Joint Department of Biomedical Engineering
|
|
|
- Rodger Perkins
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for Chronic Myeloid Leukemia Targeted Therapy Yang Liu, 1, Gui Zhao, 1, Cong-Fei Xu *,,, Ying-Li Luo, Zi-Dong Lu *,,, Jun Wang,, School of Life Sciences, University of Science and Technology of China, Hefei, Anhui , People s Republic of China Institutes for Life Sciences and School of Medicine, South China University of Technology, Guangzhou, Guangdong , People s Republic of China School of Biomedical Sciences and Engineering, South China University of Technology, Guangzhou, Guangdong , People s Republic of China National Engineering Research Center for Tissue Restoration and Reconstruction, South China University of Technology, Guangzhou, Guangdong , People s Republic of China Research Institute for Food Nutrition and Human Health, Guangzhou , People s Republic of China Joint Department of Biomedical Engineering
2 University of North Carolina at Chapel Hill and North Carolina State University Raleigh, NC 27695, USA Joint Department of Biomedical Engineering
3 University of North Carolina at Chapel Hill and North Carolina State University Raleigh, NC 27695, USA Joint Department of Biomedical Engineering
4 University of North Carolina at Chapel Hill and North Carolina State University Raleigh, NC 27695, USA 1 These authors contribute equally to this work *Corresponding Authors: xucf@scut.edu.cn (Cong-Fei Xu) luzd@scut.edu.cn (Zi-Dong Lu)
5 Indel frequency (%) A K562 BCR-ABL region BCR region fusion region ABL region gbcr-abl-2 target sequence gbcr-abl-1 target sequence CTTTGACCCTGGCCGCTGTGGAGTGGGTTTTATCAGCTTCCATACCCAA gbcr-abl-3 target sequence B C gbcr-abl-1 5 CCCTGGCCGCTGTGGAGTGGGTT 3 Oligo-F: CACCGAACCCACTCCACAGCGGCCA Oligo-R: AAACTGGCCGCTGTGGAGTGGGTTC gbcr-abl-2 5 CCGCTGTGGAGTGGGTTTTATCA 3 Oligo-F: CACCGTGATAAAACCCACTCCACAG Oligo-R: AAACCTGTGGAGTGGGTTTTATCAC gbcr-abl-3 5 GACCCTGGCCGCTGTGGAGTGGG 3 Oligo-F: CACCGACCCTGGCCGCTGTGGAGT Oligo-R: AAACACTCCACAGCGGCCAGGGTC Indel% 54.5% 43.6% 36.8% D T Hela MDA-MB BCR ABL Fig. S1. Designing the sequence of gbcr-abl for the disruption of BCR-ABL gene. (A) The scheme of gbcr-abl-1, gbcr-abl-2, gbcr-abl-3 targeting the fusion region of BCR-ABL. (B) The sequences of DNA oligos for constructing the pcas9/gbcr-abl. (C) The indel frequencies in K562 cells transfected with pcas9/gbcr-abl-1, pcas9/gbcr-abl-2, pcas9/gbcr-abl-3 by Lipofectamine
6 LTX. (D) The indel frequencies in BCR or ABL gene of 293T, Hela and MDA-MB-231 cells transfected with CLAN pcas9/gbcr-abl at a pcas9/gbcr-abl concentration of 2 μg/ml. The indel frequencies were detected with T7E1 at 72 h after transfection. 200 nm Fig. S2. The morphology of CLAN pcas9 was analyzed with TEM. Scal bar = 200 nm.
