Supplementary Information. Targeting BRK-positive Breast Cancer with Small
|
|
|
- Marvin Smith
- 5 years ago
- Views:
Transcription
1 Supplementary Information Targeting BRK-positive Breast Cancer with Small Molecule Kinase Inhibitors Jie Jiang 1#, Fu Gui 1#, Zhixiang He 1#, Li Li 1, Yunzhan Li 1, Shunying Li 2, Xinrui Wu 1, Zhou Deng 1, Xihuan Sun 1, Xiaoxing Huang 1, Wei Huang 1, Shang Han 1, Ting Zhang 1, Zheng Wang 1, Bo Jiao 3, Siyang Song 1, Hongrui Wang 1, Lanfen Chen 1, Dawang Zhou 1, Qiang Liu 2, Ruibao Ren 3,4*, Jianming Zhang 5*, Xianming Deng 1* 1 State Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Signaling Network, School of Life Sciences, Xiamen University, Xiamen, Fujian , China. 2 Breast Tumor Center, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou , China. 3 State Key Laboratory for Medical Genomics, Shanghai Institute of Hematology, Collaborative Innovation Center of Hematology, Collaborative Innovation Center of System Biology, Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai , China. 4 Department of Biology, Brandeis University, Waltham, MA 02453, USA 5 Cutaneous Biology Research Center, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02129, USA. # These authors contributed equally to this work. * Correspondence: Xianming Deng Tel: , Fax: , xmdeng@xmu.edu.cn; Jianming Zhang Tel: , Jzhang14@mgh.harvard.edu; Ruibao Ren, Tel: , ren@brandeis.edu. S1
2 Supplemental Figures and Tables: Figure S1. S2
3 Figure S2. S3
4 Figure S3. S4
5 Figure S4. S5
6 Figure S5. S6
7 Figure S6. S7
8 Figure S7. S8
9 Figure S8. S9
10 Figure S9. S10
11 Table S1: IC 50 s of XMU-MP-2 on a panel of 28 Tyrosine Kinases transformed Ba/F3 cells. Family Tyr Kinase IC50 (nm) Transformed Ba/F3 cell line BRK 29.7 Tel-BRK Ba/F3 SRC Tel-SRC Ba/F3 LCK Tel-LCK Ba/F3 LYN Tel-LYN Ba/F3 HCK Tel-HCK Ba/F3 FRK Tel-FRK Ba/F3 BMX 77.7 Tel-BMX Ba/F3 ARG Tel-ARG Ba/F3 ZAP Tel-ZAP-70 Ba/F3 FAK Tel-FAK Ba/F3 EphA Tel-EphA1 Ba/F3 EphA Tel-EphA3 Ba/F3 EphA Tel-EphA4 Ba/F3 TIE Tel-TIE1 Ba/F3 PDGFRβ Tel-PDGFRβ Ba/F3 FLT Tel-FLT3 Ba/F3 KDR Tel-KDR Ba/F3 RET Tel-RET Ba/F3 FGFR Tel-FGFR4 Ba/F3 FGFR Tel-FGFR1 Ba/F3 FGFR Tel-FGFR2 Ba/F3 FGFR Tel-FGFR3 Ba/F3 CCK Tel-CCK4 Ba/F3 INSR Tel-INSR Ba/F3 IGF-1R Tel-IGF-1R Ba/F3 ALK 1071 Tel-ALK Ba/F3 EGFR 39.0 Tel-EGFR Ba/F3 HER Tel-HER2 Ba/F3 Non-receptor tyrosine kinases Receptor tyrosine kinases Note: Cells were treated with DMSO or serially diluted XMU-MP-2 for 48 hours. Cell viability was assayed by MTS. S11
12 Table S2: Antiproliferative activity of XMU-MP-2 against a panel of human breast cancer and non-tumorigenic cell lines. Tumor type Cell line BRK expression IC 50 (nm) T-47D Breast cancers Nontumorigenic Cell Lines MCF BT BT MDA-MB L-02 + > GES MCF 10A Note: Cells were treated with DMSO or serially diluted doses of XMU-MP-2 for 48 h. Cell growth inhibition was determined by MTS assay. The IC 50 s were calculated from the results of the assays. The color code accounts for the range of IC 50 (blue: IC nm; light blue: 100 nm < IC nm; cyan: 1000 nm < IC nm; white: IC 50 > nm). S12
