Novel chemoimmunotherapeutic strategy for hepatocellular carcinoma based on a genomewide
|
|
|
- Hector Gaines
- 5 years ago
- Views:
Transcription
1 Novel chemoimmunotherapeutic strategy for hepatocellular carcinoma based on a genomewide association study Running title: GWAS-based HCC chemoimmunotherapy Kaku Goto, Ph.D., Dorcas A. Annan, M.D., Tomoko Morita, Ph.D., Wenwen Li, M.D., Ph.D., Ryosuke Muroyama, M.D., Ph.D., Yasuo Matsubara, M.D., Ph.D., Sayaka Ito, Ryo Nakagawa, M.D., Yasushi Tanoue, M.D., Ph.D., Masahisa Jinushi, M.D., Ph.D., Naoya Kato, M.D., Ph.D. Supplementary Information
2 Supplementary Figure S
3 Supplementary Figure S
4 A B. NKGD/GAPDH. NKGD... VOR (µm) C Relative cell viability..... VOR (µm) Supplementary Figure S
5 Day Day Day Anti-NKGD VOR VOR/Anti-NKGD Anti-NKGD VOR VOR/Anti-NKGD Anti-NKGD VOR VOR/Anti-NKGD Day Day Day Anti-NKGD VOR/Anti-NKGD 8 Anti-NKGD VOR/Anti-NKGD 9 8 Anti-NKGD VOR/Anti-NKGD Day 9 8 Anti-NKGD VOR VOR/Anti-NKGD Supplementary Figure S
6 A B prb/gapdh PTEN/GAPDH MICA/GAPDH 8 9 VOR (µm) VOR (µm) DL-NaL (mm) C MICA/GAPDH VOR (-) VOR (+) BMS- (µm) Supplementary Figure S
7 Supplementary figure legends Supplementary Figure S. CoA metabolisms. The relative levels of detected metabolites are mapped in the indicated metabolic pathways as line graphs at,, 8, and h post-treatment with VOR as in Figure. N.D., not detected. Supplementary Figure S. The metabolism of branched-chain and aromatic amino acids. The relative levels of detected metabolites are mapped in the indicated metabolic pathways as line graphs at,, 8, and h post-treatment with VOR as in Figure. N.D., not detected. Supplementary Figure S. Effects of VOR on NK cells. (A) NK9MI cells treated with VOR (,, and µm in blue, purple, and red, respectively) for h were immunolabeled with anti- MICA antibody and fluorescent signals were detected by flow cytometry analysis, with the isotype controls shown as gray histograms. Likewise MICA mrna level (B) and relative cell viability (C) were measured in NK9MI cells treated with VOR at the indicated concentrations for h. Supplementary Figure S. Tumor growth levels in vivo over the treatment. The median relative tumor growth levels in vivo were demonstrated by box plots at Day,,,,,, and. Supplementary Figure S. Correlation between metabolism and HDACi-mediated MICA induction. (A) PLC/PRF/ cells were treated with µm VOR for 8 h and relative prb and
8 PTEN mrna levels were quantified by qrt-pcr with normalization to GAPDH. (B) PLC/PRF/ cells were treated with DL-NaL at the indicated concentrations for days and relative MICA mrna levels were quantified by qrt-pcr with normalization to GAPDH. (C) PLC/PRF/ cells were treated with BMS- at the indicated concentrations in the absence or presence of. µm VOR for h and relative MICA mrna levels were quantified by qrt- PCR with normalization to GAPDH.
