Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients

Size: px
Start display at page:

Download "Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients"

Transcription

1 Vertical Magnetic Separation of Circulating Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients Chang Eun Yoo 1,2#, Jong-Myeon Park 3#, Hui-Sung Moon 1,2, Je-Gun Joung 2, Dae-Soon Son 1,2, Hyo-Jeong Jeon 2, Yeon Jeong Kim 1,2, Kyung-Yeon Han 1,2, Jong- Mu Sun 4, Keunchil Park 4, Donghyun Park 1,2 *, Woong-Yang Park 2,5 * 1 Samsung Biomedical Research Institute (SBRI), Samsung Advanced Institute of Technology (SAIT), Samsung Electronics Co. Ltd., Seoul 06351, Korea 2 Samsung Genome Institute (SGI), Samsung Medical Center (SMC), Seoul 06351, Korea 3 Samsung Electronics Co., Ltd., Suwon, 16677, Korea 4 Department of Medicine, Sungkyunkwan University School of Medicine, Suwon 16416, Korea 5 Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, Suwon 16419, Korea # These authors contributed equally to this work * To whom correspondence should be addressed. Donghyun Park dh37.park@samsung.com Tel: Fax:

2 Woong-Yang Park Tel: Fax:

3 SUPPLEMENTARY INFORMATION Supplementary Figures S1 2 Supplementary Tables S1-4 3

4 (a) (b) (c) (d) (e) (f) Supplementary Figure S1. Photographs, dimensions, and schematic view of the modified well-plate. (a) Plate, (b) Well, (c) Insert, (d) Plate dimensions, (e) Well dimensions, (f) Schematic view of well fitted with an insert (green) 4

5 5

6 Supplementary Figure 2 Ratio profiles of copy numbers and percentage of CNAs in s and tumor samples for patient 20 (A), patient 23 (B), and patient 32 (C) 6

7 Supplementary Table S1 Histological information of patient samples and comparison of the number of s recovered by vertical magnetic separation and the CellSearch method 21. Number of s per 7.5 ml Patient # Histology Vertical Magnetic Separation CellSearch 1 ADC SQ ADC SCLC ADC ADC ADC SQ Pleomorphic ADC ADC ADC SCLC SCLC SCLC ADC 2 0 7

8 Supplementary Table S2 Histological information, the number of s collected, and sequencing performance of collected s for each patient sample Patient # Histology Specimen Candidates Collected Reads Mean Read Length (bp) Mapped Reads On Target Mean Depth Uniformity 16 NSCLC Frozen Tissue 8 8 Library Failed Base Proportion (>100 ) 17 NSCLC FFPE , , % 1, % NSCLC Frozen Tissue , , % 2, % SCLC Frozen Tissue , , % 1, % NSCLC Frozen Tissue , , % 1, % NSCLC Frozen Tissue 2 2 Library Failed 22 NSCLC Frozen Tissue , , % % NSCLC Frozen Tissue , , % % NSCLC Frozen Tissue , , % 1, % NSCLC Frozen Tissue , , % 2, % NSCLC No tumor , , % 1, % NSCLC Frozen Tissue , , % 1, % NSCLC Not Enough Tissue , , % 1, % NSCLC FFPE , , % 1, % NSCLC Frozen Tissue , , % 1, % NSCLC Frozen Tissue , , % 1, % SCLC Frozen Tissue , , % 1, % NSCLC Not Enough Tissue , , % 2, % NSCLC FFPE DNA , , % 1, % 92 8

9 35 NSCLC Frozen Tissue , , % 2, % SCLC Frozen Tissue , , % 3, % NSCLC Frozen Tissue , , % 1, % NSCLC Frozen Tissue , , % 2, % SCLC 40 NSCLC Not Enough Tissue Not Enough Tissue , , % 1, % , , % 1, % NSCLC Frozen Tissue , , % 1, % NSCLC FFPE 1 1 Library Failed 43 NSCLC Frozen Tissue , , % 2, % NSCLC No tumor NSCLC Frozen Tissue 0 0 No s 9