7 NOD/SCID NOD/SCID with human CML 86.6% Peripheral blood mcd45-pe Peripheral blood mcd45-pe 73.8% hcd45-apc hcd45-apc 97.4% Bone marrow mcd45-pe Bone marrow mcd45-pe 25.0% hcd45-apc hcd45-apc Fig. S3. The percentage of human derived-k562 cells (hcd45 + mcd45 - ) in the blood and bone marrow of CML mouse at 28 days after transplantation. CML mouse was irradiated at the dose of 270 cgy by 137 Cs and injected with K562 cells ( cells in 500 μl PBS per mouse) within 24 h by tail intravenous injection. PAM gbcr-abl Target sequence CTTTGACCCTGGCCGCTGTGGAGTGGGTTTTATCAGCTTCCATACCCAA CTTTGACCC CGCTGTGGAGTGGGTTTTATCAGCTTCCATACCCAA CTTTGACC GCTGTGGAGTGGGTTTTATCAGCTTCCATACCCAA WT 4 6 CTTTGACCCAC GCTGTGGAGTGGGTTTTATCAGCTTCCATACCCAA 5, +2 CTTTGACCC C TGGAGTGGGTTTTATCAGCTTCCATACCCAA 8 CTTTGACC G GTATGTGGAGTGGGTTTTATCAGCTTCCATACCCAA 7, +3 Fig. S4. The representative mutant sequences harboring indels in the BCR-ABL locus of K562 cells. hcd45 + mcd45 - K562 were sorted by flow cytometry at 72 h after
8 CLAN pcas9/gbcr-abl injection. *** 800 Spleen weight (mg) Fig. S5. The spleen weight of CML mice treated with CLAN pcas9/gbcr-abl and other formulations. Data are shown as means ± SD (n = 10), *** p < Table S1. The primer sequences for qrt-pcr and PCR. Primers F primer ( ) R primer ( ) BCR-ABL qpcr GGAGCTGCAGATGCTGACCACC TCAGACCCTGAGGCTCAAAGTC GADPH qpcr ATCAAGAAGGTGGTGAAGCAGGCA TGGAAGAGTGGGAGTTGCTGTTGA BCR-ABL GCCACTGGATTTAAGCAGAGTTCAA CTTTCTTTCATCAATAAGAATTCTT Off-target 1 AAAAACTGCAACTGCTGCTGGGCCA TGTGCTCGTTGTTCTGCAGCATGAT Off-target 2 GACAAGCGGCGAGTGCCACTGCAAG ACAGACTCTGGACAAGGAGCCTGTG Off-target 3 GCCAAAGCGTTTGAGTTAAGCTACC AGACAAGCTGTGCTGTTTCAGCGTT Off-target 4 GCAGTGCGTGTCAGGTAGGAGTAAA CCTTCTCCACGAACCCCACAAACGC Off-target 5 TCATCCGAGGGTCCTCGCTCCTGAA GTCCCCGTCATCAGGAAGCCCAACA Off-target 6 TTGAATCACAGCCACAACGTGACCA GTGCAAGCTCCTTTGCCTCTGAGTC Off-target 7 GAACCAGCACAGTGATAGGGCCGCC CCTCCTTGAGCTGCTCCTCGTGGGC Off-target 8 ATGGAGCCTCACGTCTACTCCCTTC TTCAATTCTATCCTTGGGAGGCAGC BCR CCACTGGATTTAAGCAGAGTTCAAG CCAGCCTTCACTGTTCTGACAG ABL CCTGTTAATTTGTTTGTCTTTCCTT CTGTTCGATCCATGAAAATGTATAA
9 Table S2. The on-target and potential off-target sites of gbcr-abl. The mismatched bases were in red. Targets sequence mismatches UCSC gene locus On-target AACCCACTCCACAGCGGCCA Off-target 1 AGCCATCCCCACAGCGGCCA 4MMs [2:5:6:8] NM_ chr11: Off-target 2 GACCCTCTCCACAGGGGCCA 3MMs [1:6:15] NM_ chr1: Off-target 3 GGCCCACTCCTCAGCGTCCA 4MMs [1:2:11:17] NM_ chr18: Off-target 4 GACCCACCCCGCTGCGGCCA 4MMs [1:8:11:13] NM_ chr5: Off-target 5 TACCGGCTCCACAGCGGCGA 4MMs [1:5:6:19] NM_ chr8: Off-target 6 GGCCCACTCCGCAGAGGCCA 4MMs [1:2:11:15] NM_ chr17: Off-target 7 AACCCAAGCCACAGCGACCC 4MMs [7:8:17:20] NM_ chr8: Off-target 8 AATCCCATCCACAGAGGCCA 4MMs [3:6:7:15] NM_ chr15:
Supporting Information For
Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
Supplementary Information. Acoustically-Mediated Intracellular Nanoparticle and Macromolecule Delivery
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 218 Supplementary Information Acoustically-Mediated Intracellular Nanoparticle and Macromolecule Delivery
Low toxicity and accumulation of zinc oxide nanoparticles in mice
Electronic Supplementary Material (ESI) for Toxicology Research. This journal is The Royal Society of Chemistry 2016 Low toxicity and accumulation of zinc oxide nanoparticles in mice after 270-day consecutive
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
In vivo analysis of HIV replication and persistence in the myeloid compartment
In vivo analysis of HIV replication and persistence in the myeloid compartment J. Honeycutt, A. Wahl, J. Foster, R.A. Spagnulo and J. Victor Garcia Division of Infections Diseases UNC Center for AIDS Research
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supporting Information. Maximizing the Supported Bilayer Phenomenon: LCP Liposomes Comprised Exclusively