13 Table S3: The list of primer sequences. Gene name Primer sequence 5 Primer sequence 3 Restriction enzyme BRK 5'-AAAAGTTAACCCCAAGTATGTGGGCCTCTG-3' 5'-AAAAGTCGACTTAATGGTGATGGTGATGATGCTCGTAGCTGGTGAAGCTG-3' HpaI/SalI CCK4/PTK7 5'-AAAACATATGCTGCAGCCCATCACCACGC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCAGGGCGCTGGCAATCTCAC-3' NdeI/SalI EGFR 5'-AAAAGTTAACTTC5'-AAAAAGATCAAAGTGC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCACAAGGTAGCGCTGGGGGTC-3' HpaI/SalI FGFR3 5'-AAAACATATGCTGACCCTGGGCAAGCCCCTTG-3' 5'-AAAAGTCGACTTACTGGGAGGGCGCGGCATGCCAGC-3' NdeI/SalI HER2 5'-AAAAGTTAACCTGAGGAAGGTGAAGGTGCTTGG-3' 5'-AAAAGTCGACTAAGGAGAATTCAGACACCAACTCC-3' HpaI/SalI BMX/ETK 5'-AAAACATATGATTACCTTGTTGAAGGAGCTGG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCTGGTTCAATGGAAGACAGG-3' NdeI/SalI FLT3 5'-AAAAGTTAACTTAGAGTTTGGGAAGGTACT-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCT5'-AAAAACGAAGTCAAATTAG-3' HpaI/SalI FGFR4 5'-AAAACATATGCTGGTGCTTGGGAAGCCCCT-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCAGCGCCTCCACCAGCTGC-3' NdeI/SalI FGFR2 5'-AAAACATATGCTGACACTGGGCAAGCCCC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCAAGTCTTCTACCAACTGCT-3' NdeI/SalI FRK 5'-AAAACATATGATACAGCTTCTGAAGCGATTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATC5'-AAAATAGTCTTCAAGTTTCC-3' NdeI/SalI FGFR1 5'-AAAACATATGCTGGTCTTAGGCAAACCCC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCAGGTCTTCCACCAGCTGC-3' NdeI/SalI LYN 5'-AAAACATATGATCAAGTTGGTG5'-AAAAGGCTTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCATCCAGGACGCTCTGTAAG-3' NdeI/SalI IGF-1R 5'-AAAACATATGATCACCATGAGCCGGGAAC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCTCTTTGATGCTGCTGAT-3' NdeI/SalI KDR 5'-AAAACATATGCTGAAGCTAGGTAAGCCTCTTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCAAATGTTCCACCAACTCTG-3' NdeI/SalI HCK 5'-AAAACATATGCTCAAGCTGGAGAAGAAACTTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCATCCAGCACACTCTGGATGTAT-3' NdeI/SalI LCK 5'-AAAACATATGCTGAAGCTGGTGGAGCGGC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCTCCAGCACACTGCGCAGGTA-3' NdeI/SalI SRC 5'-AAAACATATGCTGCGGCTGGAGGTCAAGCTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCGAAGGCCTGCAGGTACTCG-3' NdeI/SalI PDGFRβ 5'-AAAACATATGCTTGTGCTGGGACGCACCC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCGAGAAGCAGCACCAGCTGGG-3' NdeI/SalI FAK 5'-AAAACATATGATAGAACTTGGACGATGTAT-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCTGAGCTGAGCTTTAAGTTC-3' NdeI/SalI TIE1 5'-AAAACATATGATCACCTTTGAGGACCTCATC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCTAGCTGTAGCGCAATCTGGG-3' NdeI/SalI INSR 5'-AAAACATATGATCACCCTCCTTCGAGAGC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCGAGCAGGTTGACAATCTCC-3' NdeI/SalI ARG 5'-AAAACATATGATTACCATGAAGCACAAAC-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATC5'-AAAAGCTTGGTGTGTTTCAG-3' NdeI/SalI ZAP-70 5'-AAAACATATGCTCATAGCTGACATTGAACTTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCAGGAAGTCGGGGCGATCC NdeI/SalI RET 5'-AAAACATATGTTGGTTCTTGG5'-AAAAACTCTAGG-3'5'-AAAAGTCGACTAACTTCTCCAGGTCTTTGCTGATG-3' NdeI/SalI EphA4 5'-AAAACATATGATTAAGATTG5'-AAAAAGTTATAG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCCATGTTGACAATCTGCCCAA-3' NdeI/SalI ALK 5'-AAAAAAGCTTGGAAGCACCAGGAGCTGCAAGC-3' 5'-AAAAGTCGACTTATCAGGGCCCAGGCTGGTTCATG-3' HindIII/SalI EphA3 5'-AAAACATATGATATCCATTGATAAAGTTG-3' 5'-AAAAGTCGACTTACTTGTCATCGTCATCCTTGTAATCAATACTAACAATCTGCTCAAAC-3' NdeI/SalI EphA1 5'-AAAAGAATTCGCCTGATGGTGGACACTGTCATAG-3'5'-AAAAGTCGACTTACAGTTGCTCCAGATGTGCC-3' EcoRI/SalI BRK(Y447F) 5'-AAAAGTTAACCCCAAGTATGTGGGCCTCTG-3' 5'-AAAAGTCGACTTAATGGTGATGGTGATGATGGGTCGGGTTCTCGAAGCTGGTGAAGCTGGAGAG-3'HpaI/SalI BRK(T264M)5'-CGTGTACATCATCATGGAGCTCATGGCCAA-3' 5'-TTGGCCATGAGCTCCATGATGATGTACACG-3' S13