10 Supplementary Table S3 List of somatic, non-synonymous mutations identified by targeted sequencing in tumor samples and s, and digital PCR in s. VAF 1 and VAF 2 refer to the variant allele frequency measured by targeted sequencing and digital PCR, respectively. Patient # Sample Gene Genomic Position Amino Acid Change VAF 1(%) VAF 2 (%) Mutation Type Present in COSMIC Chr7_ L858R 17.9 COSM6224 Chr17_ T96S 12.2 Stopgain COSM10770 Chr17_ E349X 11.3 COSM Chr7_ G873R ATM Chr11_ Q3000* 4.3 N.A. b Stopgain Chr17_ V179M COSM43779 SMAD4 Chr18_ Q256L Chr7_ Chr7_ G724S M793I COSM13979 COSM NRAS CSF1R Chr1_ Chr5_ S17N Q311R COSM Chr7_ T790M 16.5 COSM6240 Chr7_ L858R 44.7 COSM SMAD4 Chr18_ G386D 22.5 COSM MET Chr7_ R988C COSM FGFR2 Chr10_ S372F FGFR2 Chr17_ Chr10_ M246V G298D COSM PIK3CA Chr3_ E545K 12.9 COSM763 10

11 FBXW7 Chr4_ R479G 22.5 COSM22967 KIT Chr4_ N665K 34.0 COSM FGFR3 Chr17_ Chr4_ R249S R399C c COSM10817 COSM Chr17_ P82L COSM ATM KRAS Chr11_ Chr12_ R3008H G12A COSM21626 COSM PIK3CA Chr3_ Chr17_ H1047R R249G COSM775 COSM ALK Chr17_ Chr2_ W91X P1191S Stopgain COSM STK11 Chr19_ Q170R c 41 CTNNB1 Chr3_ D32V 17.2 COSM5691 CDKN2A Chr9_ D74A PTEN Chr10_ F56V 34.3 COSM5257 Chr17_ E204X 49.0 COSM10804 a. Variants with the same amino acid position, but an alternative sequence in the COSMIC database b. Not available because a TaqMan probe for this mutation was not prepared c. Mutation also detected in matched WBCs 11

12 Supplementary Table S4 Sequence of PCR primers and TaqMan probes used for digital PCR Gene Genomic Position Ref/Alt Forward Primer Reverse Primer Wild Probe (VIC) Mutant Probe (FAM) Chr7_ G/A GGTGCGGAAGAGAAAGAATACCAT CTGACCTAAAGCCACCTT ACTTTGCCTTCTGC CTTTGCTTTCTGC ATM * Chr11_ C/T Chr17_ C/T CATCCAAATACACACGCAAATT GATTCACTGATTGTTAGGT CATCTTATCCGAGTGGAAG ATCTTATCCGAATGGAAG SMAD4 Chr18_ A/T AGGACAGCAGCAGAATGGATTT GGCTGCCTACTTTTTTAACTATTTAAA AAGTAGCTGGCTGACCAG TAGCTGGCAGACCAG Chr7_ G/A CACCGTGCAGATCAC TCTTTGTGTTCCCGGACATAGTC CAGATGCCCTTCG CAGATACCCTTCG NRAS Chr1_ C/T TGGTTCTGGATTAGCTGGATTGTC GTTGGAGCAGGTGGTGTTG AGTGCGCTTTTCC AGTGCGTTTTTCC CSF1R Chr5_ T/C TCCACCATGACTTTGAGGTTGAG CTTGAACTTGAGTGAGCAGAA CATCCAGGAGGTG ATCCGGGAGGTG MET Chr7_ C/T TGTTTTAAGATCTGGGCAGTGA GCCTATCCAAATGAGGAGTGTGTAC CATCGTAGCGAACTAA CATCGTAGCAAACTAA FGFR2 Chr10_ G/A TGCAGTAAATGGCTATCAGGTA CAATCTAGCGCCTGGAAGAGAAA AGGAGATTACAGCTTCCCCAGA AGGAGATTACAGCTTTCCCAGA FGFR2 Chr10_ C/T GTCACCTTGAGAACCTTGAG CCCAGCCCCACATCCA AAGAACGGCAGTAAAT AAAAGAACGACAGTAAAT FGFR3 Chr4_ C/T GTGGTGGCGGCTGTGA GGAGCCCAGGCCTTTCTTG CGCAGGCGGCAGAG CGCAGGCAGCAGAG Chr17_ G/A TGGGAAGGGACAGAAGATGACA GCCCCTGCACCAGCA CGCCGGTGTAGGAG CCGCCAGTGTAGGAG ALK Chr2_ G/A CCATGAGCAGCAGGAT GCAAATTCAACCACCAGAACATTGT ATCCCTGCCCCGGTTC AATCCCTGTCCCGGTTC STK11 Chr19_ A/G TGACGGCCTGGAGTACCT CCGGCTTGATGTCCTTGTG CAATGCCCTGGCTATG ATGCCCCGGCTATG * TaqMan probe for this mutation was not prepared 12

