Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population
|
|
- Ginger Loreen Jenkins
- 5 years ago
- Views:
Transcription
1 Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population Tao Wang #, Xiaojing Ma #, Danfeng Peng, Rong Zhang, Xue Sun, Miao Chen, Jing Yan, Shiyun Wang, Dandan Yan, Zhen He, Feng Jiang, Yuqian Bao, Cheng Hu, * & Weiping Jia *. Shanghai Diabetes Institute, Shanghai Key Laboratory of Diabetes Mellitus, Shanghai Clinical Center for Diabetes, Shanghai Jiao Tong University Affiliated Sixth People s Hospital, Shanghai,, China. Institute for Metabolic Diseases, Shanghai Jiao Tong University Affiliated Sixth People s Hospital South Campus, Shanghai,, China Tao Wang and Xiaojing Ma contributed equally to this article. Corresponding authors: Cheng Hu and Weiping Jia Shanghai Diabetes Institute, Shanghai Jiao Tong University Affiliated Sixth People s Hospital, Yishan Road, Shanghai,, China s: Cheng Hu (alfredhc@sjtu.edu.cn) Weiping Jia (wpjia@sjtu.edu.cn) Tel: + Fax:--
2 Supplemental Table Characteristics of established SNPs Supplemental Tables SNP Gene Chr Position Minor/ Major allele MAF Traits First Reference Risk Reported Power Author allele beta (%) rs NEGR G/A. BMI Thorleifsson A. rs TNNIK C/T. BMI Speliotes A. rs PTBP A/C. BMI Speliotes C. rs TBX-WARS C/G. WHR Heid G. rs PIGC-DNM C/T. WHR Heid G. rs SECB T/G. BMI Thorleifsson T. rs LYPLAL T/G. WHR Heid G. rs LYPLAL - - VFA/SFA Fox A NR - rs TMEM T/C. BMI Willer C. rs TRIB T/A. VFA Nakayama T. rs RBJ C/T. BMI Speliotes C. rs FANCL A/G. BMI Speliotes T. rs THNSL G/A. VFA Fox A NR - rs GRB-COBLL C/T. WHR Heid T. rs IRS C/T. body fat percentage Kilpelainen T. rs PPARG G/C. WHR Randal C. rs ITIH-AS C/G. BMI Wen G. rs ETV T/C. BMI Thorleifsson C. rs GNPDA G/A. BMI Willer G. rs MAPK G/A. WC Randal G.
3 rs POC T/G. BMI Speliotes T. rs HSDB A/T. WHR Randal A. rs CPEB A/G. WHR Heid A. rs RREB T/C. WHR Liu T. rs CDKAL C/T. BMI Wen T. rs CASC /PRL G/A. extreme obesity Meyre A. - rs NUDT A/G. BMI Speliotes G. rs VEGFA G/A. WHR Heid A. rs TFAPB G/A. BMI Speliotes G. rs NFEL A/G. WHR Heid T. rs MIRA A/C. BMI Monda C. rs MSRA C/G. WC Lindgren G. rs LRRNC-LINGO G/A. BMI Speliotes G. rs KLF C/A. BMI Okada C. rs LHX A/G. WC Liu C. rs NTC C/T. BMI Wen C. rs RPLA T/C. BMI Speliotes C. rs BDNF A/G. BMI Thorleifsson G. rs MTCH T/C. BMI Speliotes T. rs FAIM A/G. BMI Thorleifsson A. rs HOXC A/C. WHR Heid A. rs ALDH A/G. BMI Wen G. rs ALDH-HECTD T/C. WHR Cho C. rs MTIF G/A. BMI Speliotes G. rs OLFM A/G. extreme obesity Bradfield A. - rs SPRY G/A. body fat Kilpelainen A.
4 percentage rs NRXN G/A. WC Heard-Costa G. rs GP T/C. BMI Wen C. rs SHB A/G. BMI Thorleifsson A. rs FTO A/T. BMI Frayling A. rs MAF G/A. extreme obesity Meyre A. - rs NPC G/A. extreme obesity Meyre A. - rs MCR C/T. BMI Loos C. rs KCTD C/T. BMI Thorleifsson C. rs QPCTL T/C. BMI Speliotes C. rs TMEM A/G. BMI Speliotes A. rs ZNRF A/G. WHR Heid A. SNP, single nucleotide polymorphism; Chr, chromosome; MAF, minor allele frequency in our sample of Chinese; WC, waist circumference; WHR, waist to hip ratio; VFA/SFA, the ratio of visceral fat to subcutaneous fat. NR, not reported. The allele that increased level of traits is denoted as risk allele.