Supplementary information
Supplementary information Pyk2 activates the NLRP3 inflammasome by directly phosphorylating ASC and contributes to inflammasome-dependent peritonitis I-Che Chung 1, Chun-Nan OuYang 1, Sheng-Ning Yuan 1,
Expression of programmed death ligand-1 on tumor cells varies pre and post
Expression of programmed death ligand-1 on tumor cells varies pre and post chemotherapy in non-small cell lung cancer Jin Sheng 1,2,3,*, Wenfeng Fang 1,2,3,*, Juan Yu 3, Yunpeng Yang 1,2,3, Yuxiang Ma
Mechanisms of resistance to JAK inhibitors. L. Knoops
Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm)
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm) Class I Class II HDAC1 HDAC2 HDAC3 HDAC8 HDAC4 HDAC5 HDAC6 HDAC7 HDAC9 HDAC10 4.5 12.6 9.1 79.8 13.2 11.4
Supplementary Information
Supplementary Information Prognostic Impact of Signet Ring Cell Type in Node Negative Gastric Cancer Pengfei Kong1,4,Ruiyan Wu1,Chenlu Yang1,3,Jianjun Liu1,2,Shangxiang Chen1,2, Xuechao Liu1,2, Minting
Postoperative survival for patients with thymoma complicating myasthenia gravis preliminary retrospective results of the ChART database
Original Article Postoperative survival for patients with thymoma complicating myasthenia gravis preliminary retrospective results of the ChART database Fangrui Wang 1, Liewen Pang 1, Jianhua Fu 2, Yi
Rapid Detection of Milk Protein based on Proteolysis Catalyzed by Trypsinase
Rapid Detection of Milk Protein based on Proteolysis Catalyzed by Trypsinase Yafeng Chen Institute of Food Quality and Safety, University of Shanghai for Science and Technology Shanghai 93, China Email:cyfxy498@6.com
Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF
Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF- 02341066 Assay IC 50 nm Selectivity Ratio d Biochemical Activity In Vitro c-met/hgfr enzyme (Ki, nm) a 4 NA Cellular Activity
SUPPLEMENTARY INFORMATION
Supplementary Information S3 TAM- family small molecule kinase inhibitors in development Compound Indication(s) Target Profile Develop Primary Target MERTK TYRO3 Other targets ment Phase Refs Cabozantinib
Chinese Pharmacological Bulletin 2012 Sep ~ 6. http / /www. cnki. net /kcms /detail / R html
1262 1262 ~ 6 2012-8 - 14 17 19 http / /www. cnki. net /kcms /detail /34. 1086. R. 20120814. 1719. 018. html MG - 63 1 1 2 2 1. 453003 2. 361005 doi 10. 3969 /j. issn. 1001-1978. 2012. 09. 018 A 1001-1978
An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
Robotic thoracic surgery: S 1+2 segmentectomy of left upper lobe
Case Report Page 1 of 5 Robotic thoracic surgery: S 1+2 segmentectomy of left upper lobe Hailei Du, Su Yang, Wei Guo, Runsen Jin, Yajie Zhang, Xingshi Chen, Han Wu, Dingpei Han, Kai Chen, Jie Xiang, Hecheng
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women
Overcoming Resistance to HER2 Inhibitors Through State-Specific Kinase Binding
Supplementary Information Overcoming Resistance to Inhibitors Through State-Specific Kinase Binding Chris J. Novotny 1, Sirkku Pollari 2, Jin H. Park 3, Mark A. Lemmon 3,4, Weijun Shen 2*, Kevan M. Shokat