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Supplementary Figure 1

Supplementary Figure 1 Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

SureSelect Cancer All-In-One Custom and Catalog NGS Assays

SureSelect Cancer All-In-One Custom and Catalog NGS Assays SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis

More information

Clinical Utility of Actionable Genome Information in Precision Oncology Clinic

Clinical Utility of Actionable Genome Information in Precision Oncology Clinic Indian Ocean Rim 2017 Laboratory Haematology Congress 2017. 6.18-19, Singapore Clinical Utility of Actionable Genome Information in Precision Oncology Clinic Reimbursement program for NGS panel tests in

More information

Personalized Healthcare Update

Personalized Healthcare Update Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:

More information

Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each

Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each mutated gene and the panel of 125 cancer-driving genes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13898 Supplementary Information Table 1 Kras mutation status of carcinogen-induced mouse lung adenomas Tumour Treatment Strain Grade Genotype Kras status (WES)* Kras status (Sanger) 32T1

More information

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically

More information

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech

More information

Next generation histopathological diagnosis for precision medicine in solid cancers

Next generation histopathological diagnosis for precision medicine in solid cancers Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics

More information

Supplementary information to:

Supplementary information to: Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

Clinical Grade Genomic Profiling: The Time Has Come

Clinical Grade Genomic Profiling: The Time Has Come Clinical Grade Genomic Profiling: The Time Has Come Gary Palmer, MD, JD, MBA, MPH Senior Vice President, Medical Affairs Foundation Medicine, Inc. Oct. 22, 2013 1 Why We Are Here A Shared Vision At Foundation

More information

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Liquid biopsy: the experience of real life case studies

Liquid biopsy: the experience of real life case studies Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal

More information

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared

More information

Development of Circulating Tumor DNA

Development of Circulating Tumor DNA Development of Circulating Tumor DNA Title of presentation Arial Bold 30pt in White Biomarkers Secondary title 22pt using Arial Next in White Generation Sequencing Brian Dougherty PhD, MBA Translational

More information

Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester

Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester dsg6@le.ac.uk CFDNA/CTDNA Circulating-free AS A LIQUID DNA BIOPSY (cfdna) Tumour Biopsy Liquid Biopsy

More information

Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy

Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy 1 st st International Oncological Conference Wrocław, October 6 th, 2012 Dr. Frank Kischkel Individualized Cancer Therapy:

More information

To test the possible source of the HBV infection outside the study family, we searched the Genbank

To test the possible source of the HBV infection outside the study family, we searched the Genbank Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),

More information

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff 5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late

More information

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity

More information

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Kris MG, Johnson BE, Berry LD, et al. Using Multiplexed Assays of Oncogenic Drivers in Lung Cancers to Select Targeted Drugs. JAMA. doi:10.1001/jama.2014.3741 etable 1. Trials

More information

The Center for PERSONALIZED DIAGNOSTICS

The Center for PERSONALIZED DIAGNOSTICS The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)

More information

Tumor volume determines the feasibility of cell-free DNA sequencing for mutation detection in non-small cell lung cancer

Tumor volume determines the feasibility of cell-free DNA sequencing for mutation detection in non-small cell lung cancer Tumor volume determines the feasibility of cell-free DNA sequencing for mutation detection in non-small cell lung cancer Tatsuo Ohira, 1,4 Kazuko Sakai, 2,4 Jun Matsubayashi, 3 Naohiro Kajiwara, 1 Masatoshi

More information

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation. SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang

More information

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%) Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999

More information

Molecular Testing in Lung Cancer

Molecular Testing in Lung Cancer Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans

More information

Quality of life (QoL) in metastatic breast cancer patients with. maintenance paclitaxel plus gemcitabine (PG) chemotherapy:

Quality of life (QoL) in metastatic breast cancer patients with. maintenance paclitaxel plus gemcitabine (PG) chemotherapy: Quality of life (QoL) in metastatic breast cancer patients with maintenance paclitaxel plus gemcitabine (PG) chemotherapy: results from phase III, multicenter, randomized trial of maintenance chemotherapy

More information

Detecting Oncogenic Mutations in Whole Blood

Detecting Oncogenic Mutations in Whole Blood WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013