5 Supplemental Table Gender differences in how the variants influence fat distribution irrespective of BMI SNP Gene Alleles MAF Traits Males Females P for BETA±SE P BETA±SE P interaction rs PIGC-DNM C/T. VFA.±.. -.±... SFA.±.. -.±... VFA/SFA.±.. -.±... rs SECB T/G. VFA.±...±... SFA.±...±... VFA/SFA.±...±... rs LYPLAL T/G. VFA -.±...±... SFA -.±...±.. b. VFA/SFA -.±.. -.±... rs TMEM T/C. VFA -.±.. -.±... SFA -.±.. -.±... VFA/SFA.±...±... rs RBJ C/T. VFA.±...±... SFA.±...±... VFA/SFA.±...±... rs PPARG G/C. VFA.±...±... SFA.±.. -.±... VFA/SFA -.±...±... rs ETV T/C. VFA -.±.. -.±... SFA -.±.. -.±... VFA/SFA -.±.. -.±... rs CPEB A/G. VFA.±.. -.±... SFA.±...±...
6 VFA/SFA.±.. -.±... rs NUDT A/G. VFA -.±.. -.±... SFA -.±.. -.±... VFA/SFA.±...±... rs TFAPB G/A. VFA.±...±... SFA.±...±... VFA/SFA.±.. -.±... rs NFEL A/G. VFA.±...±... SFA -.±...±... VFA/SFA.±...±... rs MIRA A/C. VFA -.±...±... SFA -.±...±... VFA/SFA.±...±... rs LHX A/G. VFA -.±.. -.±... SFA -.±.. -.±... VFA/SFA.±.. -.±... rs ALDH A/G. VFA -.±.. -a -.±... - SFA -.±.. -.±... VFA/SFA -.±.. -a.±... - rs SPRY G/A. VFA.±...±... SFA -.±...±... VFA/SFA.±.. -.±... rs MCR C/T. VFA.±...±.. -c. SFA.±...±... VFA/SFA -.±...±... rs ZNRF A/G. VFA -.±.. -.±...
7 SFA -.±.. -.±... VFA/SFA -.±...±... SNP, single nucleotide polymorphism; Alleles, minor/major alleles; MAF, minor allele frequency; SE, standard error; VFA, visceral fat area; SFA, subcutaneous fat area; VFA/SFA, the ratio of visceral fat to subcutaneous fat. Only SNPs that showed nominal significant associations with traits are shown in Supplemental Table. P values<. are shown in bold. Traits were adjusted for age in the additive genetic model. a Empirical P= -, b Empirical P=., c Empirical P=.; Empirical P values were based on permutations within each trait.
8 Supplementary Figure legend Supplementary Figure.Linkage disequilibrium map for each of the regions in the Chinese populations. Shades of red demonstrate the strength of the pairwise linkage disequilibrium based on r and number shown is r of each SNP pair expressed as a percentage. The SNPs tested in our study are marked with red blox. rs in FANCL is not included for minor alelle frequency (MAF= in Hapmap data) in Chinese populations. rs in LYPALl, rs in CASC and rs in RPLA are substuted with another SNPs (r >.) in same region. The SNPs in the same region (e.g., rs and rs in ALDH and rs and rs in LYPLA) are shown in one map.
9 Block ( kb) / / / file:///d:/ie/grb-cobll.svg / / / / file:///d:/ie/tmem.txt.svg file:///d:/ie/trib.svg // // // // file:///d:/ie/lyplal.svg Block ( kb) / // // file:///d:/ie/ptbp.svg // file:///d:/ie/tbx-wars.svg file:///d:/ie/tnnik.txt.svg // / file:///d:/ie/secb.svg file:///d:/ie/negr.svg file:///d:/ie/pigc-dnm.svg / Block ( kb) Block ( kb) / / Block ( kb) / / Block ( kb) Block ( kb) / / / Block ( kb) Block ( kb) / Block ( kb) / Block ( kb) / file:///d:/ie/pparg.svg // Block ( kb) / // / / / file:///d:/ie/mapk.svg file:///d:/ie/thnsl.txt.svg // file:///d:/ie/itih-as.svg // file:///d:/ie/etv.svg file:///d:/ie/rbj.svg file:///d:/ie/irs.svg Block ( kb) Block ( kb) // Block ( kb) Block ( kb) file:///d:/ie/rreb.svg / / // // file:///d:/ie/vegfa.svg Block ( kb) Block ( kb) / / // file:///d:/ie/cdkal.svg Block ( kb) Block ( kb) // // file:///d:/ie/nudt.svg // file:///d:/ie/casc.svg // file:///d:/ie/mira.svg file:///d:/ie/rpla.svg / // / // // / / / // file:///d:/ie/lhx.svg // // / file:///d:/ie/lrrnc-lingo.svg file:///d:/ie/klf.svg file:///d:/ie/aldh.svg // // / file:///d:/ie/msra.svg file:///d:/ie/bdnf.svg Block ( kb) file:///d:/ie/ntc.svg file:///d:/ie/nfel.svg // file:///d:/ie/tfapb.svg / Block ( kb) / // file:///d:/ie/hsdb.svg / file:///d:/ie/cpeb.svg Block ( kb) / / file:///d:/ie/poc.svg // // Block ( kb) / // file:///d:/ie/gnpda.svg Block ( kb) file:///d:/ie/mtif.svg Block ( kb) // file:///d:/ie/gp.svg Block ( kb) Block ( kb) file:///d:/ie/nrxn.svg Block ( kb) //
Dr. Claude Bouchard. John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University
Dr. Claude Bouchard John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University 2014 SEC Symposium A GENETIC PREDISPOSITION IS AMONG THE DRIVERS OF THE OBESITY EPIDEMIC: IMPLICATIONS
More informationGeneralization of adiposity genetic loci to US Hispanic women
