M. Paradiso, Carla M.P. Ribeiro, and Richard C. Boucher From the Cystic Fibrosis/Pulmonary Research and Treatment
More informationIL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells
IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells Jennifer A. Mitchel, Silvio Antoniak, Joo-Hyeon Lee, Sae-Hoon Kim, Maureen McGill, David I. Kasahara,
More informationEFFECTS OF AMILORIDE AND BUMETANIDE ON ION TRANSPORT IN THE CAECUM OF RABBIT
Copyright 2003 by Institute of Pharmacology Polish Academy of Sciences Polish Journal of Pharmacology Pol. J. Pharmacol., 2003, 55, 213 219 ISSN 1230-6002 EFFECTS OF AMILORIDE AND BUMETANIDE ON ION TRANSPORT
More informationCompound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13
Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com 1 Outline Recessive model Examples of Compound Heterozygosity Compound Double Heterozygosity (CDH) test 2 Recessive
More informationPediatrics Grand Rounds 18 Sept University of Texas Health Science Center. + Disclosure. + Learning Objectives.
Disclosure Dr Donna Willey Courand receives research support from Cystic Fibrosis Therapeutics The Cystic Fibrosis Foundation Children with Special Health Care Needs Cystic Fibrosis 05: Improving Survival
More informationEFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS
EFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS BHATT, PRIYANKA; BAILEY, VIOLAINE; DASGUPTA, AFIA; CHIN, JUSTIN; AN, WEILING; BRESILLA, CASTERA; KWOK, IRIS;
More informationCellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
More informationSunitinib, an orally available receptor tyrosine kinase inhibitor, induces monocytic
Sunitinib, an orally available receptor tyrosine kinase inhibitor, induces monocytic differentiation of acute myeogenouse leukemia cells that is enhanced by 1,25-dihydroxyviatmin D 3. To the Editor: Sunitinib,
More informationSUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons
SUPPLEMENTARY INFORMATION The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat Sensor in Nociceptive Neurons Hawon Cho, Young Duk Yang, Jesun Lee, Byeongjoon Lee, Tahnbee Kim Yongwoo Jang,
More informationhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
More informationChloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia
Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia MATTHEW P. ANDERSON, DAVID N. SHEPPARD, HERBERT A. BERGER, AND MICHAEL J. WELSH Howard Hughes Medical
More informationBreathtaking science. Developing respiratory drugs to improve health and quality of life
Breathtaking science Developing respiratory drugs to improve health and quality of life June 2017 Forward-Looking Statements This presentation contains forward looking statements that are based on the
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationWhat is Cystic Fibrosis? CYSTIC FIBROSIS. Genetics of CF
What is Cystic Fibrosis? CYSTIC FIBROSIS Lynne M. Quittell, M.D. Director, CF Center Columbia University Chronic, progressive and life limiting autosomal recessive genetic disease characterized by chronic
More informationCharacteristics of Cl uptake in rat alveolar type I cells
Am J Physiol Lung Cell Mol Physiol 297: L816 L827, 2009. First published August 14, 2009; doi:10.1152/ajplung.90466.2008. Characteristics of Cl uptake in rat alveolar type I cells Meshell Johnson, 1,4
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationBiguang Tuo 1, Guorong Wen 1 and Ursula Seidler 2. Introduction
British Journal of Pharmacology (2009), 158, 1313 1321 2009 The Authors Journal compilation 2009 The British Pharmacological Society All rights reserved 00071188/09 www.brjpharmacol.org RESEARCH PAPER
More informationExhaled Biomarkers Asthma & COPD. AS Paul DM Seminar 30 March 07
Exhaled Biomarkers Asthma & COPD AS Paul DM Seminar 30 March 07 Introduction Diagnosis and course of COPD/Asthma Clinical information Pulmonary function tests Arterial blood gases Chest X-raysX No direct
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationPHSI3009 Frontiers in Cellular Physiology 2017
Overview of PHSI3009 L2 Cell membrane and Principles of cell communication L3 Signalling via G protein-coupled receptor L4 Calcium Signalling L5 Signalling via Growth Factors L6 Signalling via small G-protein
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationChapter 10. The Respiratory System Exchange of Gases. Copyright 2009 Pearson Education, Inc.
Chapter 10 The Respiratory System Exchange of Gases http://www.encognitive.com/images/respiratory-system.jpg Human Respiratory System UPPER RESPIRATORY TRACT LOWER RESPIRATORY TRACT Nose Passageway for
More informationHistamine Develops Homologous Desensitization under Ca 2+ -free Conditions with Increase in Basal Tone in Smooth Muscle of Guinea Pig Taenia Caeci
YAKUGAKU ZASSHI 130(3) 451 455 (2010) 2010 The Pharmaceutical Society of Japan 451 Notes Histamine Develops Homologous Desensitization under Ca 2+ -free Conditions with Increase in Basal Tone in Smooth
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature22394 Supplementary Table 1 Observed intermolecular interactions within the GLP-1:GLP-1R TMD interface. Superscripts refer to the Wootten residue numbering system
More informationThe action potential and the underlying ionic currents. Norbert Jost, PhD
The action potential and the underlying ionic currents Norbert Jost, PhD The propagation of the stimulation in the heart Sinus node Left atria His Bundle Conduction velocity in m/s Time to arrive from
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationIdentification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.
Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationThere is a substantial need for new biomarkers. Absorptive clearance of DTPA as an aerosol-based biomarker in the cystic fibrosis airway
Eur Respir J 2010; 35: 781 786 DOI: 10.1183/09031936.00059009 CopyrightßERS Journals Ltd 2010 Absorptive clearance of DTPA as an aerosol-based biomarker in the cystic fibrosis airway T.E. Corcoran*, K.M.
More informationTALKING POINTS. Ten Reasons Why the Ozone Air Quality Standard Must Be Strengthened
October 22, 2014 TALKING POINTS Ten Reasons Why the Ozone Air Quality Standard Must Be Strengthened 1. The current standard is not protective of public health. The Clean Air Act requires EPA to set National
More information