SUPPLEMENTARY INFORMATION doi: /nature12026
|
|
|
- Jared Singleton
- 5 years ago
- Views:
Transcription
1 doi:1.138/nature1226 a MCSF level (pg/ml) h3 3h 5h 7h 15h 24h b MPP (CD135 KSL) HSC (CD34 CD15 KSLF) c % 4 ** LPS 3 GFP pos cells 2 PU.1 GFP LPS 1 FSCA Ctl NI 24h LPS Sup.Fig.1 Effect of LPS on MCSF release and PU.1 induction in HSC a) Serum levels of MCSF after LPS stimulation Median and individual concentrations of MCSF in blood serum from five mice at the indicated times after 5mg/kg intraperitoneal LPS injection. b,c)representative FACS profiles (b) and quantification (c) of GFP expression in MPP and HSC of PU.1GFP reporter mice before or after 24h of 5mg/kg LPS injection. ** p =.3, n = 4,2 1
2 RESEARCH MCSFR R.U HSC KSL Bcells Sup.Fig.2 MCSFR expression in HSC Relative expression of MCSFR normalized to GAPDH (R.U.) by qrtpcr analysis in sorted HSC, KSL (ckit, sca1, lin ) hematopoietic stem and progenitor cells (HS/PC) and CD19 Bcells from the bone marrow, as positive and negative control respectively. Error bars show standard error of the mean from duplicates. Error Bars show standard deviation from duplicates. 2
3 RESEARCH a MCSFR 5 4 R.U MCSF HSC MPP b 12 MafB 1 R.U MCSF HSC MPP Sup.Fig.3 MCSFR and MafB expression in HSC after MCSF stimulation Relative expression of MCSFR (a) and MafB (b) normalized to GAPDH (R.U.) by qrtpcr analysis in sorted HSC, 16h after control (PBS) or MCSF injection, compared to untreated MPP (CD135 KSL) as control for a population containing myeloid committed cells 3, with high MCSFR and low MafB expression, respectively. Error bars show standard deviation from duplicates. 3
4 RESEARCH a 5,3% 6,1% KSL CD15hi CD15int MCSF b 7,2% HSC GFP 69,7% GFP GFP CD15hi CD15int 53,3% GFP CD15hi CD15int MCSF CD15 5,2% 6,5% CD15hi CD15int PU1 GFP 33,2% GFP GFP CD15 7% CD15hi CD15int 52,8% CD15hi CD15int CD34 Flt3 CD34 c % 1 GFP GFP 8 6 CD15 hi HSC 4 2 Sup.Fig.4 Distribution of CD15hi HSC in GFP HSC. a) Gating strategy for CD15hi HSC in the KSL compartment following published definitions 2. b,c) Representative FACS profiles (b) and quantification (c) of CD15hi HSC subpopulations in GFP and GFP HSC from PU.1GFP mice 16h after control (PBS) or MCSF injection. 4
5 RESEARCH a CD15 hi HSC (CD34 KSLF) cumulative cell divisions MCSF cumulative number of dead cells MCSF time (h) time (h) b Total HSC (CD15 CD34 KSLF) cumulative cell divisions MCSF cumulative number of dead cells MCSF time (h) time (h) Sup.Fig.5 Recording of cell division and cell death of HSC in culture by video imaging. Cumulative cell divisions (left) and cumulative number of cells that died (right) of CD15hi (a) and total (b) HSC for 1 and 36 input cells respectively, over the indicated times in culture with or without MCSF. The vast majority of first cell divisions occurred after 24h and nearly no additional cell death occurred after minimal initial sorting and culture stress. No significant differences in proliferation or cell death were detected between culture with or without MCSF. 5
6 RESEARCH MCSF PI Annexin Sup.Fig.6 Analysis of viability of HSC after MCSF stimulation Propidium iodide / Annexin V staining of HSC after 16h in culture with or without MCSF. 6
7 RESEARCH h genes Lympho Myelo E Meg E Meg Lin Myelo Myelo/Lympho Mix single cells Sup.Fig.7 Blow up of Fig.3a, showing single cell gene expression analysis of HSC before culture. The genes analyzed are classified and colour coded on top according to published gene expression analysis of early lineage committed progenitors 4,41. PU.1 is indicated by an asterix. Cells are clustered according to lineage identity indicated on the right. Meg MegE Lin neg >3,2 <12,86 7
8 RESEARCH MCSF genes Lympho Myelo E Meg E Meg Lin Myelo Myelo/Lympho single cells Mix Sup.Fig.8 Blow up of Fig.3b, showing single cell gene expression analysis of HSC after 16h culture without MCSF. The genes analyzed are classified and colour coded on top according to published gene expression analysis of early lineage committed progenitors 4,41. PU.1 is indicated by an asterix. Cells are clustered according to lineage identity indicated on the right. Meg MegE Lin neg >3,2 <12,86 8