Generalization of adiposity genetic loci to US Hispanic women The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published
More informationThe Genetic Basis of Obesity
The Genetic Basis of Obesity Kaitlin Samocha Wikimedia user: GAThrawn22 DNA and Genes cell DNA gene protein AGCTACCGTTATCCAATGCGCGAGCTATTA A C G T Wikimedia users: Mikael Häggström, GAThrawn22, cacycle
More informationGenome-Wide Association for Abdominal Subcutaneous and Visceral Adipose Reveals a Novel Locus for Visceral Fat in Women
Genome-Wide Association for Abdominal Subcutaneous and Visceral Adipose Reveals a Novel Locus for Visceral Fat in Women Caroline S. Fox 1,2,3. *, Yongmei Liu 4. *, Charles C. White 1,5, Mary Feitosa 6,
More informationSUPPLEMENTARY INFORMATION
Genetic variation near IRS1 associates with reduced adiposity and an impaired metabolic profile Tuomas O Kilpeläinen, M Carola Zillikens, Alena Stančáková, Francis M Finucane, Janina S Ried et al.* * A
More informationSupplementary Online Content
Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published
More informationSupplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
More informationGenetic predisposition to obesity leads to increased risk of type 2 diabetes
Diabetologia (2011) 54:776 782 DOI 10.1007/s00125-011-2044-5 ARTICLE Genetic predisposition to obesity leads to increased risk of type 2 diabetes S. Li & J. H. Zhao & J. Luan & C. Langenberg & R. N. Luben
More informationARTICLE. Diabetologia (2012) 55: DOI /s
Diabetologia (2012) 55:105 113 DOI 10.1007/s00125-011-2320-4 ARTICLE Association studies of novel obesity-related gene variants with quantitative metabolic phenotypes in a population-based sample of 6,039
More informationBest Practice & Research Clinical Endocrinology & Metabolism
Best Practice & Research Clinical Endocrinology & Metabolism 26 (2012) 211 226 Contents lists available at SciVerse ScienceDirect Best Practice & Research Clinical Endocrinology & Metabolism journal homepage:
More informationSponsored Document Sponsored Document Sponsored Document
Sponsored document from Maturitas Genetics and epigenetics of obesity Blanca M. Herrera a, Sarah Keildson a, and Cecilia M. Lindgren a,b, a Wellcome Trust Centre for Human Genetics, University of Oxford,
More informationNIH Public Access Author Manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2013 December 01.
NIH Public Access Author Manuscript Published in final edited form as: Obesity (Silver Spring). 2013 June ; 21(6): 1256 1260. doi:10.1002/oby.20319. Obesity-susceptibility loci and the tails of the pediatric
More informationSupplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region
More informationGenome-Wide Population-Based Association Study of Extremely Overweight Young Adults The GOYA Study
Genome-Wide Population-Based Association Study of Extremely Overweight Young Adults The GOYA Study Lavinia Paternoster 1,2 *, David M. Evans 1,2, Ellen Aagaard Nohr 3, Claus Holst 4, Valerie Gaborieau
More informationGenome-wide association study identifies susceptibility loci for polycystic ovary. syndrome on chromosome 2p16.3, 2p21 and 9q33.3
Genome-wide association study identifies susceptibility loci for polycystic ovary syndrome on chromosome 2p16.3, 2p21 and 9q33.3 Supplementary Materials Zi-Jiang Chen 1,2 *, Han Zhao 1,2,25, Lin He 3,4,5,25,
More informationType 2 diabetes, though poorly understood, is known to be a disease
Review article Genomic Medicine W. Gregory Feero, M.D., Ph.D., and Alan E. Guttmacher, M.D., Editors Genomics, Type 2 Diabetes, and Obesity Mark I. McCarthy, M.D. Type 2 diabetes, though poorly understood,
More informationContribution of 32 GWAS-Identified Common Variants to Severe Obesity in European Adults Referred for Bariatric Surgery
Contribution of 32 GWAS-Identified Common Variants to Severe Obesity in European Adults Referred for Bariatric Surgery Reedik Mägi 1,2., Sean Manning 3,4,5., Ahmed Yousseif 3, Andrea Pucci 3,6, Ferruccio
More informationHeritability and genetic correlations explained by common SNPs for MetS traits. Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK
Heritability and genetic correlations explained by common SNPs for MetS traits Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK The Genomewide Association Study. Manolio TA. N Engl J Med 2010;363:166-176.