More information

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes

More information

Supplementary Table S1: Primers for DNA sequencing (A), quantification of. relative mrna expression (B), and copy number analysis (C)

Supplementary Table S1: Primers for DNA sequencing (A), quantification of. relative mrna expression (B), and copy number analysis (C) Supplementary Table S1: Primers for DNA sequencing (A), quantification of relative mrna expression (B), and copy number analysis (C) A. DNA sequencing (1-4) Genes Primers Sequence EGFR exon 18 EGFR E18F

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities

Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Sujana Movva 1, Wenhsiang Wen 2, Wangjuh Chen 2, Sherri Z. Millis 2, Margaret von Mehren 1, Zoran

More information

Enabling Personalized

Enabling Personalized Molecular Enabling Personalized Diagnostics Medicine- Targeted Sequencing: NGS-based solutions Silvia Dorn Roel Reinders- Andreas Diplas Friday, 19.06.2015 Company Overview Founded in April 2011 Development

More information

Changing demographics of smoking and its effects during therapy

Changing demographics of smoking and its effects during therapy Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults

More information

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng, The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Study design.

Nature Genetics: doi: /ng Supplementary Figure 1. Study design. Supplementary Figure 1 Study design. Leukopenia was classified as early when it occurred within the first 8 weeks of thiopurine therapy and as late when it occurred more than 8 weeks after the start of

More information

Plasma-Seq conducted with blood from male individuals without cancer.

Plasma-Seq conducted with blood from male individuals without cancer. Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer

More information

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown

More information

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:

More information

Secuenciación masiva: papel en la toma de decisiones

Secuenciación masiva: papel en la toma de decisiones Secuenciación masiva: papel en la toma de decisiones Cancer is a Genetic Disease Development of cancer is driven by the acquisition of somatic genetic alterations: Nonsynonymous point mutations: missense.

More information

PRECISION INSIGHTS. Liquid GPS. Blood-based tumor profiling and quantitative monitoring. Reveal more with cfdna + cfrna.

PRECISION INSIGHTS. Liquid GPS. Blood-based tumor profiling and quantitative monitoring. Reveal more with cfdna + cfrna. PRECISION INSIGHTS Liquid GPS Blood-based tumor profiling and quantitative monitoring Reveal more with cfdna + cfrna www.nanthealth.com Why Blood-Based Tumor Profiling? Although tissue-based molecular

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

Liquid biopsy in lung cancer: The EGFR paradigm

Liquid biopsy in lung cancer: The EGFR paradigm Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships

More information

Utility of liquid biopsies EQA Program Naples, IT Sidney A. Scudder, MD Director, Clinical Science 13 May, 2017

Utility of liquid biopsies EQA Program Naples, IT Sidney A. Scudder, MD Director, Clinical Science 13 May, 2017 Utility of liquid biopsies EQA Program Naples, IT Sidney A. Scudder, MD Director, Clinical Science 13 May, 2017 picture placeholder Agenda cobas EGFR Mutation Test v2 Ring Trial SQI Semi Quantitative Index

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation

SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.

More information

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder

More information

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018

Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018 Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations

More information

Laboratory Service Report

Laboratory Service Report Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic

More information

ABSTRACT. Oncotarget, Vol. 6, No. 32

ABSTRACT.     Oncotarget, Vol. 6, No. 32 /, Vol. 6, No. 32 The NEXT-1 (Next generation personalized tx with multi-omics and preclinical model) trial: prospective molecular screening trial of metastatic solid cancer patients, a feasibility analysis

More information

Youngnam Cho. National Cancer Center Biomarker Branch

Youngnam Cho. National Cancer Center Biomarker Branch Youngnam Cho National Cancer Center Biomarker Branch Contents 1. Liquid Biopsy 2. Circulating Tumor Cells from Blood 3. Cell-free DNA from Blood 1. Liquid biopsy Cancer Diagnosis IMAGING TISSUE BIOPSY

More information

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~

Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ 16 th Dec. 2016. ESMO Preceptorship Program Non-Small-Cell Lung Cancer @Singapore Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ Research Institute for Disease of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics

More information

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng. Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class

More information

Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%

Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60% Supplemental Table 1: Estimated tumor purity, allele frequency, and independent read depth for all gene mutations classified as either potentially pathogenic or VUS in the metatastic and primary tumor

More information

Next generation diagnostics Bringing high-throughput sequencing into clinical application

Next generation diagnostics Bringing high-throughput sequencing into clinical application Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no

More information

Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis

Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Supplementary Material Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Kwangwoo Kim 1,, So-Young Bang 1,, Katsunori Ikari 2,3, Dae

More information

Comprehensive Analyses of Circulating Cell- Free Tumor DNA

Comprehensive Analyses of Circulating Cell- Free Tumor DNA Comprehensive Analyses of Circulating Cell- Free Tumor DNA Boston, MA June 28th, 2016 Derek Murphy, Ph.D. Scientist, Research and Development Personal Genome Diagnostics Acquisition of Somatic Alterations

More information

Result of screening and surveillance colonoscopy in young Korean adults < 50 years

Result of screening and surveillance colonoscopy in young Korean adults < 50 years SEP 25, 2017 Result of screening and surveillance colonoscopy in young Korean adults < 50 years Jae Myung Cha, MD. PhD. Department of Internal Medicine, Kyung Hee University Hospital at Gang Dong, Kyung

More information

Disclosure of Relevant Financial Relationships NON-SMALL CELL LUNG CANCER: 70% PRESENT IN ADVANCED STAGE

Disclosure of Relevant Financial Relationships NON-SMALL CELL LUNG CANCER: 70% PRESENT IN ADVANCED STAGE MORPHOLOGY AND MOLECULAR TESTING IN NON-SMALL CELL OF LUNG NEW FRONTIEIRS IN CYTOPATHOLOGY PRACTICE American Society for Cytopathology San Antonio, Texas Sunday March 5, 2017 Disclosure of Relevant Financial

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology

More information

Supplementary Information

Supplementary Information Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho

More information

Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies

Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Protein Domain-Centric Approach to Study Cancer Somatic Mutations from High-throughput Sequencing Studies Dr. Maricel G. Kann Assistant Professor Dept of Biological Sciences UMBC 2 The term protein domain

More information

ECMC cfdna consensus meeting

ECMC cfdna consensus meeting ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients

More information

Pathologists role Ancillary Studies in Cytology Challenges. Pre-analytical issues. LUNG CYTOLOGY Predictive markers and molecular tests

Pathologists role Ancillary Studies in Cytology Challenges. Pre-analytical issues. LUNG CYTOLOGY Predictive markers and molecular tests Pathologists role LUNG CYTOLOGY Predictive markers and molecular tests Prof. Fernando Schmitt Department of Pathology and Oncology, Medical Faculty of Porto University Head of Pathology Unit, IPATIMUP

More information

National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant

National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The NSABP Foundation

More information

Identification of Potential Therapeutic Targets by Molecular and Genomic Profiling of 628 Cases of Uterine Serous Carcinoma

Identification of Potential Therapeutic Targets by Molecular and Genomic Profiling of 628 Cases of Uterine Serous Carcinoma Identification of Potential Therapeutic Targets by Molecular and Genomic Profiling of 628 Cases of Uterine Serous Carcinoma Nathaniel L Jones 1, Joanne Xiu 2, Sandeep K. Reddy 2, Ana I. Tergas 1, William

More information

K-Ras signalling in NSCLC

K-Ras signalling in NSCLC Targeting the Ras-Raf-Mek-Erk pathway Egbert F. Smit MD PhD Dept. Pulmonary Diseases Vrije Universiteit VU Medical Centre Amsterdam, The Netherlands K-Ras signalling in NSCLC Sun et al. Nature Rev. Cancer

More information

Next generation sequencing analysis - A UK perspective. Nicholas Lea

Next generation sequencing analysis - A UK perspective. Nicholas Lea Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population

More information

Developments in small cell lung cancer G. Giaccone, MD PhD Chief, Medical Oncology Branch and Affiliates National Cancer Institute Bethesda MD USA

Developments in small cell lung cancer G. Giaccone, MD PhD Chief, Medical Oncology Branch and Affiliates National Cancer Institute Bethesda MD USA Developments in small cell lung cancer G. Giaccone, MD PhD Chief, Medical Oncology Branch and Affiliates National Cancer Institute Bethesda MD USA Geneva April 20, 2012 Neuroendocrine tumors of lung Typical

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

2017 Obesity Fact Sheet

2017 Obesity Fact Sheet 2017 Fact Sheet Welcome message 2017 Fact Sheet Dear Colleagues, It is my great honor and pleasure to publish the 2017 Fact Sheet of the Korean Society for the Study of (KSSO). The 2017 Fact Sheet is the