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs).
RayBio Phosphorylation Antibody Array I For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs). User Manual (Revised Jul 25, 2007) (Cat# AAH-PRTK-1-2;
Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54
CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
Liu Jing and Liu Jing Diagnosis System in Classical TCM Discussions of Six Divisions or Six Confirmations Diagnosis System in Classical TCM Texts
Liu Jing and Liu Jing Diagnosis System in Classical TCM Discussions of Six Divisions or Six Confirmations Diagnosis System in Classical TCM Texts Liu Jing Bian Zheng system had developed about 1800 years
Original Article Influence of retinal photocoagulation applied to severe diabetic retinopathy on the life quality of patients
Int J Clin Exp Med 2016;9(2):4630-4634 www.ijcem.com /ISSN:1940-5901/IJCEM0016207 Original Article Influence of retinal photocoagulation applied to severe diabetic retinopathy on the life quality of patients
VEGFR. 1
VEGFR VEGFRs (vascular endothelial growth factor receptors) are tyrosine kinase receptors responsible for binding with VEGF to initiate signal cascades that stimulate angiogenesis among other effects.
Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes
Oncogenes and Proto-oncogenes Jekyll and Hyde A double edged sword Origin of oncogenes? Oncogene hypothesis Retroviral oncogenes and cell proto-oncogenes (v-onc) (c-onc) The role of c-onc in cancer How
Alumina stabilized ZnO-graphene anode for lithium ion
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting Information for Alumina stabilized ZnO-graphene anode for lithium ion batteries via
China experts consensus on icotinib for non-small cell lung cancer treatment (2015 version)
Consensus Page 1 of 5 China experts consensus on icotinib for non-small cell lung cancer treatment (2015 version) Yuankai Shi 1, Yan Sun 1, Cuimin Ding 2, Ziping Wang 1, Changli Wang 3, Zheng Wang 4, Chong
Report on the development and application of PET/CT in mainland China
/, 2017, Vol. 8, (No. 38), pp: 64417-64426 Report on the development and application of PET/CT in mainland China Yumei Chen 1,2,*, Ruohua Chen 1,2,*, Xiang Zhou 1,2, Jianjun Liu 1 and Gang Huang 1,2,3
Supplemental text file, including:
Supplemental text file, including: Supplemental Table S1: Kinase profile for XL147 Supplemental Table S2: Effects of XL147 on PI3K Pathway Signaling in MCF7 and PC-3 Cells Supplemental Table S3: XL147
Supplementary Material
10.1071/CH15728_AC The Authors 2016 Australian Journal of Chemistry 2016, 69(8), 846-855 Supplementary Material Structural Diversity and Properties of Six Zn II /Cd II Coordination Polymers Based on a
IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
St. Gallen 2011 Symposium Highlights in China
May 2011 Shanghai St. Gallen 2011 Symposium Highlights in China Chang Hai Hospital of Shanghai Fudan University Shanghai Cancer Center Guangzhou Sun Yat-Sen University Cancer Center Beijing 307 Hospital
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
Construction of the Vesselcollateral. Guidance for Prevention and Treatment of Vasculopathy. Section 1. China. Clinical Trials.