More informationAssociation of variations in the FTO, SCG3 and MTMR9 genes with metabolic syndrome in a Japanese population
(2011) 56, 647 651 & 2011 The Japan Society of Human Genetics All rights reserved 1434-5161/11 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Association of variations in the FTO, SCG3 and MTMR9 genes with
More informationGenetic susceptibility to type 2 diabetes and obesity: from genome-wide association studies to rare variants and beyond
Diabetologia (2014) 57:1528 1541 DOI 10.1007/s00125-014-3270-4 REVIEW Genetic susceptibility to type 2 diabetes and obesity: from genome-wide association studies to rare variants and beyond Niels Grarup
More informationGenome-Wide Association of BMI in African Americans
nature publishing group Genome-Wide Association of BMI in African Americans Maggie C.Y. Ng 1,2, Jessica M. Hester 1 3, Maria R. Wing 1 3, Jiang Li 1,2, Jianzhao Xu 1,2, Pamela J. Hicks 1,2,4, Bong H. Roh
More informationObesity-Susceptibility Loci and Their Influence on Adiposity-Related Traits in Transition from Adolescence to Adulthood - The HUNT Study
Obesity-Susceptibility Loci and Their Influence on Adiposity-Related Traits in Transition from Adolescence to Adulthood - The HUNT Study Koenraad Frans Cuypers 1 *, Ruth J. F. Loos 2,3, Kirsti Kvaløy 1,
More informationLetter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *
814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,
More informationFTO gene variants are strongly associated with type 2 diabetes in South Asian Indians
Diabetologia (2009) 52:247 252 DOI 10.1007/s00125-008-1186-6 SHORT COMMUNICATION FTO gene variants are strongly associated with type 2 diabetes in South Asian Indians C. S. Yajnik & C. S. Janipalli & S.
More informationGenome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54
CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects
More informationAssociation analyses of 249,796 individuals reveal 18 new loci associated with body mass index
Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index 21 Nature America, Inc. All rights reserved. Obesity is globally prevalent and highly heritable, but its underlying
More informationCombining UK Biobank genetics and MRI imaging data to identify genetic factors associated with higher body fat % but lower risk of diabetes.
Combining genetics and MRI imaging data to identify genetic factors associated with higher body fat % but lower risk of diabetes. Hanieh Yaghootkar Diabetes UK RD Lawrence Fellow 21 June 2018 meeting -
More informationCarrying more favourable adiposity gene7c factors is associated with higher adiposity but lower ectopic fat and lower risk of type 2 diabetes.
Carrying more favourable adiposity gene7c factors is associated with higher adiposity but lower ectopic fat and lower risk of type 2 diabetes. Hanieh Yaghootkar 15 March 2018 Diabetes UK - London Who has
More informationIntroduction. Short communication
DOI 10.1515/jpem-2013-0179 J Pediatr Endocr Met 2013; 26(11-12): 1209 1213 Short communication Anke Hinney, Barbara Wolters, Carolin Pütter, Harald Grallert, Thomas Illig, Johannes Hebebrand and Thomas
More informationHow to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD
How to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD Regents Distinguished Chair and Professor, Tulane University School of Public Health and Tropical Medicine
More informationPCSK1, MC4R, FTO, MAP2K5, GNPDA2
/, 2017, Vol. 8, (No. 55), pp: 93593-93607 The role of established East Asian obesity-related loci on pediatric leptin levels highlights a neuronal influence on body weight regulation in Chinese children
More informationInvestigating causality in the association between 25(OH)D and schizophrenia
Investigating causality in the association between 25(OH)D and schizophrenia Amy E. Taylor PhD 1,2,3, Stephen Burgess PhD 1,4, Jennifer J. Ware PhD 1,2,5, Suzanne H. Gage PhD 1,2,3, SUNLIGHT consortium,
More informationAssociation of genetic variation in FTO with risk of obesity and type 2 diabetes with data from 96,551 East and South Asians
Diabetologia (01) 55:981 995 DOI 10.1007/s0015-011-370-7 ARTICLE Association of genetic variation in FTO with risk of obesity and type diabetes with data from 96,551 East and South Asians H. Li & T. O.