S-1 Supporting Information Maximizing the Supported Bilayer Phenomenon: LCP Liposomes Comprised Exclusively of PEGylated Phospholipids for Enhanced Systemic and Lymphatic Delivery Matthew T. Haynes and
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
Supplementary Material
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells
Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells J. M. Heath, A. Chalishazar, C.S. Lee, W. Selleck, C. Cotta-Ramusino, D. Bumcrot, J.L.
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry Please do 2017 not adjust margins Nanoscale Electronic Supplementary Information Mono-fullerenols modulating
Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe
Supporting Information Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe Shengnan He, Long Qu, Zhifa Shen, Ying Tan, Meiyun Zeng, Feng Liu *, and Yuyang Jiang ǁ
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Hematopathology Case Study
Hematopathology Case Study AMP Outreach Course 2009 AMP Annual Meeting John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine November 19, 2009 HISTORY Case History An
Supporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers
Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity
Supporting Information Design of LVFFARK and LVFFARK-Functionalized Nanoparticles for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Neng Xiong, Xiao-Yan Dong, Jie Zheng, Fu-Feng Liu, * and
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Analysis of Sphingosine Kinase Activity in Single Natural Killer Cells from Peripheral Blood
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information: Analysis of Sphingosine Kinase Activity in Single
Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU
Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren
ONCO-HU TM MICE FOR IMMUNOTHERAPEUTIC DRUG DISCOVERY. Brian W. Soper, Ph.D. Senior Technical Information Scientist
ONCO-HU TM MICE FOR IMMUNOTHERAPEUTIC DRUG DISCOVERY Brian W. Soper, Ph.D. Senior Technical Information Scientist Presentation Outline Capabilities Humanization Hu-NSG TM versus Hu-NSG TM -SGM3 Immuno-oncology
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Transient cold shock enhances zinc-finger nuclease mediated gene disruption
nature methods Transient cold shock enhances zincfinger nuclease mediated gene disruption Yannick Doyon, Vivian M Choi, Danny Xia, Thuy D Vo, Philip D Gregory & Michael C Holmes Supplementary figures and
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
THE USE OF WT1-QPCR TO MEASURE AND DETECT MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA. Ava Greco
THE USE OF WT1-QPCR TO MEASURE AND DETECT MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA Ava Greco REVIEW OF LITERATURE What is Leukemia? Abnormal growth of cells in the blood stream Progresses rapidly
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment
Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment Kaiyue Zhang 1,2, Xiangnan Zhao 1, Xiaoniao Chen 3, Yongzhen Wei
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Hematologic and cytogenetic responses of Imatinib Mesylate and significance of Sokal score in chronic myeloid leukemia patients
ORIGINAL ALBANIAN MEDICAL RESEARCH JOURNAL Hematologic and cytogenetic responses of Imatinib Mesylate and significance of Sokal score in chronic myeloid leukemia patients Dorina Roko 1, Anila Babameto-Laku
A novel method for identifying potential disease-related mirnas via disease-mirna-target heterogeneous network
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 A novel method for identifying potential disease-related mirnas via disease-mirna-target
A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors
Electronic Supplementary Information (ESI): A Facile Method for Enhancing the Sensing Performance of Zinc Oxide Nanofibers Gas Sensors Pei-Pei Wang a, Qi Qi a, Rui-Fei Xuan a,b, Jun Zhao a, Li-Jing Zhou
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Supplementary Information
Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations.