Section 1 05 Clinical Trials Construction of the Vesselcollateral Theory and its Guidance for Prevention and Treatment of Vasculopathy China Yiling Wu The Integration of Traditional and Western Medical
Staurosporine Tethered Peptide Ligands for camp-dependent Protein Kinase A (PKA): Optimization and Selectivity Profiling
Staurosporine Tethered Peptide Ligands for camp-dependent Protein Kinase A (PKA): Optimization and Selectivity Profiling Carolyn D. Shomin, Scott C. Meyer and Indraneel Ghosh* Supplementary Information
The highlights in the First English Contest of Gastrointestinal Surgery Case (Guangzhou station)
News The highlights in the First English Contest of Gastrointestinal Surgery Case (Guangzhou station) Elva S. Zheng, Skylar Gao Editorial Office of Translational Gastrointestinal Cancer, Guangzhou 510220,
Anti-cancer Effects of Ganoderma Lucidum Triterpenoids. Guo-Sheng Wu. Doctor of Philosophy in Biomedical Sciences
Anti-cancer Effects of Ganoderma Lucidum Triterpenoids by Guo-Sheng Wu Doctor of Philosophy in Biomedical Sciences 2013 Institute of Chinese Medical Sciences University of Macau Anti-cancer Effects of
Appropriate Quality regarde as
A systematic review of antibiotic prescription associated with upper respiratory tract infections in China (Jing Li, MS 1 ) Supplemental Digital Content-Table 1. Quality assessment of included studies
Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429
Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429 Qinglong Guo 1a, Lu Lu 1a, Yan Liao a, Xiaoping Wang a, Yi Zhang a, Yicheng Liu a, Shaoliang
Influence of Starch-inorganic Salt Surface Sizing on the Application Properties of Corrugating Medium
- 266042-8 2 6 g /m 2 76. 3% 80. 0% 82. 5% 74. 7% 72. 6% 80. 9% 13. 1% 14. 3% 15. 6% Cobb 140 g /m 2 30 g /m 2 TS727 +. 5 A 0254-508X 2013 04-0022-05 Influence of Starch-inorganic Salt Surface Sizing on
CURRICULUM VITAE. Professional Employment and Teaching Experience:
CURRICULUM VITAE Name: Current Address: Hong Chen American Academy of Acupuncture and Oriental Medicine 1925 West County Road B2 Roseville, MN 55113 Tel: (651) 631-0204 Fax: (651) 631-0361 E-mail: hongyu1229@hotmail.com
Cancer incidence and patient survival rates among the residents in the Pudong New Area of Shanghai between 2002 and 2006
Chinese Journal of Cancer Original Article Cancer incidence and patient survival rates among the residents in the Pudong New Area of Shanghai between 2002 and 2006 Xiao-Pan Li 1, Guang-Wen Cao 2, Qiao
Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism
Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao
CURRICULUM VITAE Shanshan Zhou. Shanshan Zhou. Department of Cardiology. Tel: Feb 25, 1982, China. Chinese.