More informationTEST ID: Doctor/Clinic Name Any Street Anytown, US 00000
TEST ID: 0000000 Doctor/Clinic Name 12345 Any Street Anytown, US 00000 TM DNA OPTIMIZED HEALTH Table Of Contents w w w. Welln es sg en e. c o m MediPro Direct Slim - 17933 NW Evergreen Pkwy Suite 220 Beaverton,
More informationObesity susceptibility loci and uncontrolled eating, emotional eating and cognitive restraint behaviors in men and women
Obesity susceptibility loci and uncontrolled eating, emotional eating and cognitive restraint behaviors in men and women The Harvard community has made this article openly available. Please share how this
More informationImpact of obesity-related genes in Spanish population
Martínez-García et al. BMC Genetics 2013, 14:111 RESEARCH ARTICLE Impact of obesity-related genes in Spanish population Open Access Fernando Martínez-García 1,2, María L Mansego 3,4, Gemma Rojo-Martínez
More informationEffects of environment and genetic interactions on chronic metabolic diseases
22 1 2010 1 Chinese Bulletin of Life Sciences Vol. 22, No. 1 Jan., 2010 1004-0374(2010)01-0001-06 ( 200031) 2 2 20 2 2 2 R151; R589; R587.1; R363.16 A Effects of environment and genetic interactions on
More informationThis document has been downloaded from TamPub The Institutional Repository of University of Tampere
This document has been downloaded from TamPub The Institutional Repository of University of Tampere Publisher's version The permanent address of the publication http://urn.fi/urn:nbn:fi:uta- 201412222517
More informationMetabolic Endocrine Curriculum. Coordinator: Prof. Gianni Marone PHD THESIS
UNIVERSITY OF NAPLES FEDERICO II DOCTORATE PROGRAM IN CLINICAL AND EXPERIMENTAL MEDICINE Metabolic Endocrine Curriculum XXIX CYCLE (2014-2017) Coordinator: Prof. Gianni Marone PHD THESIS Understanding
More informationRESEARCH PAPER. Genes Nutr (2013) 8: DOI /s z
Genes Nutr (2013) 8:495 505 DOI 10.1007/s12263-013-0340-z RESEARCH PAPER Obesity polymorphisms identified in genome-wide association studies interact with n-3 polyunsaturated fatty acid intake and modify
More informationReduced genetic influence on childhood obesity in small for gestational age children
Han et al. BMC Medical Genetics 2013, 14:10 RESEARCH ARTICLE Open Access Reduced genetic influence on childhood obesity in small for gestational age children Dug Yeo Han 1,3*, Rinki Murphy 4, Angharad
More informationThe genetics of human obesity
Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Issue: The Year in Diabetes and Obesity The genetics of human obesity Qianghua Xia 1 and Struan F.A. Grant 1,2,3 1 Division
More informationPrevalence of diabetes and impaired fasting glucose in Uygur children of Xinjiang, China
Prevalence of diabetes and impaired fasting glucose in Uygur children of Xinjiang, China J. Zhang 1, Y.T. Ma 1, X. Xie 1, Y.N. Yang 1, F. Liu 2, X.M. Li 1, Z.Y. Fu 1, X. Ma 1, B.D. Chen 2, Y.Y. Zheng 1,
More informationThe omics approach in measuring the double burden of malnutrition
IAEA Headquarter, Vienna, Austria, 3-5 October 2017 Joint IAEA-WHO-UNICEF workshop on analysis of biological pathways to better understand the double burden of malnutrition and to inform action planning
More informationFTO Polymorphisms Are Associated with Obesity But Not with Diabetes in East Asian Populations: A Meta analysis
BIOMEDICAL AND ENVIRONMENTAL SCIENCES 22, 449 457 (2009) www.besjournal.com FTO Polymorphisms Are Associated with Obesity But Not with Diabetes in East Asian Populations: A Meta analysis BO XI #, + AND
More informationAssociation analyses of 249,796 individuals reveal 18 new loci associated with body mass index
correction Notice Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index Elizabeth K Speliotes, Cristen J Willer, Sonja I Berndt, Keri L Monda, Gudmar Thorleifsson,
More informationAssociation of serum adipose triglyceride lipase levels with obesity and diabetes
Association of serum adipose triglyceride lipase levels with obesity and diabetes L. Yang 1 *, S.J. Chen 1 *, G.Y. Yuan 1, L.B. Zhou 2, D. Wang 1, X.Z. Wang 1 and J.J. Chen 1 1 Department of Endocrinology,
More informationCommon Variants of FTO Are Associated with Childhood Obesity in a Cross-Sectional Study of 3,126 Urban Indian Children
Common Variants of FTO Are Associated with Childhood Obesity in a Cross-Sectional Study of 3,126 Urban Indian Children Om Prakash Dwivedi 1., Rubina Tabassum 1., Ganesh Chauhan 1, Saurabh Ghosh 2, Raman
