Organochloride pesticides impaired mitochondrial function in hepatocytes and. aggravated disorders of fatty acids metabolism
|
|
|
- Claud Lamb
- 5 years ago
- Views:
Transcription
1 Supplementary Materials Organochloride pesticides impaired mitochondrial function in hepatocytes and aggravated disorders of fatty acids metabolism Qian Liu 1,2,3*, Qihan Wang 4*, Cheng Xu 2,3, Wentao Shao 2,3, Chunlan Zhang 2,3, Hui Liu 2,3, Zhaoyan Jiang 1,4, Aihua Gu 2,3 1 Center of Gallbladder Disease, Shanghai East Hospital, Institution of Gallstone Disease, Tongji University School of Medicine, Shanghai, China, State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing, China 3 Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing, China 4 Department of Surgery, Shanghai Institute of Digestive Surgery, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China, * These authors contributed equally to this study and all should be considered as first authors. Corresponding authors: Aihua Gu: aihuagu@njmu.edu.cn Zhao-Yan Jiang: zhaoyanjiang@gmail.com
2 Supplement Table 1. Sequences of primers for RT-PCR. Supplement Table 2. Effect of p,p -DDE and β-hch on serum biochemical Supplement Table 3. Metabolomic analysis of liver tissues from mouse exposed to OCPs Supplementary Figure Legends Figure S1 Changes in body weight among treatment groups (n=8/group). Figure S2 Cell viability was analyzed after 24 h exposure to different concentrations of p, p -DDE (A) and β-hch (B). The results were expressed as a ratio relative to controls and presented as mean ± SEM of six independent experiments.
3 Supplement Table 1. Sequences of primers for RT-PCR. Gene Mouse-Acc F Mouse-Acc R Mouse-Fas F Mouse-Fas R Mouse-Scd1 F Mouse-Scd1 R Mouse-Cpt1α F Mouse-Cpt1α R Mouse-Acox1 F Mouse-Acox1 R Mouse-Scad F Mouse-Scad R Mouse-Mcad F Mouse-Mcad R Mouse-Lcad F Mouse-Lcad R Mouse-GAPDH F Mouse-GAPDH R Human-CPT1α F Human-CPT1α R Human-SCAD F Human-SCAD R Human-MCAD F Human-MCAD R Human-LCAD F Human-LCAD R Human-GAPDH F Human-GAPDH R Sequences GCCGTGGGGAAGGAAAAGT GTGGCTAGGTACTGAACAAAGAG TATCAAGGAGGCCCATTTTGC TGTTTCCACTTCTAAACCATGCT TTCTTGCGATACACTCTGGTGC CGGGATTGAATGTTCTTGTCGT ACGTTGGACGAATCGGAACA GGTGGCCATGACATACTCCC CCGTCGAGAAATCGAGAACT ATTGAGGCCAACAGGTTCCA ATGTGCCAGAGGAGCTGAGT TGATCCACTGTTGCTTCTGC AACTAAACATGGGCCAGCGA CAGCTGCGACTGTAGGTCTG GCATCAACATCGCAGAGAAA ACGCTTGCTCTTCCCAAGTA AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA ATCAATCGGACTCTGGAAACGG TCAGGGAGTAGCGCATGGT CGGCAGTTACACACCATCTAC GCAATGGGAAACAACTCCTTCTC GGAAGCACATACCCCAGGAAT AGCTCCGTCACCAATTAAAACAT TGCAATAGCAATGACAGAGCC CGCAACTACAATCACAACATCAC TGACAACTTTGGTATCGTGGAAGG AGGCAGGGATGATGTTCTGGAGAG F: forward; R: reverse
4 Supplement Table 2. Effect of p,p -DDE and β-hch on serum biochemical Index Control p,p'-dde β-hch ALT (U/L) 38.6± ± ±5.8 AST (U/L) 78.9± ± ±8.6 TP (g/l) 56.9± ± ±0.7 ALB (g/l) 38.3± ± ±0.7 TBIL (umol/l) 1.9± ± ±1.1 ALP (U/L) 90.0± ± ±6.1 GLU (mmol/l) 11.0± ± ±0.5 BUN (mmol/l) 9.9± ± ±0.6 CREA (umol/l) 9.0± ± ±1.4 CHOL (mmol/l) 3.1± ± ±0.1 TG (mmol/l) 0.8± ± ±0.1 HDL-C (mmol/l) 2.5± ± ±0.1 LDL-C (mmol/l) 0.1± ± ±0.02 GLOB (g/l) 18.7± ± ±0.3* parameters (mean ± SEM, n = 8/group). Significance indicated by: *p < 0.05 compared with the control group.