CURRICULUM VITAE Shanshan Zhou PERSONAL DETAILS Name: Work address: Shanshan Zhou Department of Cardiology The General Hospital of the People's Liberation Army 28 Fuxing Road, Haidian District, Beijing,
Preliminary Agenda. 9:55-10:20 How to overcome TKI resistance? James Chih-Hsin Yang 10:20-10:40 Discussion All 10:40-10:55 Coffee break
Preliminary Agenda November 7, 2018 14:00-17:00 Registration and check in Satellite Symposia with Dinner 17:00-18:30 Jiangsu Hengrui Medicine Co., Ltd 17:00-18:30 Satellite Symposia with Dinner 17:00-18:30
ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Recommended by ELS! NARROW BAND IMAGING IN ENT Review of Clinical Evidence.
Recommended by ELS! NARROW BAND IMAGING IN ENT Review of Clinical Evidence. 307 HIGH DEFINITION NARROW BAND IMAGING TECHNICAL PRINCIPLE Narrow Band Imaging (NBI) NBI is an optical image enhancement technology
Fundamentals of Traditional Chinese Medicine
Fundamentals of Traditional Chinese Medicine World Century Compendium to TCM Volume 1 Volume 2 Volume 3 Volume 4 Volume 5 Volume 6 Volume 7 Fundamentals of Traditional Chinese Medicine by Hong-zhou Wu,
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 1 Electronic Supplementary Information An electrochemical MIP sensors for selective detection
Report of the 8th Annual International Surgery Forum 2017
News Page 1 of 6 Report of the 8th Annual International Surgery Forum 2017 Tianliu Wang, Jieying Deng Annals of Pancreatic Cancer, AME Publishing Company, Guangzhou 510000, China Correspondence to: Tianliu
RXDX-101 & RXDX-102. Justin Gainor, MD February 20 th, 2014
RXDX-101 & RXDX-102 Justin Gainor, MD February 20 th, 2014 Background Chromosomal fusions are important oncogenic drivers in NSCLC - ALK Rearrangements (4-6%) - ROS1 Rearrangements (1-2%) - RET Rearrangements
Amino acids-incorporated nanoflowers with an
Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*
Howard Temin. Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase.
Howard Temin Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase Nobel prize 1975 Figure 3.6 The Biology of Cancer ( Garland Science 2007)
Content Prioritization And Content Entry and Quality Control Process
Content Prioritization And Content Entry and Quality Control Process The process of data capture begins with the definition of the content module or sub-module to be built (see figure 1). Broadly we define
Objective research on tongue manifestation of patients with eczema
Technology and Health Care 25 (2017) S143 S149 DOI 10.3233/THC-171316 IOS Press S143 Objective research on tongue manifestation of patients with eczema Zhifeng Yu, Haifang Zhang, Linjie Fu and Xiaozuo
An Open-Label Phase Ib/II Study of Sulfatinib in Patients with Advanced Neuroendocrine Tumors (NCT )
An Open-Label Phase Ib/II Study of Sulfatinib in Patients with Advanced Neuroendocrine Tumors (NCT02267967) J.M. Xu a, J. Li b, C.M. Bai c, N. Xu d, Z.W. Zhou e, Z.P. Li f, C.C. Zhou g, W. Wang h, J. Li
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE I
COURSE DESCRIPTION The first of three courses in the Herb Formulae series. These courses can be taken in any order. The Herb Formulae series analyzes the functions, ingredients, and properties of approximately
Pott s kyphosis. University Affiliated Sixth People s Hospital, 600 Yishan Road, Shanghai , P.
QJM Advance Access published November 17, 2014 Pott s kyphosis Author Names: Yi Zhang, Yong-Sheng Yu, Zheng-Hao Tang and Guo-Qing Zang Author Affiliations: Department of Infectious Diseases, Shanghai Jiao
CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.