More informationSupplementary information
Supplementary information Hepatitis B virus genotype, mutations, human leukocyte antigen polymorphisms and their interactions in hepatocellular carcinoma: a multi-centre case-control study Juan Wen, Ci
More informationThe association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease
The association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease Shanshan Sun, Tao Wu, Miao Wang, Wei Li, Lin Wang, Songhua He, Huafeng Wei, Haiyan Song,
More informationEvaluating the discriminative power of multi-trait genetic risk scores for type 2 diabetes in a northern Swedish population
Diabetologia (2010) 53:2155 2162 DOI 10.1007/s00125-010-1792-y ARTICLE Evaluating the discriminative power of multi-trait genetic risk scores for type 2 diabetes in a northern Swedish population B. Fontaine-Bisson
More informationGenetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes
More informationASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT
ONLINE SUPPLEMENT ASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT Jason H Karnes, PharmD 1, Caitrin W McDonough, PhD 1, Yan Gong, PhD 1, Teresa
More informationSupplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2
Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 rs4402960, (B) MTNR1B rs10830963, (C) TCF7L2 rs7903146, (D) IRS1 rs1801278, (E) PPARG rs1801282, (F)
More informationPott s kyphosis. University Affiliated Sixth People s Hospital, 600 Yishan Road, Shanghai , P.
QJM Advance Access published November 17, 2014 Pott s kyphosis Author Names: Yi Zhang, Yong-Sheng Yu, Zheng-Hao Tang and Guo-Qing Zang Author Affiliations: Department of Infectious Diseases, Shanghai Jiao
More informationGenetic Terms DNA. Proteins. Genes. Variations. Epigenetics. Alleles
Name: SAMPLE REPORT Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations are based upon
More informationReport Date: 11/20/2017
Name: Sample Report Report Date: 11/20/2017 Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations
More informationYinfang Tu 1, Haoyong Yu 1, Yuqian Bao 1, Pin Zhang 2, Jianzhong Di 2, Xiaodong Han 2 and Weiping Jia 1*
Tu et al. BMC Endocrine Disorders (2015) 15:26 DOI 10.1186/s12902-015-0027-0 RESEARCH ARTICLE Open Access Baseline of visceral fat area and decreased body weight correlate with improved pulmonary function
More informationGenome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels.
Supplementary Online Material Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. John C Chambers, Weihua Zhang, Yun Li, Joban Sehmi, Mark N Wass, Delilah Zabaneh,
More informationOver the past year, the capacity to perform
BRIEF REPORT Adiposity-Related Heterogeneity in Patterns of Type 2 Diabetes Susceptibility Observed in Genome-Wide Association Data Nicholas J. Timpson, 1,2 Cecilia M. Lindgren, 1,3 Michael N. Weedon,
More informationReplication of Early B-cell Factor 1 (EBF1) Gene-bypsychosocial Stress Interaction Effects on Central Adiposity in a Korean Population
Original Article J Prev Med Public Health 2016;49:253-259 http://dx.doi.org/10.3961/jpmph.16.028 pissn 1975-8375 eissn 2233-4521 Journal of Preventive Medicine & Public Health Replication of Early B-cell
More informationSmoking modifies the effect of two independent SNPs rs5063 and. rs of NPPA on central obesity in the Chinese Han population
Research Article Smoking modifies the effect of two independent SNPs rs5063 and rs198358 of NPPA on central obesity in the Chinese Han population Huan Zhang 1,2, Xingbo Mo 1,2,3, Zhengyuan Zhou 4, Zhengbao
More informationThe genetic architecture of type 2 diabetes appears
ORIGINAL ARTICLE A 100K Genome-Wide Association Scan for Diabetes and Related Traits in the Framingham Heart Study Replication and Integration With Other Genome-Wide Datasets Jose C. Florez, 1,2,3 Alisa
More informationInteraction between the RGS6 gene and psychosocial stress on obesity-related traits
2017, 64 (3), 357-362 Original Interaction between the RGS6 gene and psychosocial stress on obesity-related traits Hyun-Jin Kim 1), Jin-young Min 1) and Kyoung-bok Min 2) 1) Institute of Health and Environment,
More informationSupplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationThis is a published version of a paper published in PLoS ONE. Access to the published version may require subscription.