9 Supplementary Table Supplementary Table S. Transcription factors for MICA expression. Name Cell line Reference Extracellular signal-regulated kinase ARK Glycogen synthase kinase Jurkat Heat shock transcription factor HeLa Phosphatidylinositol kinase PANC-, BxPC- Specificity protein HeLa, HepG EF* SKO- Nuclear factor kappa B* HeLa STAT* SKO- * Independent of HDACis
10 Supplementary Table S. The actual tumor sizes in vivo. Days Tumor size (mm )* Control Anti-NKGD VOR VOR/ Anti-NKGD 8 9. ±. 8. ±.9. ±. 9. ±.8 9. ±.. ±.. ± 8.. ±. 8.9 ±.8. ± 8.. ± 9.8. ±. 9. ± ±. 9. ±..8 ±.. ±.9. ±.9 8. ±..9 ±.8.9 ±.. ±.9 9. ±.9 9. ±..9 ±..8 ± ± ±.. ±.. ± 8.. ±. 9. ±.98 * Means ± SD
11 Supplementary references Wu, X., Tao, Y., Hou, J., Meng, X. & Shi, J. Valproic acid upregulates NKGD ligand expression through an ERK-dependent mechanism and potentially enhances NK cellmediated lysis of myeloma. Neoplasia, 8-89 (). Skov, S. et al. Cancer cells become susceptible to natural killer cell killing after exposure to histone deacetylase inhibitors due to glycogen synthase kinase--dependent expression of MHC class I-related chain A and B. Cancer Res, - (). Zhang, C., Wang, Y., Zhou, Z., Zhang, J. & Tian, Z. Sodium butyrate upregulates expression of NKGD ligand MICA/B in HeLa and HepG cell lines and increases their susceptibility to NK lysis. Cancer Immunol Immunother 8, -8 (9). Shi, P. et al. Valproic acid sensitizes pancreatic cancer cells to natural killer cellmediated lysis by upregulating MICA and MICB via the PIK/Akt signaling pathway. BMC Cancer, (). Soriani, A. et al. Reactive oxygen species- and DNA damage response-dependent NK cell activating ligand upregulation occurs at transcriptional levels and requires the transcriptional factor EF. J Immunol 9, 9-9 (). Lin, D., Lavender, H., Soilleux, E. J. & O'Callaghan, C. A. NF-kappaB regulates MICA gene transcription in endothelial cell through a genetically inhibitable control site. J Biol Chem 8, 99- (). Fionda, C. et al. Inhibition of glycogen synthase kinase- increases NKGD ligand MICA expression and sensitivity to NK cell-mediated cytotoxicity in multiple myeloma cells: role of STAT. J Immunol 9, - ().
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Rino Ragno Rome Center for Molecular Design Department of Chemistry and Phamaceutical Technology Faculty of Pharmacy and Medicine
Rino Ragno Rome Center for Molecular Design Department of Chemistry and Phamaceutical Technology Faculty of Pharmacy and Medicine HDAC Inhibitors: Structure-Based Modeling and Isoform-Selectivity Prediction
Figure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ
Figure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ T lymphocytes used in all NK activation and cytotoxicity
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
Disclosures. Pathogenesis of Autoimmunity Normal immune response: 11/5/2011. Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis
Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis Disclosures N. Olsen and T. Aune are co-founders of ArthroChip LLC. Nancy J. Olsen Penn State MS Hershey Medical Center Thomas M. Aune Vanderbilt
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Synergistic combinations of targeted immunotherapy to combat cancer
Synergistic combinations of targeted immunotherapy to combat cancer Myung Ah Lee, M.D., Ph. D Division of Medical Oncology, Hepato-biliary pancreatic cancer center Seoul St. Mary s hospital, The Catholic
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Hyperthermia Increases Natural Killer Cell Cytotoxicity against SW-872 Liposarcoma Cell Line
Hyperthermia Increases Natural Killer Cell Cytotoxicity against SW-872 Liposarcoma Cell Line Shirin Farjadian 1, Marzie Norouzian 1, Vahid Younesi 1, Azin Ebrahimpour 1, Ramin Lotfi 2,3 1 Department of
Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
Analysis of Sphingosine Kinase Activity in Single Natural Killer Cells from Peripheral Blood
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information: Analysis of Sphingosine Kinase Activity in Single
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan
96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Supplementary figures and legends for
Supplementary figures and legends for No evident dose-response relationship between cellular ROS level and its cytotoxicity a paradoxical issue in ROS-based cancer therapy Chunpeng Zhu, Wei Hu, Hao Wu,
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22
Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran
Phospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma.
Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma Lajos István Nagy Ph.D thesis summary Supervisor: László Puskás, PhD, DSc Scientific
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)
Radiation-induced matrix metalloproteinases limit natural killer cell-mediated anticancer immunity in NCI-H23 lung cancer cells
1800 Radiation-induced matrix metalloproteinases limit natural killer cell-mediated anticancer immunity in NCI-H23 lung cancer cells WOONG HEO 1, YOUNG SHIN LEE 1, CHEOL HUN SON 1,2, KWANGMO YANG 2, YOU
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Plate-Based Assay Methods for the Assessment of Cellular Health
Plate-Based Assay Methods for the Assessment of Cellular Health Andrew L. Niles, Senior Research Scientist 2012, Promega Corporation. Biological Outcomes in Cell Culture Treatment -Small molecule -Bio-molecule
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
Post-translational modifications of proteins in gene regulation under hypoxic conditions
203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator
INCUCYTE LIVE-CELL ANALYSIS SYSTEM Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator See what your cells are doing and when they
Original article: DEXMEDETOMIDINE INHIBITS INFLAMMATION IN MICROGLIA CELLS UNDER STIMULATION OF LPS AND ATP BY C-FOS/NLRP3/CASPASE-1 CASCADES
Supplementary material to Original article: DEXMEDETOMIDINE INHIBITS INFLAMMATION IN MICROGLIA CELLS UNDER STIMULATION OF LPS AND ATP BY C-FOS/NLRP3/CASPASE-1 CASCADES Hu Li 1, Xueping Zhang 2, Mingfu
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
glucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate
Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Structure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
NK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
Immunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
Supplementary material for the manuscript
Supplementary material for the manuscript Title: CD200-positive cancer associated fibroblasts augment the sensitivity of Epidermal Growth Factor Receptor mutation-positive lung adenocarcinomas to EGFR
Supporting Information
Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,
INTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST
INTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST Kirk A. Staschke 1, Souvik Dey 1, John M. Zaborske 2, Lakshmi Reddy Palam 1, Jeanette N. McClintick
Introduction IMMUNOBIOLOGY
IMMUNOBIOLOGY ATM-ATR dependent up-regulation of DNAM-1 and NKG2D ligands on multiple myeloma cells by therapeutic agents results in enhanced NK-cell susceptibility and is associated with a senescent phenotype
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Chapter 2. Aims & Objectives
2.1. Statement of the problem: Earlier reports have shown ambiguous alteration of histone marks in response to DNA damage in asynchronized population of cells. These histone marks not only undergo dynamic
Supplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic
The Innate Immune Response
The Innate Immune Response FUNCTIONS OF THE IMMUNE SYSTEM: Recognize, destroy and clear a diversity of pathogens. Initiate tissue and wound healing processes. Recognize and clear damaged self components.
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
0105) at the day 15, respectively1 In contrast, the percentages of CD3 + CD4 + and NK cells displayed no
2003 12 10 83 23 Natl Med J China, December 10,2003,Vol 83, No. 23 2049 (CIK ), T, CIK 13 (PBMC),,4 7 10 13 15 ;CIK, (DC1) (CD2),CD3 + CD8 +, CD3 + CD56 +, CD25 +, 3315 % 1011 % 717 % 218 %1213 % 415 %,3616
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
Supplementary figure 2. VCAM1 protein expression in static HCAECs exposed to CSE over 72 hours, with TNFα or TNFα + CSE positive controls.
Supplementary data Cigarette smoke extract profoundly suppresses TNFα-mediated proinflammatory gene expression through upregulation of ATF3 in human coronary artery endothelial cells Jack E. Teasdale 1,
Muse Assays for Cell Analysis
Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Lung cancer is the most commonly diagnosed cancer in
BASIC STUDY to NK Cell-mediated Lysis of Lung Cancer Cells Hyunsu Kim,*w Sun-Hee Kim,*w Mi-Ju Kim,*w So-Jung Kim,* Soo-Jung Park,z Joo-Seop Chung,y Jae-Ho Bae,*w and Chi-Dug Kang* Summary: As quercetin,
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/12/e1601756/dc1 Supplementary Materials for Syrosingopine sensitizes cancer cells to killing by metformin Don Benjamin, Marco Colombi, Sravanth K. Hindupur, Charles
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
Supplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells
Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells Zhuhong Zhang 1, Si Chen 2, Hu Mei 3, Jiekun Xuan 2, Xiaoqing Guo 1, Letha Couch 2, Vasily N.
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
University of Bristol - Explore Bristol Research
Teasdale, J. E., Hazell, G. G. J., Peachey, A. M. G., Sala-Newby, G. B., Hindmarch, C. C. T., McKay, T. R.,... White, S. J. (2017). Cigarette smoke extract profoundly suppresses TNF-mediated proinflammatory
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
Annals of Oncology, Volume 26, Issue suppl_9, 1 December 2015, Pages ix3, Published: 19 December 2015
We Article use Navigation cookies to enhance your experience on our website. By clicking 'continue' or by continuing to use our website, you are agreeing to our use of cookies. You can change your cookie
HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells
HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells Sonja I Gringhuis 1,2*, Michiel van der Vlist 1,2*, Linda M van den Berg 1,2, Jeroen den Dunnen 2,3, Manja