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Molecular Probes Introducing 14 new probes

Molecular Probes Introducing 14 new probes Molecular Probes Introducing 14 new probes Gene and Chromosome Probes Dual Colour ISH INFORM HER2 Dual ISH DNA Probe Cocktail Assay Product Part Number INFORM HER2 Dual ISH DNA Probe Cocktail 800-4422

More information

Targeted next-generation sequencing of 50 cancer-related genes in Japanese patients with oral squamous cell carcinoma

Targeted next-generation sequencing of 50 cancer-related genes in Japanese patients with oral squamous cell carcinoma Original Article Targeted next-generation sequencing of 50 cancer-related genes in Japanese patients with oral squamous cell carcinoma Tumor Biology September 2018: 1 9 Ó The Author(s) 2018 Article reuse

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/3/75/75ra26/dc1 Supplementary Materials for Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors Lecia V. Sequist,*

More information

ACTIVITY 2: EXAMINING CANCER PATIENT DATA

ACTIVITY 2: EXAMINING CANCER PATIENT DATA OVERVIEW Refer to the Overview of Cancer Discovery Activities for Key Concepts and Learning Objectives, Curriculum Connections, and Prior Knowledge, as well as background information, references, and additional

More information

Targeted Molecular Diagnostics for Targeted Therapies in Hematological Disorders

Targeted Molecular Diagnostics for Targeted Therapies in Hematological Disorders Targeted Molecular Diagnostics for Targeted Therapies in Hematological Disorders Richard D. Press, MD, PhD Dept of Pathology Knight Cancer Institute Knight Diagnostic Labs Oregon Health & Science University

More information

Optimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey

Optimum Sequencing of EGFR targeted therapy in NSCLC. Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Optimum Sequencing of EGFR targeted therapy in NSCLC Dr. Sema SEZGİN GÖKSU Akdeniz Univercity, Antalya, Turkey Lung cancer NSCLC SCLC adeno squamous EGFR ALK ROS1 BRAF HER2 KRAS EGFR Transl Lung Cancer

More information

Kalydeco. Kalydeco (ivacaftor) Description

Kalydeco. Kalydeco (ivacaftor) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.45.03 Subject: Kalydeco Page: 1 of 6 Last Review Date: November 30, 2018 Kalydeco Description Kalydeco

More information

Best of ASCO 2014 Sarcoma

Best of ASCO 2014 Sarcoma Best of ASCO 2014 Sarcoma Robin L Jones Seattle Cancer Care Alliance University of Washington Fred Hutchinson Cancer Research Center Presentation Outline Overview progress made in sarcoma Highlight 2 trials

More information

Supplementary Information. Potential pitfalls of mass spectrometry to uncover mutations in childhood soft tissue

Supplementary Information. Potential pitfalls of mass spectrometry to uncover mutations in childhood soft tissue Supplementary Information Potential pitfalls of mass spectrometry to uncover mutations in childhood soft tissue sarcoma: A report from the Children s Oncology Group Lin Xu 1,6, Raphael A. Wilson 1,6, Theodore

More information

KEY FINDINGS 1. Potential Clinical Benefit in Non-Small Cell Lung Cancer with Gefitinib, Erlotinib, Afatinib due to EGFR E746_A750del. 2. Potential Cl

KEY FINDINGS 1. Potential Clinical Benefit in Non-Small Cell Lung Cancer with Gefitinib, Erlotinib, Afatinib due to EGFR E746_A750del. 2. Potential Cl PATIENT INFO SAMPLE REFERING PHYSICIAN COPY TO (if different from ordering) Name: John Smith Date Collected: 10/23/2016 Name: Oncologist, M.D. Name: Pathologist, M.D. DOB: 04/22/1937 Date Received: 10/24/2016

More information

Prior Authorization. Additional Information:

Prior Authorization. Additional Information: Genetic Testing for Cowden Syndrome - PTEN Gene MP9488 Covered Service: Prior Authorization Required: Additional Information: Yes when meets criteria below Yes as shown below Pre and post-test genetic

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Clinical, Pathologic and Molecular Updates

Clinical, Pathologic and Molecular Updates Colorectal Cancer: Clinical, Pathologic and Molecular Updates Joanna A. Gibson, M.D./Ph.D. Yale University School of Medicine/Yale New Haven Hospital, Department of Pathology Gastrointestinal, Pancreaticobiliary

More information