9 RESEARCH genes Lympho Myelo E Meg E Meg Lin Myelo Myelo/Lympho single cells Sup.Fig.9 Blow up of Fig.3c, showing single cell gene expression analysis of HSC after 16h culture with MCSF. The genes analyzed are classified and colour coded on top according to published gene expression analysis of early lineage committed progenitors 4,41. PU.1 is indicated by an asterix. Cells are clustered according to lineage identity indicated on the right. Mix Meg MegE >3,2 <12,86 9
10 RESEARCH a PU.1 GFP CD h PU.1 HSC PU.1 cells 2w 2w GMP/MEP spleen GMP/MEP spleen b 1.2 spleen ** c % 5 spleen * 4 GMP/ MEP.8.4 GMP in CD PU.1 PU.1 PU.1 PU.1 d Sup.Fig.1 Differentiation potential of MCSF induced PU.1 cells a) Experimental design for transplantation of sorted CD45.2 PU.1 HSC before and after induction of PU.1 cells in MCSF culture into sublethally irradiated recipients and analysis of progeny cells after 2 weeks in the spleen. b,c) Quantification of the ratio of donor GMP to MEP progenitors (b) and total GMP (c) derived from transplanted PU.1 HSC before or PU.1 cells after MCSF culture. **p =.2, *p =.7, n = 6,7. d) Cells with macrophage morphology phagocytosing fluorescent latex beads after continued culture of PU.1 cells in MCSF for 1 days. 1
11 ratio RESEARCH a MCSF CD h HSC CD45.2 GMP MEP in spleen (2w) CD45.2 Myelo/Lympho in blood (4w) b 3 Spleen GMP MEP 124 Monocytes/Bcells * ** *** c Blood 256 % in CD45.2 cells Sup.Fig.11 Differentiation potential of MCSF primed HSC a) Experimental design for transplantation of in vivo MCSF primed CD45.2 HSC into sublethally irradiated recipients and analysis of progeny cells after 2 weeks in the spleen or 4 weeks in the blood. b) Percentage of GMP and MEP progenitors in total donor cells derived from control (PBS) or MCSF primed HSC in the spleen 2 weeks after transplantation. *p =.1, **p =.4, n = 4,4 c) Quantification of the ratio of donor CD11b SSC lo monocytes to CD19 Bcells in the blood 4 weeks after transplantation. ***p =.9, n = 8,
12 RESEARCH a MCSF CD45.2 ActinGFP 16h competitor CD45.2 HSC HSC 46w GFP in CD45.2 blood cells Myelo/Lympho in GFP Myelo/Mega in GFP b Red cell lyzed total Blood Mac1 CD19 Mac1 CD19 CD45.2 Mac1 SSC SSC CD19 Red cell lyzed total Blood CD19 total Blood CD61 CD45.2 CD19 CD45.2 FSC/SSC low CD61 GFP CD19 CD45.2 GFP CD61 Myeloid Lymphoid Platelets FSC GFP GFP Sup.Fig.12 Competitive transplantation of MCSF primed HSC a) Experimental design for competitive transplantation of FACS sorted in vivo MCSF primed HSC (CD15CD34CD135KSL) from actingfp CD45.2 mice together with CD45.2 competitor HSC into lethally irradiated recipients and analysis of blood cell contribution. b) Gating strategy for quantification of actingfp HSC derived myeloid, lymphoid blood cells and platelets. 12
13 RESEARCH c % GFP 1 ** 4 weeks 6 weeks 14 weeks Myelo B Cells Platelets Myelo B Cells Platelets Myelo B Cells Platelets T Cells Sup.Fig.12 Competitive transplantation of MCSF primed HSC c) Donor contribution to blood of competitively reconstituted mice 4, 6 and 14 weeks after transplantation of MCSF primed or control HSC, expressed as percentage of GFP donor cells in Mac myeloid, CD19 B Cells, CD61 Platelets (4, 6 and 14 weeks) and CD3e T Cells (14 weeks) and normalized to total GFP contribution in CD45.2 donor compartment. ** p =.3, n = 6,
14 RESEARCH pi:c MCSF PU.1 fl/fl PU.1 fl/fl PU.1 fl/fl MxCre ct PU.1 Δ PU.1 fl Sup.Fig.13 Analysis of PU1 deletion PCR analysis to detect deleted (PU.1Δ) and loxp flanked (PU.1fl) PU.1 alleles in samples transplanted in fig.4i from control or MCSF primed HSC isolated from PU.1fl/fl::MxCre or PU.1fl/fl bone marrow 7 days after last treatment with pi:c. 14