5 Supplement Table 3. Metabolomics analysis of liver tissues from mouse exposed to OCPs Metabolites RT mass Metabolic pathway Fold changes (DDE/Ctrl) Fold changes (DDE/Ctrl) Cinnamic acid Amino acids metabolism Xanthurenic acid Tryptophan metabolism Sphinganine Sphingolipid metabolites Phenylpyruvic acid Phenylalanine metabolism PG(P-16:0/14:1(9Z)) Phospholipids metabolism PE(18:1(9Z)/0:0) Phospholipids metabolism PE(18:0/0:0) Phospholipids metabolism PC(O-18:0/0:0) Phospholipids metabolism PC(8:0/7:0)[ Phospholipids metabolism PC(14:0/0:0) Phospholipids metabolism Palmitic amide Fatty acid metabolism PA(22:1(11Z)/0:0) Phospholipids metabolism PA(20:1(11Z)/0:0) Phospholipids metabolism Homocysteine Amino acids metabolism Histidine Amino acids metabolism Uric acid Purine metabolism PI(18:1(9Z)/0:0) Phospholipids metabolism Phenylalanine Amino acids metabolism Glucose 6-phosphate Glucose metabolism Xanthurenic acid Tryptophan metabolism Xanthine Purine metabolism PS(19:0/0:0) Phospholipids metabolism PG(18:1(9Z)/0:0) Phospholipids metabolism Glucose Glucose metabolism PI(16:0/0:0) Phospholipids metabolism
6 Figure S1
7 Figure S2
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan
Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
VITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
The role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
Controls & Calibrators Clinical Chemistry
Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same
Age-related reference ranges
Authoriser: Peter Beresford Page 1 of 6 Age-related reference ranges Alkaline Phosphatase (ALP) IU/L Both less than 14 days 90 273 Both 14 days
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Supporting information
Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction
Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health
Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive
SITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
Amino acids-incorporated nanoflowers with an
Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*
ALKA VITA DIABETES TEST
ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone
Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing
An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection
Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang
ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
Evaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
The Whats and Hows of Reference Intervals. Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney
The Whats and Hows of Reference Intervals Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney Surabaya Indonesia 2016 Acknowledgements Reference Intervals - Summary What are they
Supplementary material
Supplementary material Comprehensive Characterization and Evaluation for Hepatocellular Carcinoma by LC-MS based Serum Metabolomics Journal: Metabolomics Xin Lu 1,3, Huan Nie 1, Yiqun Li 1, Chao Zhan 2,
Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China. Testing Report
Ministry Health approved Natural Health Products Testing Agency Issued by: Public Health Inspections, Ministry Health (1996) Publication # 53 Nutrition and Foods Safety Agency the Centre for Disease Prevention
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT
Supplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
SUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 2 ARTICLE NUMBER: 17084 Metabolic anticipation in Mycobacterium tuberculosis Hyungjin Eoh, Zhe Wang, Emilie Layre,
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,
Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
Abaxis Piccolo xpress TM
Abaxis Piccolo xpress TM A breakthrough in point-of care diagnostics A breakthrough in point of care diagnostics Fast, easy, accurate on-site testing The Piccolo xpress TM is a fully automated system,
Supplementary Information
Supplementary Information Metabolomics reveals trichloroacetate as a major contributor to trichloroethylene-induced metabolic alterations in mouse urine and serum Zhong-Ze Fang, Kristopher W Krausz, Naoki
Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS
SUPPLEMENTARY MATERIALS Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS Zhiqiang Pang 1, Guoqiang Wang 1, Nan Ran 1, Hongqiang
Supplementary Information. for
Supplementary Information for Serum Metabolomics to Identify the Liver Disease-Specific Biomarkers for the Progression of Hepatitis to Hepatocellular Carcinoma Rong Gao, 1 Jianhua Cheng, 1 Chunlei Fan
Roche/Hitachi - PreciControl ClinChem Multi 2
ATRYP Antitrypsin alpha 1 ERM-DA470k/IFCC 9 136 1.36 1.84 0.0184 GPROT Acid glycoprotein alpha 1 CRM 470 2 90.1 0.901 0.890 0.00890 ACP Acid phosphatase total 1-naphthyl phosphate 0.720 43.1 0.00703 0.421
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
TRACEABILITY and UNCERTAINTY
ACP Acid phosphatase total 1-naphthyl phosphate NPP Acid phosphatase, non-prostatic 1-naphthyl phosphate (Inhib.:tartrate) ACP-P Acid phosphatase, prostatic 1-naphthyl phosphate (Inhib.:tartrate) ALB Albumin
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
TRACEABILITY and UNCERTAINTY
Cat. No. 0 79 0 90 ACP Acid phosphatase total -naphthyl phosphate NPP Acid phosphatase, non-prostatic -naphthyl phosphate (Inhib.:tartrate) ALB Albumin BCG plus ALB Albumin BCP ALP Alkaline phosphatase
Impact of Proposed HRI s on Laboratory Report Flagging Rates
Impact of Proposed HRI s on Laboratory Report Flagging Rates A/Prof. Ken Sikaris Melbourne Pathology BSc(Hons), MBBS, FRCPA, FAACB, FFSc CBN 2011 WORKSHOP 2012 WORKSHOP 2013 WORKSHOP 2014 GENERAL CONCEPTS
Coping with Analytical Interferences
Coping with Analytical Interferences (Handling Icteric, Hemolytic and Lipaemic Samples) Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney Surabaya Indonesia 2016 Acknowledgements
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
Organochloride pesticides induced hepatic ABCG5/G8 expression and lipogenesis in Chinese patients with gallstone disease
/, Vol. 7, No. 23 Organochloride pesticides induced hepatic ABCG5/G8 expression and lipogenesis in Chinese patients with gallstone disease Guixiang Ji 1,4,*, Cheng Xu 2,3,*, Haidong Sun 5,*, Qian Liu 2,3,
Supplementary Table 1. Patient demographics and baseline characteristics (treated patients).
Supplementary Table 1. Patient demographics and baseline characteristics (treated patients). Placebo (n=188) 10 mg (n=186) 25 mg (n=189) Total (n=563) Gender, n (%) Male 75 (40) 97 (52) 84 (44) 256 (45)
Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in
Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for High-Efficiency Tracking Orthotopic Colorectal Tumor in Mouse Hongda Chen, a,c Xiaodong Li, b Fuyao Liu, a Huimao
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Loss of protein association causes cardiolipin degradation in Barth syndrome
SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas
Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic
Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li
Association between schizophrenia and syphilis: a retrospective study in Xiamen, China
Zhang and Xie BMC Psychiatry (2018) 18:273 https://doi.org/10.1186/s12888-018-1869-6 RESEARCH ARTICLE Open Access Association between schizophrenia and syphilis: a retrospective study in Xiamen, China
Fatty acids and phospholipids
PYS 4xx Intro 2 1 PYS 4xx Intro 2 - Molecular building blocks We now describe in more detail the nomenclature and composition of several classes of compounds of relevance to the cell, including: membrane
Application of LC-MS-based metabolomics method in differentiating septic survivors from non-survivors
Analytical and Bioanalytical Chemistry Electronic Supplementary Material Application of LC-MS-based metabolomics method in differentiating septic survivors from non-survivors Zhicheng Liu, Peiyuan Yin,
HEP DART 2017, Kona, Hawaii
HEP DART 2017, Kona, Hawaii Rong Yu 1, Ke Xu 1, Jing Li 1, Tong Sun 1, Shengjiang Zhang 2, Jinhua Shao 2, Jin Sun 2, Qiong He 3, Jianwen Luo 3, Cheng Wang 4, Yudong Wang 4, Jing Chen 4, Vanessa Wu 4, George
Metabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Pattern of lipid biomarkers and risk of cardiovascular disease
