HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells
|
|
- Della Tyler
- 5 years ago
- Views:
Transcription
1 HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells Sonja I Gringhuis 1,2*, Michiel van der Vlist 1,2*, Linda M van den Berg 1,2, Jeroen den Dunnen 2,3, Manja Litjens 2 and Teunis B H Geijtenbeek 1,2 1 Center of Infection and Immunity Amsterdam and Center for Experimental and Molecular Medicine, Academic Medical Center, University of Amsterdam, Amsterdam,The Netherlands; 2 Department of Molecular Cell Biology and Immunology, VU University Medical Center, Amsterdam, The Netherlands; 3 Present address: Cell Biology and Histology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands. * These authors contributed equally to this work. 1
2 Supplementary Figure 1 Supplementary Figure 1 Silencing of Raf-1 in DCs by RNA interference and Raf-1 inhibition by GW5074. (a,b) Silencing of Raf-1 was verified by quantitative real-time PCR or flow cytometry at 72 h after transfection. (c-f) Cell viability and apoptosis after Raf-1 silencing (c,d) or Raf-1 inhibition with GW5074 (e,f) were determined by Cell-Titer Glo assay (c,e) and caspase 3/7 activity (d,f), respectively. Staurosporine (10 μm; Calbiochem) was used as a positive control. Data are presented as mean ± s.d. of four independent experiments (a) or representative for two (c-f) or four (b) independent experiments. 2
3 Supplementary Figure 2 Supplementary Figure 2 HIV-1 LAI induces Raf-1 activation. Raf-1 phosphorylation at Ser338 or Tyr was measured by flow cytometry in unstimulated DCs (thin line) or stimulated for 10 min with HIV-1 LAI in the absence (filled histogram) or presence (thick line) of blocking antibodies. Data are representative for 4 independent experiments. 3
4 Supplementary Figure 3 Supplementary Figure 3 Silencing of MyD88, TLR7 and TLR8 in DCs by RNA interference. (a-d) Silencing of target genes in MyD88-, TLR7-, TLR8- or control-silenced DCs was verified by quantitative real-time PCR or flow cytometry at 72 h after transfection. (e) Functional silencing in TLR7-silenced DCs was verified by stimulation with TLR7- specific ligand R837. Cytokine mrna expression was determined by quantitative real-time PCR after 6 h stimulation. Expression is normalized to GAPDH. Data are presented as mean ± s.d. of two (e) or four (a,c) independent experiments or representative for at least four independent experiments (b,d). 4
5 Supplementary Figure 4 Supplementary Figure 4 Co-infections enhance HIV-1 replication via Raf-1 signaling pathways in myeloid DCs. DC-SIGN + myeloid DCs were co-infected for 6 h with HIV-1 BaL in combination with Mycobacterium tuberculosis or Candida albicans in the presence or absence of Raf-1 inhibitor GW5074 and Tat-Rev mrna was determined by quantitative realtime PCR. mrna expression is normalized to GAPDH. Data are presented as mean ± s.d. of two independent experiments. 5
6 Supplementary Table 1 Expression primer sequences Gene product Forward primer Reverse primer TNF CCATGTTCGTCATGGGTGTG GGTGCTAAGCAGTTGGTGGTG IL-10 GAGGCTACGGCGCTGTCAT CCACGGCCTTGCTCTTGTT IFN-β ACAGACTTACAGGTTACCTCCGAAAC CATCTGCTGGTTGAAGAATGCTT Tat-Rev ATGGCAGGAAGAAGCGGAG ATTCCTTCGGGCCTGTCG Vpu TCTCTCGACGCAGGACTCG TCTGATGAGCTCTTCGTCGC Gag GTGTGGAAAATCTCTAGCAGTGG CGCTCTCGCACCCATCTC GAPDH CCATGTTCGTCATGGGTGTG GGTGCTAAGCAGTTGGTGGTG Abortive HIV-1 RNA GGGTCTCTCTGGTTAGACCAGATC GGTTCCCTAGTTAGCCAGAGAGC 18S TCGAGGCCCTGTAATTGGAA CCCTCCAATGGATCCTCGTT ChIP primer sequences Gene product Forward primer Reverse primer HIV-1 LTR CGAGAGCTGCATCCGGAGTA GAGGCTTAAGCAGTGGGTTCC HIV GACGCAGGACTCGGCTTG TGGCGTACTCACCAGTCGC HIV TGAGGGACAATTGGAGAAGTGA TCTGCACCACTCTTCTCTTTGC HIV AGTTGTCCCCCTAACGGACAC TCCCGAATCCTGCAAAGC HIV GCCTTAGGCATCTCCTATGGC GATGAGCTCTTCGTCGCTGTC GAPDH TACTAGCGGTTTTACGGGCG TCGAACAGGAGGAGCAGAGAGCGA 6
Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.
Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationNature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
More informationHIV-1 blocks the signaling adaptor MAVS to evade antiviral host defense after sensing of abortive HIV-1 RNA by the host helicase DDX3
blocks the signaling adaptor to evade antiviral host defense after sensing of abortive RNA by the host helicase Sonja I Gringhuis, Nina Hertoghs, Tanja M Kaptein, Esther M Zijlstra-Willems, Ramin Sarrami-Forooshani,
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSalp15 Binding to DC-SIGN Inhibits Cytokine Expression by Impairing both Nucleosome Remodeling and mrna Stabilization
Salp15 Binding to DC-SIGN Inhibits Cytokine Expression by Impairing both Nucleosome Remodeling and mrna Stabilization Joppe W. R. Hovius 1,2[, Marein A. W. P. de Jong 3[, Jeroen den Dunnen 3, Manja Litjens
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationTowards an HIV Cure Pre-Conference Symposium 20 & 21 July 2012
Towards an HIV Cure Pre-Conference Symposium 20 & 21 July 2012 Your logo Natural control of HIV infection is associated with an isotype switched IgG antibody response to HIV Gag antigens in patients with
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationIMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis
IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, inhibits disease development in mouse models of psoriasis Weiwen e Ja Jiang, Fu-Gang Zhu, Dong Yu, Ekambar R. Kandimalla, a a, Nicola La Monica, and Sudhir
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationAllergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationTitle: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
More informationA TOLLIP DEFICIENCY ALLELE, RS , IS ASSOCIATED WITH LNCRNA TOLLIP-AS1 EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY
A TOLLIP DEFICIENCY ALLELE, RS5743854, IS ASSOCIATED WITH LNCRNA TOLLIP-AS EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY February 2, 208 5th Global Forum on TB Vaccines MULTIPLE
More informationNK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation
NK cells promote neutrophil recruitment in the brain during sepsisinduced neuroinflammation Hao He 1, Tingting Geng 1, Piyun Chen 1, Meixiang Wang 1, Jingxia Hu 1, Li Kang 1, Wengang Song 1, * & Hua Tang
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationTherapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationLecture on Innate Immunity and Inflammation
Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationInvolvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II. Fu Xiuqiong
Involvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II Fu Xiuqiong Melanoma fact Skin cancers Skin cancer deaths 2.3% 75% Melanoma Non-melanoma skin cancers ----American
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupporting Information
Supporting Information Sui et al..7/pnas.997 Pre-CLP CM9 LA9 SL Tat# Pol Vif % Tetramer + CD + CD + Vac+IL- +IL- Vac Fig. S. Frequencies of six different CD + CD + Mamu-A*-tetramer + cells were measured
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationThe encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More information4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
More informationHow HIV Causes Disease Prof. Bruce D. Walker
How HIV Causes Disease Howard Hughes Medical Institute Massachusetts General Hospital Harvard Medical School 1 The global AIDS crisis 60 million infections 20 million deaths 2 3 The screen versions of
More informationSupplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
More informationSupplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationImpact of TLR7/8 Triggering on HIV Pathogenesis
University Hospital Zurich u Division of Infectious Diseases and Hospital Epidemiology Impact of TLR7/8 Triggering on HIV Pathogenesis Roberto F. Speck, MD Hallmark of HIV-Infection is the Progressive
More informationSupplementary Figures
MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,
More informationA20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplementary Information File
Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3
More informationSUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
More informationUvA-DARE (Digital Academic Repository) Tick-host-pathogen interactions in Lyme borreliosis Hovius, J.W.R. Link to publication
UvA-DARE (Digital Academic Repository) Tick-host-pathogen interactions in Lyme borreliosis Hovius, J.W.R. Link to publication Citation for published version (APA): Hovius, J. W. R. (2009). Tick-host-pathogen
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationFungal Engagement of the C-Type Lectin Mincle Suppresses Dectin-1-Induced Antifungal Immunity
Article Fungal Engagement of the C-Type Lectin Mincle Suppresses Dectin-1-Induced Antifungal Immunity Brigitte A. Wevers, 1 Tanja M. Kaptein, 1 Esther M. Zijlstra-Willems, 1 Bart Theelen, 2 Teun Boekhout,
More informationCell-mediated Immunity
Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSupplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
More informationCitation for published version (APA): Von Eije, K. J. (2009). RNAi based gene therapy for HIV-1, from bench to bedside
UvA-DARE (Digital Academic Repository) RNAi based gene therapy for HIV-1, from bench to bedside Von Eije, K.J. Link to publication Citation for published version (APA): Von Eije, K. J. (2009). RNAi based
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.
ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina
More informationProtein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSupplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
More informationSupplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).
Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationStandardization of Immune Biomarkers: Lessons From the HIV Field
Standardization of Immune Biomarkers: Lessons From the HIV Field Alan Landay, PhD Rush University Medical Center Thomas Denny, MSc Duke University Medical Center and Viral Load Standardization Immunology
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses
More informationEGFR kinase activity is required for TLR4 signaling and the septic shock response
Manuscript EMBOR-2015-40337 EGFR kinase activity is required for TLR4 signaling and the septic shock response Saurabh Chattopadhyay, Manoj Veleeparambil, Darshana Poddar, Samar Abdulkhalek, Sudip K. Bandyopadhyay,
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationOncolytic Viruses as a Potential Approach to Eliminate the HIV Reservoir
Oncolytic Viruses as a Potential Approach to Eliminate the HIV Reservoir Costiniuk CT, Côté SC, Al-Ghazawi FM, Carrasco-Medina L,Young CD, & Angel JB University of Ottawa, November 12 th, 2012 HIV Reservoirs
More information