15 RESEARCH FSC/SSC singlet SSCA SSCH CD45.2 FSCA SSCW CD45.2 CD45.2 GMP CD117 CD117/Sca1 Prog CD16/32 MEP Sca1 CD34 Sup.Fig.14 Gating strategy for detection of HSC derived donor CD45.2 GMP and MEP populations in the spleens of recipients. 15
16 RESEARCH h MCSF Myeloid total Myeloid total Myeloid total Experiment Experiment Experiment total p=,1 p=,1 Sup.table 1, related to Fig 3a,b,c Summary of cell numbers with myeloid identity in three independent single cell nanofluidic real time PCR experiments on FluidigmTM array for freshly isolated HSC (h) or after 16 hour of culture in the absence or the presence of MCSF. HSC were FACS sorted as CD15CD34CD48KSLF (experiment 1,3) or CD15CD34KSLF (experiment 2). Experiment 3 is shown in Fig.3a and sup.fig
17 RESEARCH Supplementary Discussion The M CSF receptor can activate multiple partially connected downstream signalling pathways 28, including Src, PI3K and Erk kinase that were tested by chemical inhibition in our assays. Src kinase can activate both PI3K and Erk signalling 28,42, which in turn can activate c/ebpα, c Jun, Runx1 and NFkB transcription factors that are known to control the promoter and upstream regulatory element (URE) enhancer of the pu.1 gene 46 5 and to be functionally important in early hematopoietic stem/progenitor cells 48,49,51,52. It will be interesting in the future to determine the relative importance of these factors in M CSF induced PU.1 expression in HSC. Supplementary References 4 Laslo, P. et al. Multilineage transcriptional priming and determination of alternate hematopoietic cell fates. Cell 126, (26). 41 Pronk, C. J. et al. Elucidation of the phenotypic, functional, and molecular topography of a myeloerythroid progenitor cell hierarchy. Cell Stem Cell 1, (27). 42 McCubrey, J. A. et al. Roles of the RAF/MEK/ERK and PI3K/PTEN/AKT pathways in malignant transformation and drug resistance. Adv Enzyme Regul 46, , (26). 43 Jack, G. D., Zhang, L. & Friedman, A. D. M CSF elevates c Fos and phospho C/EBPalpha(S21) via ERK whereas G CSF stimulates SHP2 phosphorylation in marrow progenitors to contribute to myeloid lineage specification. Blood 114, , (29). 44 Bae, S. C. & Lee, Y. H. Phosphorylation, acetylation and ubiquitination: the molecular basis of RUNX regulation. Gene 366, 58 66, (26). 45 Buitenhuis, M. & Coffer, P. J. The role of the PI3K PKB signaling module in regulation of hematopoiesis. Cell Cycle 8, , (29). 46 Lichtinger, M. et al. RUNX1 reshapes the epigenetic landscape at the onset of haematopoiesis. EMBO J 31, , (212). 47 Yeamans, C. et al. C/EBPalpha binds and activates the PU.1 distal enhancer to induce monocyte lineage commitment. Blood 11, , (27). 48 Huang, G. et al. PU.1 is a major downstream target of AML1 (RUNX1) in adult mouse hematopoiesis. Nat Genet 4, 51 6, (28). 49 Bonadies, N. et al. PU.1 is regulated by NF kappab through a novel binding site in a 17 kb upstream enhancer element. Oncogene 29, , (21). 5 Leddin, M. et al. Two distinct auto regulatory loops operate at the PU.1 locus in B cells and myeloid cells. Blood 117, , (211). 51 Zhang, P. et al. Enhancement of hematopoietic stem cell repopulating capacity and self renewal in the absence of the transcription factor C/EBP alpha. Immunity 21, (24). 52 Steidl, U. et al. Essential role of Jun family transcription factors in PU.1 knockdown induced leukemic stem cells. Nat Genet 38, , (26). 17
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
Normal & Leukaemic haematopoiesis. Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore
Normal & Leukaemic haematopoiesis 2010 Dr. Liu Te Chih Dept of Haematology / Oncology National University Health Services Singapore Use of Immunophenotyping today Lineage assignment Differentiation of
Chronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)
Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis
Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
Molecular Characterization of Leukemia Stem Cell Development. Scott A. Armstrong MD, Ph.D.