Umeå University This is a published version of a paper published in PLoS ONE. Citation for the published paper: Stocks, T., Ängquist, L., Banasik, K., Harder, M., Taylor, M. et al. (2012) "TFAP2B influences
More informationCollege of Computer Engineering and Science, Sattam Bin Abdulaziz University, KSA
A Genetic Analytics Framework for Risk Variant Identification to Support Intervention Strategies for People Susceptible to Polygenic Obesity and Overweight C. Aday Curbelo Montañez 1, P. Fergus 1, A. Hussain
More informationPERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE:
HEALTHY WEIGHT PERSON TESTED: Jane Doe REFERENCE #: 123456 DATE OF BIRTH: 3/7/1998 REPORT DATE: 5/25/17 REPORT SUMMARY CATEGORY RATING GENES Weight Loss Ability with Diet and Exercise BELOW AVERAGE FTO,
More informationModification of genetic influences on adiposity between 36 and 63 years of age by physical activity and smoking in the 1946 British Birth Cohort Study
OPEN Citation: Nutrition & Diabetes (2014) 4, e136; doi:10.1038/nutd.2014.33 2014 Macmillan Publishers Limited All rights reserved 2044-4052/14 www.nature.com/nutd ORIGINAL ARTICLE between 36 and 63 years
More informationDiabetes and Obesity Sex- and Gender-differences!
Oskar Kokoschka 1908 Das Mädchen Li und ich Diabetes and Obesity Sex- and Gender-differences! Alexandra Kautzky Willer IGM, Berlin 2015 Global Diabetes-Epidemic Increase (%) in age-standardised diabetes
More informationFTO gene, obesity and colon cancer: from epidemiological evidence to laboratory studies
Obesity-associated Colon Cancer FTO gene, obesity and colon cancer: from epidemiological evidence to laboratory studies Jiezhong Chen 1,2, Jian Yang 3, Kong-Nan Zhao 4 1 School of Biomedical Sciences,
More informationHEALTHY WEIGHT. ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES
HEALTHY WEIGHT ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES REFERENCE #: 8539094 DATE OF BIRTH: 1/18/1980 REPORT DATE: March 07, 2018 YOUR PERSONALIZED REPORT CONGRATULATIONS! You will
More informationSupplemental Table 1. Components of MDS and AHEI
Supplemental Table 1. Components of MDS and AHEI MDS AHEI Vegetable Fruit SSB & fruit juice Nut Legume Whole grain Fish Red meat MUFA/SAT ratio EPA & DHA PUFA Trans-fat Alcohol Sodium MDS: Mediterranean-style
More informationAssociation between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population
Association between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population G.B. Su, X.L. Guo, X.C. Liu, Q.T. Cui and C.Y. Zhou Department of Cardiothoracic
More informationSupplementary Figure S1A
Supplementary Figure S1A-G. LocusZoom regional association plots for the seven new cross-cancer loci that were > 1 Mb from known index SNPs. Genes up to 500 kb on either side of each new index SNP are
More informationl e t t e r s Identification of an imprinted master trans regulator at the KLF14 locus related to multiple metabolic phenotypes
Identification of an imprinted master trans regulator at the KLF14 locus related to multiple metabolic phenotypes 211 Nature America, Inc. All rights reserved. Kerrin S Small 1,2,1, Åsa K Hedman 3,1, Elin
More informationExpression of fourteen novel obesity-related genes in zucker diabetic fatty rats
Schmid et al. Cardiovascular Diabetology 2012, 11:48 CARDIO VASCULAR DIABETOLOGY ORIGINAL INVESTIGATION Expression of fourteen novel obesity-related genes in zucker diabetic fatty rats Peter M Schmid 1,4*,
More informationLA PROF. ESTER VITACOLONNA Dichiara che negli ultimi due anni non ha avuto rapporti anche di finanziamento con soggetti portatori di interessi
LA PROF. ESTER VITACOLONNA Dichiara che negli ultimi due anni non ha avuto rapporti anche di finanziamento con soggetti portatori di interessi commerciali in campo sanitario Nutrigenetica e rischio cardiometabolico
More informationPERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE:
HEALTHY WEIGHT PERSON TESTED: Jacky Dave REFERENCE #: 123256 DATE OF BIRTH: 05/07/1988 REPORT DATE: 12/25/2017 YOUR PERSONALIZED REPORT CONGRATULATIONS! You will receive insights about your body that have
More informationA total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in
Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican
More informationAssociation between genetic polymorphisms of PTGS2 and glioma in a Chinese population
Association between genetic polymorphisms of PTGS2 and glioma in a Chinese population R.P. Lin 1, C.Y. Yao 2 and D.X. Ren 1 1 Department of Neurosurgery, First People s Hospital of Shenyang, Shenyang,