Pattern of lipid biomarkers and risk of cardiovascular disease Robert Clarke Clinical Trial Service Unit University of Oxford 9 January 2017 Biomarkers for dietary fats Blood lipids (LDL, HDL, triglycerides,
BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
Supplementary Information. Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a
Supplementary Information Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a High-throughput Targeted Metabolomics Approach Nanyang Yu, Si Wei, *, Meiying Li, Jingping
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a
Supporting information for Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based Metabolomics and Serum Amino Acid Profiles in Obese Women from a Randomized Controlled Study Shanshan
Harmonisation of Reference Ranges
Harmonisation of Reference Ranges Ken Sikaris BSc(Hons), MBBS, FRCPA, FAACB, FFSc Vice President, AACB (Education) Chemical Pathologist, Melbourne Pathology Director of Clinical Support Systems, Sonic
Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
Supplementary Information. Targeting BRK-positive Breast Cancer with Small
Supplementary Information Targeting BRK-positive Breast Cancer with Small Molecule Kinase Inhibitors Jie Jiang 1#, Fu Gui 1#, Zhixiang He 1#, Li Li 1, Yunzhan Li 1, Shunying Li 2, Xinrui Wu 1, Zhou Deng
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,
Supplemental material Supplemental method RNA extraction, reverse transcription, and real-time PCR The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
The effect of heavy metals in the water source on selected biochemical indices in European mouflon (Ovis musimon L.) from a game reserve
ACTA VET. BRNO 2017, 86: 45 49; https://doi.org/10.2754/avb201786010045 The effect of heavy metals in the water source on selected biochemical indices in European mouflon (Ovis musimon L.) from a game
Special issue: Six Sigma metrics Original papers
Special issue: Six Sigma metrics Original papers Risk analysis and assessment based on Sigma metrics and intended use Yong Xia 1, Hao Xue 1, Cunliang Yan 1, Bowen Li 2, ShuQiong Zhang 1, Mingyang Li 1,
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Beijing , China. 4 Department of Surgery, Third Affiliated Hospital of Peking University, Beijing , China. *Corresponding author:
Title:Eplerenone restores -h blood pressure circadian rhythm and reduces advanced glycation end-products in rhesus macaques with spontaneous hypertensive metabolic syndrome Yan Zhang,,Wen Zheng,, Yuli
AAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao
Effects of a purified, omega-3 rich krill oil phospholipid on cardiovascular disease risk factors and fatty acid composition of erythrocyte membranes in non-human primates AAOCS 10 th Biennial Conference
GI DISEASE WORKSHOP CASE STUDIES
GI DISEASE WORKSHOP CASE STUDIES American Academy of Insurance Medicine Triennial Course in Insurance Medicine 2012 Clifton Titcomb Jr., MD (Hannover Re) James Topic, MD (Protective Life) 1 CASE #1 Application
Implications from and for food cultures for cardiovascular disease: diet, nutrition and cardiovascular diseases in China
146 Asia Pacific J Clin Nutr (2001) 10(2): 146 152 Thematic Article Implications from and for food cultures for cardiovascular disease: diet, nutrition and cardiovascular diseases in China Wenhua Zhao
Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity
Supporting Information Design of LVFFARK and LVFFARK-Functionalized Nanoparticles for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Neng Xiong, Xiao-Yan Dong, Jie Zheng, Fu-Feng Liu, * and
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
Original Article Protective effects of panaxadiolsaponins on liver and kidney injury in rats with severe acute pancreatitis
Int J Clin Exp Med 2016;9(7):12811-12817 www.ijcem.com /ISSN:1940-5901/IJCEM0018697 Original Article Protective effects of panaxadiolsaponins on liver and kidney injury in rats with severe acute pancreatitis
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2