Self-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells
Supporting Information Self-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells Wei Zhao, Ji-Shi Wei, Peng Zhang, Jie Chen, Ji-Lie Kong,,, * Lian-Hua Sun, Huan-Ming
International Symposium on the Applications of 3-D Printing (Rapid Prototyping) in Orthopaedics
International Symposium on the Applications of 3-D Printing (Rapid Prototyping) in Orthopaedics September 20, 2014 (Saturday) Auditorium, Level 1, Main Clinical Block and Trauma Centre, Prince of Wales
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
SPIE Student Chapter Report Annual report
SPIE Student Chapter Report 2015 Annual report SPIE Student Club Shanghai Institute of Optics and Fine Mechanics September 28, 2015 Shanghai Institute of Optics and Fine Mechanics Chinese Academy of Mechanics
Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome
Supplementary Information Targeted disruption of influenza A virus hemagglutinin in genetically modified mice reduces viral replication and improves disease outcome Song Wang 1#, Chao Chen 1#, Zhou Yang
Ruijin robotic thoracic surgery: S segmentectomy of the left upper lobe
Case Report Page 1 of 5 Ruijin robotic thoracic surgery: S 1+2+3 segmentectomy of the left upper lobe Han Wu, Su Yang, Wei Guo, Runsen Jin, Yajie Zhang, Xingshi Chen, Hailei Du, Dingpei Han, Kai Chen,
A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors
Supplementary Information:- A novel Monoclonal Antibody against Notch1 Targets Leukemiaassociated Mutant Notch1 and Depletes Therapy Resistant Cancer Stem Cells in Solid Tumors Ankur Sharma 1, Rupali A
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
1ME A17R11 WI238 DMS2114 JC L2929 P815 PT67
20 1 2004 1 Chinese Journal of Biotechnology Vol. 20 No. 1 January 2004 3 (, 361005), BacV2CMV2EGFPA,Sf9, 20, 12,7,1 CMV,,,LipofectAMINE CMV EGFP pcdna3112egfp, CMV EGFP, CMV CMV,,,,,, Bac2to2Bac 2, CMV,,,
How to compute a semantic similarity threshold. Charles Bettembourg, Christian Diot, Olivier Dameron
How to compute a semantic similarity threshold Charles Bettembourg, Christian Diot, Olivier Dameron Abstract The analysis of gene annotations related to Gene Ontology plays an important role in the interpretation
CURRICULUM VITAE. Keming Yang, MD, MS
CURRICULUM VITAE Keming Yang, MD, MS Department of Epidemiology Richard M. Fairbanks School of Public Health, Indiana University 1050 Wishard Blvd, RG 5129, Indianapolis, IN 46202-2872. Email: kemyang@iu.edu
Avian Influenza A(H7N9) 13 February 2014 Surveillance Update
Avian Influenza A(H7N9) 13 February 2014 Surveillance Update Summary The WHO has reported 337 human infections including 66 deaths with onset since February 2013. There are still no signs of ongoing, efficient,
Protein tyrosine kinase signaling
rotein tyrosine kinase signaling Serge ROCHE CRBM CNRS/Montpellier University serge.roche@crbm.cnrs.fr rotein phosphorylation on Tyr A central mechanism to control cell communication in a multicellular
CANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population H.B. Gui 1, X.G. Du 2, Z.H. Fu 3 and X.M. Chen 1 1 Department of Emergency, The First Affiliated
Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population
Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population Tao Wang #, Xiaojing Ma #, Danfeng Peng, Rong Zhang, Xue Sun, Miao Chen, Jing Yan, Shiyun
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
Maastricht Ⅴ /Florence
2016 21 10 577 Maastricht Ⅴ /Florence 200001 2015 10 8 9 Maastricht V 1 / 2 3 4 / 5 Maastricht Ⅴ Interpretation of Management of Helicobacter pylori Infection the Maastricht Ⅴ / Florence Consensus Report
Mechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