More informationSu Yon Jung 1*, Eric M. Sobel 2, Jeanette C. Papp 2 and Zuo-Feng Zhang 3
Jung et al. BMC Cancer (2017) 17:290 DOI 10.1186/s12885-017-3284-7 RESEARCH ARTICLE Open Access Effect of genetic variants and traits related to glucose metabolism and their interaction with obesity on
More informationORIGINAL ARTICLE. Abstract
Journal of Diabetes 9 (2017), 994 1002 ORIGINAL ARTICLE Association of type 2 diabetes mellitus with the interaction between low-density lipoprotein receptorrelated protein 5 (LRP5) polymorphisms and overweight
More informationmir-146a and mir-196a2 polymorphisms in ovarian cancer risk
mir-146a and mir-196a2 polymorphisms in ovarian cancer risk X.C. Sun, A.C. Zhang, L.L. Tong, K. Wang, X. Wang, Z.Q. Sun and H.Y. Zhang Department of Obstetrics and Gynecology, China-Japan Union Hospital
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within
More informationReplication of 13 genome-wide association (GWA)-validated risk variants for type 2 diabetes in Pakistani populations
Diabetologia (2011) 54:1368 1374 DOI 10.1007/s00125-011-2063-2 ARTICLE Replication of 13 genome-wide association (GWA)-validated risk variants for type 2 diabetes in Pakistani populations S. D. Rees &
More informationCardiovascular Diabetology. Open Access ORIGINAL INVESTIGATION
https://doi.org/10.1186/s12933-018-0786-9 Cardiovascular Diabetology ORIGINAL INVESTIGATION Open Access Correlations between serum concentration of three bone derived factors and obesity and visceral fat
More informationReview Article MicroRNA single-nucleotide polymorphisms and susceptibility to gastric cancer
Am J Digest Dis 2016;3(1):11-15 www.ajdd.us /ISSN:2329-6992/AJDD0023804 Review Article MicroRNA single-nucleotide polymorphisms and susceptibility to gastric cancer Xinhang Jiang, Xintong Chen, Linhua
More informationInfluence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia
Supplementary Information For: Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia Aroon T. Chande 1,2,3, Jessica Rowell
More informationCDKAL1 and type 2 diabetes: a global meta-analysis
CDKAL1 and type 2 diabetes: a global meta-analysis M.A.S. Dehwah, M. Wang and Q.-Y. Huang Hubei Key Lab of Genetic Regulation and Integrative Biology, College of Life Sciences, Huazhong Normal University,
More informationA preliminary association study of fat mass and obesity associated gene polymorphisms and degenerative disc disease in a Chinese Han population
Research Note A preliminary association study of fat mass and obesity associated gene polymorphisms and degenerative disc disease in a Chinese Han population Journal of International Medical Research 2014,
More informationResearch Article Beneficial Effects of an 8-Week, Very Low Carbohydrate Diet Intervention on Obese Subjects
Evidence-Based Complementary and Alternative Medicine Volume 213, Article ID 7684, 8 pages http://dx.doi.org/1.1155/213/7684 Research Article Beneficial Effects of an 8-Week, Very Low Carbohydrate Diet
More informationSupplementary Figures
Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample
More informationGenetic susceptibility to obesity and related traits in childhood and adolescence; influence of loci identified by genome-wide association studies
Diabetes Publish Ahead of Print, published online August 19, 2010 Genetic susceptibility to obesity and related traits in childhood and adolescence; influence of loci identified by genome-wide association
More informationThe obesity-related FTO gene variant associates with the risk of recurrent miscarriage
A C TA Obstetricia et Gynecologica AOGS MAIN RESEARCH ARTICLE The obesity-related FTO gene variant associates with the risk of recurrent miscarriage PRABHA H. ANDRAWEERA 1,2, GUSTAAF A. DEKKER 1,3, ROHAN
More informationUniversity of Groningen. Metabolic risk in people with psychotic disorders Bruins, Jojanneke
University of Groningen Metabolic risk in people with psychotic disorders Bruins, Jojanneke IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationAssociation between FTO, MC4R, SLC30A8, and KCNQ1 gene variants and type 2 diabetes in Saudi population
Association between FTO, MC4R, SLC30A8, and KCNQ1 gene variants and type 2 diabetes in Saudi population M.D. Bazzi 1, F.A. Nasr 1, M.S. Alanazi 1, A. Alamri 1, A.A. Turjoman 2, A.S. Moustafa 2, A.A. Alfadda
More informationAssociation-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis
Supplementary Material Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Kwangwoo Kim 1,, So-Young Bang 1,, Katsunori Ikari 2,3, Dae
More information