Molecular Characterization of Leukemia Stem Cell Development Scott A. Armstrong MD, Ph.D. Normal and Leukemic Hierarchies NORMAL HSC (SRC) Myeloid progenitor LTC-IC CFU AML LSC (SL-IC) Leukemic LTC-IC
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
Imtiyaz et al., Fig. S1
. Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Haematopoietic stem cells
Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell
Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells
Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells J. M. Heath, A. Chalishazar, C.S. Lee, W. Selleck, C. Cotta-Ramusino, D. Bumcrot, J.L.
The Hierarchical Organization of Normal and Malignant Hematopoiesis
The Hierarchical Organization of Normal and Malignant Hematopoiesis NORMAL Hematopoie2c Stem Cell (HSC) Leukemia Stem Cells (LSC) MPP MLP CMP Leukemic Progenitors MEP GMP B/NK ETP Leukemic Blasts Erythrocytes
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Getting to the root of Cancer
Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
RUNX1 and FPD/AML Translational Research. The Leukemia and Lymphoma Society / Babich Family Foundation Partnership. September 2016
www.lls.org www.runx1.com RUNX1 and FPD/AML Translational Research The Leukemia and Lymphoma Society / Babich Family Foundation Partnership September 2016 Prepared by L. Greenberger, PhD Chief Scientific
Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE
a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
A cell-intrinsic role for CaMKK2 in granulocyte lineage commitment and differentiation
Article A cell-intrinsic role for CaMKK2 in granulocyte lineage commitment and differentiation Ellen C. Teng,* Luigi Racioppi,*, and Anthony R. Means*,1 *Department of Pharmacology and Cancer Biology,
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr )
Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr 130259) The main goal of this project focuses on establishing
Supplementary Materials Extracting a Cellular Hierarchy from High-dimensional Cytometry Data with SPADE
Supplementary Materials Extracting a Cellular Hierarchy from High-dimensional Cytometry Data with SPADE Peng Qiu1,4, Erin F. Simonds2, Sean C. Bendall2, Kenneth D. Gibbs Jr.2, Robert V. Bruggner2, Michael
Long-term innate immune memory via effects on bone marrow progenitors
Long-term innate immune memory via effects on bone marrow progenitors Helen S Goodridge, PhD helen.goodridge@csmc.edu Regenerative Medicine Institute, Cedars-Sinai Medical Center, Los Angeles, USA Fondation
The Role of Rac Signaling in The Perivascular Niche
The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-13-1-0057 TITLE: Role of TIRAP in Myelodysplastic Syndromes PRINCIPAL INVESTIGATOR: Linda Ya-ting Chang CONTRACTING ORGANIZATION: British Columbia Cancer Agency Branch Vancouver,
Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit
Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15
Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow
White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
TITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis
AD Award Number: W81XWH-05-1-0608 TITLE: Properties of Leukemia Stem Cells in a Novel Model of CML Progression to Lymphoid Blast Crisis PRINCIPAL INVESTIGATOR: Craig T. Jordan, Ph.D. CONTRACTING ORGANIZATION:
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS a Division of Stem Cell Therapy, b Stem Cell Bank, Center for Stem Cell Biology and Regenerative Medicine, f Laboratory of Molecular Pathogenesis, Center for Experimental Medicine
Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently
Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre
Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU
Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells
Research article The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells Sungho Kook, 1 Joonseok Cho, 1 Sean Bong Lee, 2 and Byeong-Chel Lee 1 1 University of Pittsburgh
Chronic Myeloid Leukemia Outlook: The Future of CML Therapy
Chronic Myeloid Leukemia Outlook: The Future of CML Therapy Neil Shah, MD PhD Edward S. AgenoDistinguished Professor in Hematology/Oncology UCSF School of Medicine San Francisco, California Progression
THE HYPOXIC HEMATOPOIETIC STEM CELL NICHE Consequences of Hypoxiainduced Transcription on Stem Cell Fate
THE HYPOXIC HEMATOPOIETIC STEM CELL NICHE Consequences of Hypoxiainduced Transcription on Stem Cell Fate Rehn, Matilda Published: 2011-01-01 Link to publication Citation for published version (APA): Rehn,
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT
UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT Mitchell E. Horwitz, MD Duke University Medical Center Duke Cancer Institute
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
The Oncogenic MicroRNA mir-22 Targets the TET2 Tumor Suppressor to Promote Hematopoietic Stem Cell Self-Renewal and Transformation
Article The Oncogenic MicroRNA mir- Targets the TET Tumor Suppressor to Promote Hematopoietic Stem Cell Self-Renewal and Transformation Su Jung Song, 1,,3,4,9 Keisuke Ito, 1,,3,4,9,1 Ugo Ala, 1,,3,4 Lev
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
SUPPLEMENTARY INFORMATION
DOI:.3/ncb7 Hematopoiesis Expression (Protein) Competition PRC integration Polycomb-mediated gene repression Cell fate HSC PRC SELF-RENEWAL Cbx Cbx4 PRC progenitor genes PROG Cbx PRC Cbx4 DIFFERENTIATION
Nature Genetics: doi: /ng.3812
Nature Genetics: doi:10.1038/ng.3812 Supplementary Figure 1 Smarcd2-knockout mice die perinatally with impaired energy homeostasis. (a) Generation of the Smarcd2 conditional knockout allele. Deletion of
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression
AD Award Number: W81XWH-04-1-0795 TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression PRINCIPAL INVESTIGATOR: Kenneth Dorshkind, Ph.D. CONTRACTING ORGANIZATION: University of California,
Quantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Inhibition of Aldehyde Dehydrogenase Expands Hematopoietic Stem Cells with Radioprotective Capacity GARRETT G. MURAMOTO, a J. LAUREN RUSSELL, a RACHID SAFI, b ALICE B. SALTER,
TITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse. REPORT DATE: September 2014
AWARD NUMBER: W81XWH-13-1-0245 TITLE: Assessing the Mechanisms of MDS and its Transformation to Leukemia in a Novel Humanized Mouse PRINCIPAL INVESTIGATOR: Stephanie Halene CONTRACTING ORGANIZATION: Yale
Impaired DNA replication within progenitor cell pools promotes leukemogenesis
Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert
Acute myeloid leukemia. M. Kaźmierczak 2016
Acute myeloid leukemia M. Kaźmierczak 2016 Acute myeloid leukemia Malignant clonal disorder of immature hematopoietic cells characterized by clonal proliferation of abnormal blast cells and impaired production
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice
Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Mariusz Z. Ratajczak M.D., Ph.D., d.hc. Stem Cell Institute at the James Graham Brown Cancer Center, University of Louisville.
Umbilical cord blood-derived CD45 - /SSEA-4 + /OCT-4 + /CD133 + /CXCR4 + /Lin - very small embryonic/epiblast like stem cells (VSELs) Potential Clinical Applications Mariusz Z. Ratajczak M.D., Ph.D., d.hc.
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
RCPA Research Award Final Progress Review
RCPA Research Award 2010-2011 Final Progress Review Name: Dr Craig Wallington-Beddoe Degree/Institution/Year: PhD, The University of Sydney, Year 2 Research Project Title: New Therapeutic Strategies for
BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid
Supplementary Results BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia Oliver Hantschel*, Wolfgang Warsch*, Eva Eckelhart*, Ines Kaupe, Florian Grebien, Kay-Uwe Wagner, Giulio
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Characterization of human myeloid progenitors and their differentiation
Characterization of human myeloid progenitors and their differentiation Edvardsson, Louise 2006 Link to publication Citation for published version (APA): Edvardsson, L. (2006). Characterization of human
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Long-term production of blood cells depends on proper hematopoietic
MicroRNAs enriched in hematopoietic stem cells differentially regulate long-term hematopoietic output Ryan M. O Connell a,1, Aadel A. Chaudhuri a,1, Dinesh S. Rao a,b, William S. J. Gibson a, Alejandro
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Transfer protocol of human HSC into NOG mice
Transfer protocol of human HSC into NOG mice Mice: Adult NOG mice are aged 8-12 weeks. Newborn mice are 1 2 days old. 8-12 week old NOG mice irradiated with 2.5 Gy Intravenous transfer of 1-0.5 x 10 5
Supplementary Information
Supplementary Information Distinct bone marrow-derived and tissue resident macrophage lineages proliferate at key stages during inflammation. 1 Luke C. Davies, 1 Marcela Rosas, 2 Stephen J. Jenkins, 1
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells
Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells articles Julie Lessard* & Guy Sauvageau* * Laboratory of Molecular Genetics of Hemopoietic Stem Cells, Clinical Research Institute