Supplementary Figure 1 TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations. The CpG motifs closest to the breakpoints are highlighted in red boxes and the
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Overview of the transplant procedure and supplementary data to Figure 1. a. Under isofluorane anesthesia, the lumen of the colon is washed by a gentle PBS enema. b. Using a p200
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
BLT mice in HIV prophylaxis
BLT mice in HIV prophylaxis Martina Kovarova, Ph.D. Assistant Professor UNC at Chapel Hill September 18, 2017 BLT mice Bone Marrow-Liver-Thymus Melkus, et al., Nature (2006) BLT humanized mice preparation
Electronic Supplementary Information. Chemical inhibitors and stable knock-down of efflux transport leads to reduced
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Chemical inhibitors and stable knock-down of efflux
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supporting Information
Supporting Information Cancer Cell Membrane-Biomimetic Nanoprobes with Two-Photon Excitation and Near-Infrared Emission for Intravital Tumor Fluorescence Imaging Yanlin Lv 1,2,, Ming Liu 3,4,, Yong Zhang
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
MOF-Derived Zn-Mn Mixed Hollow Disks. with Robust Hierarchical Structure for High-Performance. Lithium-Ion Batteries
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information (ESI) MOF-Derived Zn-Mn Mixed Oxides@Carbon
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Supplementary Information
Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho
An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
Light and X-ray triggered liposomal gene/drug delivery system for cancer therapy
Light and X-ray triggered liposomal gene/drug delivery system for cancer therapy Wei Deng, 1 Wenjie Chen, 2 Sandhya Clement, 1 Anna Guller, 1 Alexander Engel, 3 Ewa Goldys 1 1 The Graduate School of Biomedical
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Information
Supplementary Information Lymphatic endothelial cells support tumor growth in breast cancer Esak Lee a, Niranjan B. Pandey a, and Aleksander S. Popel a,b a Department of Biomedical Engineering, Johns Hopkins
Peking University People's Hospital, Peking University Institute of Hematology
Qian Jiang, M.D. Peking University People's Hospital, Peking University Institute of Hematology No. 11 Xizhimen South Street, Beijing, 100044, China. Phone number: 86-10-66583802 Mobile: 86-13611115100
University of Ulsan College of Medicine, Seoul 05505, Republic of Korea.
Nanoparticle-Assisted Transcutaneous Delivery of a Signal Transducer and Activator of Transcription 3-Inhibiting Peptide Ameliorates Psoriasis-like Skin Inflammation Jin Yong Kim 1,5, Jinhyo Ahn 3,4, Jinjoo
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
Case #1. 65 yo man with no prior history presented with leukocytosis and circulating blasts: Bone marrow biopsy was performed
Case #1 65 yo man with no prior history presented with leukocytosis and circulating blasts: WBC 187.4K/uL ; Hgb 10.0gm/dL; Platelet 68K/uL Neutrophil % 25.0% Lymphocyte % 38.0% Monocyte % 12.0% Metamyelocyte
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed