CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

Size: px
Start display at page:

Download "CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing."

Transcription

1 Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder tumors (left) with copy number analysis of the CDH1 locus for two representative cases (right). All six tumors analyzed harbored truncating loss-of-function mutations in CDH1. Evidence for copy-neutral loss of the wild-type allele and loss of heterozygosity was observed in the two samples shown (asterisks above heat map). 1

2 Supplementary Figure 2 Pattern of CDH1 alterations and select co-alterations in plasmacytoid-variant bladder cancers, lobular breast carcinomas and diffuse gastric carcinomas. With the exception of CDH1 alterations, the pattern of genetic co-alterations in lobular breast and diffuse gastric carcinomas was distinct from that of plasmacytoid-variant bladder cancer. Somatic mutation data for the lobular breast carcinoma and diffuse gastric carcinomas was derived from The Cancer Genome Atlas. 2

3 Supplementary Figure 3 Phylogenetic tree depicting the divergent evolution of plasmacytoid-variant carcinoma and urothelial carcinoma, NOS, histologies within a tumor with distinct histologic regions. Exon capture and deep sequencing of two adjacent portions of a bladder tumor harboring distinct regions of plasmacytoid-variant and urothelial carcinoma, NOS, histologies. CDKN2A and PIK3C2G alterations were shared by plasmacytoid-variant histology and urothelial carcinoma, NOS, areas within the same tumor, suggesting that these are truncal alterations occurring within a common precursor cell. However, a CDH1 frameshift mutation was unique to plasmacytoid-variant histology, and the remaining genetic alteration profiles of the two histologic components were distinct. Magenta and green lines in the phylogenetic tree indicate plasmacytoid-variant and urothelial carcinoma, NOS, histologies, respectively. 3

4 Supplementary Figure 4. CDH1 promoter hypermethylation is a mechanism for loss of expression of E-cadherin in plasmacytoid-variant bladder cancer. Bisulfite sequencing of the CDH1 promoter CpG island showed hypermethylation in four of five CDH1 wild type plasmacytoid-variant bladder tumors. Representative urothelial carcinoma, NOS, specimens (U1, U2) that were subjected to bisulfite sequencing are shown to lack CDH1 promoter hypermethylation. A schematic of the CpG island is depicted with red circles representing methylated CpG sites. 4

5 Supplementary Figure 5 E-cadherin expression is absent in the invasive component of plasmacytoid-variant tumors. Low magnification H&E showing the in situ and invasive regions of plasmacytoid-variant tumors is displayed on the left. Highmagnification views with E-cadherin IHC of each of these regions are shown on the right. E-cadherin expression is retained within the in situ component and is absent from the invasive regions of this tumor. 5

6 Supplementary Table 1: CDH1 alterations identified in plasmacytoid variant bladder cancer ID Age/sex No of mutations CDH1 mutation E-cadherin IHC invasive region E-cadherin IHC in situ region Source of germline DNA 1 75/F 19 E58* 0 NA Benign pelvic lymph node 2 50/M 10 E806* 0 NA Benign pelvic lymph node 3 ǂ 72/F 8 Q129* 0 Membranous Benign pelvic lymph node 4 60/F 12 E648* 0 NA Benign pelvic lymph node 5 ǂ 57/F 8 Q677* 0 NA Benign pelvic lymph node 6 58/F 7 Q647* 0 NA Benign pelvic lymph node 7 72/F 23 E35* 0 NA Benign pelvic lymph node 8 40/F 17 W4* 0 NA Benign ovarian tissue 9 48/M 5 Q129* 0 Membranous Benign pelvic lymph node 10 ǂ 67/M 14 S70Pfs*13 0 NA Benign pelvic lymph node 11 ǁ 67/M 4 WT Membranous NA Benign pelvic lymph node 12 60/M 6 C163Afs*52 0 Membranous Benign pelvic lymph node 13 70/M 5 T366Rfs*5 0 NA Benign pelvic lymph node 14 68/F 9 E386K, F462Hfs*16 0 Membranous Benign cervical tissue 15 ǂ 69/M 7 F730Vfs*18 0 Membranous Benign skin from biopsy 16 67/M 13 X178_splice 0 NA Benign pelvic lymph node 17 54/F 4 X522_splice 0 NA Benign pelvic lymph node 18 ǂ 63/F 7 X522_splice 0 Membranous Benign small bowel segment 19 55/M 7 X441_splice Membranous Membranous Benign pelvic lymph node 20 56/M 23 V157F Weak cytoplasmic NA Benign pelvic lymph node 21 ǂ 73/M 6 S9*, D288N 0 Membranous Benign pelvic lymph node 22 83/M 5 WT, Hypermethylated 0 NA Benign prostatic tissue 23 71/M 2 WT 0 Membranous Benign pelvic lymph node 24 59/M 11 WT, Hypermethylated 0 Membranous Benign pelvic lymph node 25 76/M 30 WT, Hypermethylated 0 Membranous Benign pelvic lymph node 26 54/M 1 WT, Hypermethylated 0 NA Benign pelvic lymph node 27 Ɨ 60/M 18 E247* 0 Membranous Peripheral blood 28 Ɨ 66/F 8 R598* 0 NA Peripheral blood 29 Ɨ 84/M 9 Q23* 0 Membranous Peripheral blood 30 Ɨ 55/M 8 Q346*, Q351*, P373A 0 Membranous Peripheral blood 31 Ɨ 52/M 8 deletion: c.134_ del 0 Membranous Peripheral blood 32 Ɨ 36/M 118 E210Q 0 Membranous Peripheral blood Ɨ: Prospective cohort samples ǂ: Whole exome sequenced samples; WT: Wild type; M: Male; F: Female ǁ: Samples 10 and 11 are derived from the same tumor. 10 displays plasmacytoid features and 11 displays urothelial carcinoma, NOS features (see Supplemental Figure 3)

7 Supplementary Table 2: Primer sequences for bisulfite sequencing and CRISPR nickase Bisulfite sequencing primers for CDH1 5'-GGTAGGTGAATTTTTAGTTAATTAG-3' 5 -AATACCTACAACAACAACAACAAC-3' CDH1 exon 3 oligonucleotides used for LentiCRISPR v2 nickase construction 5 -CACCGATAGGCTG TCCTTTGTCGAC-3 5 -CACCGCCTCGACACCCGATTCAAAG-3

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

MSI positive MSI negative

MSI positive MSI negative Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden

More information

Nature Genetics: doi: /ng.2995

Nature Genetics: doi: /ng.2995 Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

More information

List of Available TMAs in the PRN

List of Available TMAs in the PRN TMA RPCI_BrainCa01 RPCI_BrCa03 RPCI_BrCa04 RPCI_BrCa05 RPCI_BrCa0 RPCI_BrCa07 RPCI_BrCa08 RPCI_BrCa15 RPCI_BrCa1 RPCI_BrCa17 RPCI_BrCa18 RPCI_BrCa19 RPCI_BrCa20 RPCI_BrCa21 RPCI_BrCa24 RPCI_BrCa25 RPCI_BrCa2

More information

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align

More information

Clonal evolution of human cancers

Clonal evolution of human cancers Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio

More information

Multiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer

Multiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer Multiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer A Kuijper SS Preisler-Adams FD Rahusen JJP Gille E van der Wall PJ van Diest J Clin Pathol

More information

The Cancer Genome Atlas

The Cancer Genome Atlas The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are

More information

No evidence of clonally selected somatic genomic alterations in cancer associated

No evidence of clonally selected somatic genomic alterations in cancer associated Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,

More information

Supplementary Figure 1. A - MSH6 p.val282thrfs*10: Endome. Endome. Colon

Supplementary Figure 1. A - MSH6 p.val282thrfs*10: Endome. Endome. Colon Supplementary Figure 1 - MSH6 p.val282hrfs*10: 1780 1785 C C C C C 1 B - MSH6 p.phe1088leufs*5: 1820 1810 Rectal Rectal Gastric C C C C C C Rectal C 2 C - MSH6 p.rg1172lysfs*5: 1745 1740 Ovarian 3 D -

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

Urinary Bladder: WHO Classification and AJCC Staging Update 2017

Urinary Bladder: WHO Classification and AJCC Staging Update 2017 Urinary Bladder: WHO Classification and AJCC Staging Update 2017 Houston Society of Clinical Pathologists 58 th Annual Spring Symposium Houston, TX April 8, 2017 Jesse K. McKenney, MD Classification

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide

More information

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser

Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser Melissa S. Cline 1*, Brian Craft 1, Teresa Swatloski 1, Mary Goldman 1, Singer Ma 1, David Haussler 1, Jingchun Zhu 1 1 Center for Biomolecular

More information

Supplementary Note. Nature Genetics: doi: /ng.2928

Supplementary Note. Nature Genetics: doi: /ng.2928 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28

More information

Avances en patología gástrica. Novedades de la clasificación WHO (2010)

Avances en patología gástrica. Novedades de la clasificación WHO (2010) XXV Congreso de la Sociedad Española de Anatomía Patológica y División Española de la International Academy of Pathology Avances en patología gástrica. Novedades de la clasificación WHO (2010) Fátima Carneiro

More information

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification

More information

Recent advances in breast cancers

Recent advances in breast cancers Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response

More information

Interpretation of p53 Immunostains. P53 Mutations are Ubiquitous in High Grade Serous Carcinoma. Diffuse strong positive nuclear staining

Interpretation of p53 Immunostains. P53 Mutations are Ubiquitous in High Grade Serous Carcinoma. Diffuse strong positive nuclear staining Stains for Tumor Classification p53 p16 WT1 HMGA2 P53 Mutations are Ubiquitous in High Grade Serous Carcinoma Source Ahmed et al Australian Ovarian Cancer Study Cancer Genome Atlas Research Network Cases

More information

The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis

The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics

More information

Overview of the immunohistochemical and sequencing results from 35 non-paraganglionic tumors

Overview of the immunohistochemical and sequencing results from 35 non-paraganglionic tumors Supplemental Figure 1. Overview of the immunohistochemical and sequencing results from 35 non-paraganglionic tumors arising in 26 SDH mutation carriers. Abbreviations Supplemental Figure 1: SDH: succinate

More information

Serrated Polyps and a Classification of Colorectal Cancer

Serrated Polyps and a Classification of Colorectal Cancer Serrated Polyps and a Classification of Colorectal Cancer Ian Chandler June 2011 Structure Serrated polyps and cancer Molecular biology The Jass classification The familiar but oversimplified Vogelsteingram

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09626 Suppl. Table 1. Sequencing primers. B-RAF Forward Reverse Exon1 CGGCGACTTCTCGTCGTCTC CTGCATGACGGAGAGGGACA Exon2 CTGGCAGTTACTGTGATGTAGTTG CTTCCCAAATCTATTCCTAATCCCACC Exon3 GGACCATCTAGATATCACATATG

More information

Quiz. b. 4 High grade c. 9 Unknown

Quiz. b. 4 High grade c. 9 Unknown Quiz 1. 10/11/12 CT scan abdomen/pelvis: Metastatic liver disease with probable primary colon malignancy. 10/17/12 Colonoscopy with polypectomy: Adenocarcinoma of sigmoid colon measuring at least 6 mm

More information

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major

More information

Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL

Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Round Table: Tissue Biopsy versus Liquid Biopsy César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Introduction Classic Advantages of liquid biopsy collection over standard biopsy Standard biopsy

More information

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University

More information

WHAT IS A GENE? CHROMOSOME DNA PROTEIN. A gene is made up of DNA. It carries instructions to make proteins.

WHAT IS A GENE? CHROMOSOME DNA PROTEIN. A gene is made up of DNA. It carries instructions to make proteins. WHAT IS A GENE? CHROMOSOME GENE DNA A gene is made up of DNA. It carries instructions to make proteins. The proteins have specific jobs that help your body work normally. PROTEIN 1 WHAT HAPPENS WHEN THERE

More information

4/12/2018. MUSC Pathology Symposium Kiawah Island April 18, Jesse K. McKenney, MD

4/12/2018. MUSC Pathology Symposium Kiawah Island April 18, Jesse K. McKenney, MD MUSC Pathology Symposium Kiawah Island April 18, 2018 Jesse K. McKenney, MD 1 Urothelial Carcinoma with Alternative Differentiation 2 Urothelial Carcinoma with Alternative Differentiation Recognition as

More information

Proactive Patient Paves the Way for Genetic Testing of Eight Family Members

Proactive Patient Paves the Way for Genetic Testing of Eight Family Members CASE STUDY Proactive Patient Paves the Way for Genetic Testing of Eight Family Members Quick Summary Samar Mohite * was diagnosed with colon adenocarcinoma at the age of 49 years. Genetic counselling was

More information

Case study 1. Rie Horii, M.D., Ph.D. Division of Pathology Cancer Institute Hospital, Japanese Foundation for Cancer Research

Case study 1. Rie Horii, M.D., Ph.D. Division of Pathology Cancer Institute Hospital, Japanese Foundation for Cancer Research NCCN/JCCNB Seminar in Japan April 15, 2012 Case study 1 Rie Horii, M.D., Ph.D. Division of Pathology Cancer Institute Hospital, Japanese Foundation for Cancer Research Present illness: A 50y.o.premenopausal

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from

More information

Hereditary Gastric Cancer

Hereditary Gastric Cancer Hereditary Gastric Cancer Dr Bastiaan de Boer Consultant Pathologist Department of Anatomical Pathology PathWest Laboratory Medicine, QE II Medical Centre Clinical Associate Professor School of Pathology

More information

8 years later! Next Generation Sequencing. Pathogenic Findings: HNF1A c.864delinscc, p.g292rfs*25 (NM_ ) (VAF: 59%) HNF1A Loss

8 years later! Next Generation Sequencing. Pathogenic Findings: HNF1A c.864delinscc, p.g292rfs*25 (NM_ ) (VAF: 59%) HNF1A Loss 8 years later! Next Generation Sequencing Pathogenic Findings: HNF1A c.864delinscc, p.g292rfs*25 (NM_000545.6) (VAF: 59%) HNF1A Loss Interpretation HNF1A c.864delinscc, p.g292rfs*25 (NM_000545.6) This

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

Tumor suppressor genes D R. S H O S S E I N I - A S L

Tumor suppressor genes D R. S H O S S E I N I - A S L Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases. Supplementary Figure 1 Clinical timeline for the discovery WES cases. This illustrates the timeline of the disease events during the clinical course of each patient s disease, further indicating the available

More information

Supplemental Figure legends

Supplemental Figure legends Supplemental Figure legends Supplemental Figure S1 Frequently mutated genes. Frequently mutated genes (mutated in at least four patients) with information about mutation frequency, RNA-expression and copy-number.

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

BRCAplus. genetic testing for hereditary breast cancer

BRCAplus. genetic testing for hereditary breast cancer BRCAplus genetic testing for hereditary breast cancer Developed in collaboration with Fox Chase Cancer Center and the Arcadia University Genetic Counseling Program. Causes of Hereditary Breast Cancer familial

More information

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University

More information

CASE STUDY. Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members. Introduction. Patient Profile.

CASE STUDY. Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members. Introduction. Patient Profile. CASE STUDY Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members Introduction Most cancers are caused by genetic damage resulting from random mutations and exposure to

More information

LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)!

LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! Kathryn Singh, MPH, MS, LCGC Associate Clinical Professor Assistant Director, Graduate Program in Genetic Counseling Division of Genetic and Genomic

More information

Feasibility of Clinical Trial Implementation Genetically Eligible Prostate Cancer Patients Oliver Sartor, MD Cathryn E, Garvey, MS December 3, 2015

Feasibility of Clinical Trial Implementation Genetically Eligible Prostate Cancer Patients Oliver Sartor, MD Cathryn E, Garvey, MS December 3, 2015 Feasibility of Clinical Trial Implementation Genetically Eligible Prostate Cancer Patients Oliver Sartor, MD Cathryn E, Garvey, MS December 3, 2015 Study Name Feasibility of Patient Population for proposed

More information

The Next Generation of Hereditary Cancer Testing

The Next Generation of Hereditary Cancer Testing The Next Generation of Hereditary Cancer Testing Why Genetic Testing? Cancers can appear to run in families. Often this is due to shared environmental or lifestyle patterns, such as tobacco use. However,

More information

WHAT IS A GENE? CHROMOSOME DNA PROTEIN. A gene is made up of DNA. It carries instructions to make proteins.

WHAT IS A GENE? CHROMOSOME DNA PROTEIN. A gene is made up of DNA. It carries instructions to make proteins. WHAT IS A GENE? CHROMOSOME E GEN DNA A gene is made up of DNA. It carries instructions to make proteins. The proteins have specific jobs that help your body work normally. PROTEIN 1 WHAT HAPPENS WHEN THERE

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA

OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.

More information

The use of diagnostic FFPE material in cancer epidemiology research

The use of diagnostic FFPE material in cancer epidemiology research The use of diagnostic FFPE material in cancer epidemiology research Neil O Callaghan Genetic Epidemiology Laboratory Department of Pathology The University of Melbourne www.pedigree.org.au Overview Who

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

A patient with recurrent bladder cancer presents with the following history:

A patient with recurrent bladder cancer presents with the following history: MP/H Quiz A patient with recurrent bladder cancer presents with the following history: 9/23/06 TURB 1/12/07 TURB 4/1/07 TURB 7/12/07 TURB 11/14/07 Non-invasive papillary transitional cell carcinoma from

More information

Supplementary Information

Supplementary Information 1 Supplementary Information MATERIALS AND METHODS Study subjects Exome-sequenced HBOC patients Clinical characteristics of 24 exome-sequenced HBOC patients are presented in Table 1. Table 1. Clinical characteristics

More information

An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage

An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage Aaron M Newman1,2,7, Scott V Bratman1,3,7, Jacqueline To3, Jacob F Wynne3, Neville C W Eclov3, Leslie A Modlin3,

More information

Basement membrane in lobule.

Basement membrane in lobule. Bahram Memar, MD Basement membrane in lobule. Normal lobule-luteal phase Normal lobule-follicular phase Lactating breast Greater than 95% are adenocarcinomas in situ carcinomas and invasive carcinomas.

More information

Supplementary Figure 1 Overall study design

Supplementary Figure 1 Overall study design Supplementary Figure 1 Overall study design We obtained 19 tumour specimens from 14 men with prostate cancer who harboured pathogenic germline BRCA2-mutations. Germline DNA was available for five patients

More information

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24): DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence

More information

Update on Hereditary Gastric Cancer. Dr. Savtaj Brar MD MSc Surgical Oncologist Assistant Professor of Surgery

Update on Hereditary Gastric Cancer. Dr. Savtaj Brar MD MSc Surgical Oncologist Assistant Professor of Surgery Update on Hereditary Gastric Cancer Dr. Savtaj Brar MD MSc Surgical Oncologist Assistant Professor of Surgery Disclosures None Outline 1. Discuss new consensus guidelines on hereditary diffuse gastric

More information

The Cancer Genome Atlas & International Cancer Genome Consortium

The Cancer Genome Atlas & International Cancer Genome Consortium The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1

More information

Next generation histopathological diagnosis for precision medicine in solid cancers

Next generation histopathological diagnosis for precision medicine in solid cancers Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics

More information

Expert Interview: Inherited Susceptibility to Cancer with Dr. Nicoleta Voian

Expert Interview: Inherited Susceptibility to Cancer with Dr. Nicoleta Voian Expert Interview: Inherited Susceptibility to Cancer with Dr. Nicoleta Voian ANNOUNCER OPEN: Welcome to CME on ReachMD. This segment, entitled Inherited Susceptibility to Cancer: What Do Primary Care Providers

More information

A Practicum Approach to CS: GU Prostate, Testis, Bladder, Kidney, Renal Pelvis. Jennifer Ruhl, RHIT, CCS, CTR Janet Stengel, RHIA, CTR

A Practicum Approach to CS: GU Prostate, Testis, Bladder, Kidney, Renal Pelvis. Jennifer Ruhl, RHIT, CCS, CTR Janet Stengel, RHIA, CTR A Practicum Approach to CS: GU Prostate, Testis, Bladder, Kidney, Renal Pelvis Jennifer Ruhl, RHIT, CCS, CTR Janet Stengel, RHIA, CTR Survey Questions and Answers 250 Responses 2 Question #1 A gentleman

More information

04/10/2018 HIGH RISK BREAST LESIONS. Pathology Perspectives of High Risk Breast Lesions ELEVATED RISK OF BREAST CANCER HISTORICAL PERSPECTIVES

04/10/2018 HIGH RISK BREAST LESIONS. Pathology Perspectives of High Risk Breast Lesions ELEVATED RISK OF BREAST CANCER HISTORICAL PERSPECTIVES Pathology Perspectives of High Risk Breast Lesions Savitri Krishnamurthy MD Professor of Pathology Deputy Division Head Director of Clinical Trials, Research and Development The University of Texas MD

More information

Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber

Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber jweber@dom.wustl.edu Oncogenes & Cancer DNA Tumor Viruses Simian Virus 40 p300 prb p53 Large T Antigen Human Adenovirus p300 E1A

More information

Germline Testing for Hereditary Cancer with Multigene Panel

Germline Testing for Hereditary Cancer with Multigene Panel Germline Testing for Hereditary Cancer with Multigene Panel Po-Han Lin, MD Department of Medical Genetics National Taiwan University Hospital 2017-04-20 Disclosure No relevant financial relationships with

More information

ACCME/Disclosures. Case History 4/13/2016. USCAP GU Specialty Conference Case 3. Ann Arbor, MI

ACCME/Disclosures. Case History 4/13/2016. USCAP GU Specialty Conference Case 3. Ann Arbor, MI USCAP GU Specialty Conference Case 3 March 2016 L. Priya Kunju, M.D. University of Michigan Health System Ann Arbor, MI University of Michigan Health System ACCME/Disclosures The USCAP requires that anyone

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray

Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,

More information

My Personalized Breast Cancer Worksheet

My Personalized Breast Cancer Worksheet My Personalized Breast Cancer Worksheet KNOW For Early-Stage Breast Cancer. No Questions. Only Results. No two tumors are alike. What are the characteristics of your breast cancer and how will that effect

More information

Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients

Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients Vertical Magnetic Separation of Circulating Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients Chang Eun Yoo 1,2#, Jong-Myeon Park 3#, Hui-Sung Moon 1,2, Je-Gun Joung 2, Dae-Soon Son

More information

Kimberly Rohan ANP-BC, AOCN Nurse Practitioner Edward Cancer Center

Kimberly Rohan ANP-BC, AOCN Nurse Practitioner Edward Cancer Center Kimberly Rohan ANP-BC, AOCN Nurse Practitioner Edward Cancer Center Objective The nurse will be able to explain biomarkers and their implications to patient s prescribed treatment plan Biomarkers Use in

More information

CANCER GENETICS PROVIDER SURVEY

CANCER GENETICS PROVIDER SURVEY Dear Participant, Previously you agreed to participate in an evaluation of an education program we developed for primary care providers on the topic of cancer genetics. This is an IRB-approved, CDCfunded

More information

Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014

Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Policy Number 2.04.82 Molecular Markers in Fine Needle Aspirates of the Thyroid Medical Policy Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Disclaimer Our medical policies

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies

Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies Disclosures MDxHealth Scientific Advisor 2 Case Study 54-year-old man referred for a PSA of 7 - Healthy, minimal

More information

MRC-Holland MLPA. Description version 18; 09 September 2015

MRC-Holland MLPA. Description version 18; 09 September 2015 SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the

More information

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Outline Germline testing CDKN2A BRCA2 BAP1 Somatic testing Gene expression profiling (GEP) BRAF Germline vs Somatic testing

More information

Update on Exact Sciences Molecular CRC Screening Test. November 16 th, 2011

Update on Exact Sciences Molecular CRC Screening Test. November 16 th, 2011 Update on Exact Sciences Molecular CRC Screening Test November 16 th, 2011 0 Safe Harbor Statement Certain matters contained in this presentation, other than historical information, consist of forward-looking

More information

Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium

Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Ulrike Peters Fred Hutchinson Cancer Research Center University of Washington U01-CA137088-05, PI: Peters

More information

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease) CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions

More information

Dr. dr. Primariadewi R, SpPA(K)

Dr. dr. Primariadewi R, SpPA(K) Curriculum Vitae Dr. dr. Primariadewi R, SpPA(K) Education : Medical Doctor from UKRIDA Doctoral Degree from Faculty of Medicine University of Indonesia Pathologist Specialist and Consultant from Faculty

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

SEER Summary Stage Still Here!

SEER Summary Stage Still Here! SEER Summary Stage Still Here! CCRA NORTHERN REGION STAGING SYMPOSIUM SEPTEMBER 20, 2017 SEER Summary Stage Timeframe: includes all information available through completion of surgery(ies) in the first

More information

Appendix ZOOM Etude pour site internet

Appendix ZOOM Etude pour site internet Appendix ZOOM Etude pour site internet Indication Traitement adjuvant pour des patients présentant une mutation germinale des gènes BRCA1/2 et un risque élevé de cancer du sein primaire HER2 négatif Title

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC. Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION CYTOPATHOLOGY Monday, April 26, 2013 FACULTY COPY

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION CYTOPATHOLOGY Monday, April 26, 2013 FACULTY COPY GOAL: MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION CYTOPATHOLOGY Monday, April 26, 2013 FACULTY COPY 1. Understated the role of cytopathology in the clinical management of the patient and recognize

More information

Epigenetic inactivation of the CpG demethylase TET1 as a DNA

Epigenetic inactivation of the CpG demethylase TET1 as a DNA Epigenetic inactivation of the CpG demethylase TET1 as a DNA methylation feedback loop in human cancers Lili Li 1, Chen Li 1, Haitao Mao 1, Zhenfang Du 1, Wai Yee Chan 2, Paul Murray 3, Bing Luo 4, Anthony

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information