Novel EGFR TKI Theliatinib: An Open Label, Dose Escalation Phase I Clinical Trial
Novel EGFR TKI Theliatinib: An Open Label, Dose Escalation Phase I Clinical Trial 2014-309-00CH1 Presenter: Jifang Gong, Beijing Cancer Hospital Lin Shen 1, Li Zhang 2, Hongyun Zhao 2, Wenfeng Fang 2,
Supporting Information
Supporting Information A new series of cytotoxic pyrazoline derivatives as potential anticancer agents induces cell cycle arrest and apoptosis Hong Wang 1,, Jinhong Zheng 1,, Weijie Xu 1, Cheng Chen 1,
50 nmoles substrate. 8,000 Test Points based on 100 nm in reaction
Product Insert IMAP Substrates About the IMAP Substrates To facilitate the customization of the IMAP assay to fit your specific needs, Molecular Devices offers a wide range of validated substrates and
AMCEN LAB SDN BHD ( W) No.18, Lorong Talang 9, Perai, Penang. Tel: Fax:
CUSTOMERS VENTURE SDN BHD Certificate No : AMC/nU1604/033 Lots.3A.010 & 3A.009 & 3A.011 & 3A.015, Sample Log Code : nu1604/022 4th Floor,Endah Parade, Sample Received Date : 19-Apr-2016 No.1,Jalan 1/149E,Taman
POSITION TITLE Professor. DEGREE (if applicable)
NAME Wang, Tong era COMMONS USER NAME TOWANG BIOGRAPHICAL SKETCH Provide the following information for the key personnel and other significant contributors in the order listed on Form Page 2. Follow this
Short Report Clinical outcomes of EGFR kinase domain duplication to targeted therapies in NSCLC
IJC Short Report Clinical outcomes of EGFR kinase domain duplication to targeted therapies in NSCLC International Journal of Cancer Jinguang Wang 1, Xingya Li 2, Xingyang Xue 3, Qiuxiang Ou Yang W. Shao
Supplementary information
Supplementary information Network Meta-Analysis of The Effectiveness of Neoadjuvant Endocrine Therapy for postmenopausal, HR Positive Breast Cancer Wei Wang 1*, Chenghao Liu *, Wenbin Zhou 1, Tiansong
DeSigN: connecting gene expression with therapeutics for drug repurposing and development. Bernard lee GIW 2016, Shanghai 8 October 2016
DeSigN: connecting gene expression with therapeutics for drug repurposing and development Bernard lee GIW 2016, Shanghai 8 October 2016 1 Motivation Average cost: USD 1.8 to 2.6 billion ~2% Attrition rate
Surface-Enhanced Raman Scattering Active Gold Nanoparticles. with Enzyme-Mimicking Activities for Measuring Glucose and
Surface-Enhanced Raman Scattering Active Gold Nanoparticles with Enzyme-Mimicking Activities for Measuring Glucose and Lactate in Living Tissues Yihui Hu, Hanjun Cheng, Xiaozhi Zhao, Jiangjiexing Wu, Faheem
Robotic-assisted McKeown esophagectomy
Case Report Page 1 of 8 Robotic-assisted McKeown esophagectomy Dingpei Han, Su Yang, Wei Guo, Runsen Jin, Yajie Zhang, Xingshi Chen, Han Wu, Hailei Du, Kai Chen, Jie Xiang, Hecheng Li Department of Thoracic
A highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae
Electronic Supporting Information highly selective IE fluorogen for lipid droplet imaging in live cells and green algae Erjing Wang, ab Engui Zhao, ab Yuning Hong, ab Jacky W. Y. Lam, ab and en Zhong Tang*
Prostate Disease A Pass By TANG QIAN LI ZHU BIAN
Prostate Disease A Pass By TANG QIAN LI ZHU BIAN Oxytocin and the Human Prostate in Health and - and PSA is then able to pass into the proliferation within the normal prostate. 4.4. Oxytocin and prostate
Supplementary Data Figure S1. A) PKI-587 suppression of p-akt in A498 and (+/- 10
Supplementary Data Figure S1. A) PKI-587 suppression of p-akt in A498 and 786-0 (+/- 10 μm Verapamil), and B) PKI-587 suppression of p-akt in BT474, & U87MG. 3 1 0.3 0.1 0.03 0 [μm] A) 786-0 - + p-akt
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
Joint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information MnO 2 -induced synthesis of fluorescent polydopamine nanparticles