Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz
|
|
- Marion Eaton
- 5 years ago
- Views:
Transcription
1 Biopsia Líquida: Oncología en Tiempo Real Federico Rojo Fundación Jiménez Díaz
2 Liquid Biopsy in Cancer
3 Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace Surgical Biopsies to create a new multibillion dollar market opportunity...
4 Liquid Biopsy in Cancer Analysis of therapeutic targets and drug resistance conferring gene mutations on peripheral blood samples: Estimation of risk for metastatic relapse or progression Understanding metastatic development Prediction of targeted therapy response Monitoring (minimal residual) disease Tracking secondary ( acquired ) resistance Assessing intratumor heterogeneity Tumor Targets CTCs cfdna cfrna Platelets Exosomes Origins Selected viable tumor cells leaving actively primary and/or metastasis Necrotic and apoptotic tumor cells Necrotic and apoptotic tumor cells Active incorporation of exosomes Active secretion of encapsulated particles by tumor cells Definition Tumor cells Fragmented genomes released from dying tumor cells of primary and/or metastasis Fragmented RNA released from dying tumor cells Circulating platelets Circulating encapsulated particles Analytes DNA, RNA, protein DNA RNA RNA RNA, protein
5 Liquid Biopsy and Cell-Free Tumor DNA Cell free tumor DNA released from a solid tumor cfdna CTCs Origin: Necrotic or apoptotic tumor cells; active secretion Small DNA fragments ( bp) Half life ~2h Clearance by kidney Healthy individual: 3,000 5,000 Genomic Equivalents/ml Cancer: >10,000 Genomic Equivalents/ml Concentration: 0.01% to 60% of total DNA Total DNA elevated for various reasons: inflammation, wound healing, malignant lesions, menstruation, sport
6 First Descriptions of Circulating Tumor DNA
7 Survey of ctdna in Advanced Human Cancer Cases with detectable cdna, Stage IV Cases with detectable cdna, localized vs metastatic Bettegowda et al, Sci Tran Med Feb 2014
8 Analytical Challenge for Plasma DNA Testing Blood Plasma cfdna isolation Analysis Diaz & Bardelli, J Clin Oncol 2014
9 Therascreeen EGFR mutation analysis in plasma 29 mutations in EGFR Sensitivity for activating mutations: 65.7% Specificity: 99.8%
10 Cobas EGFR mutation analysis in plasma 42 mutations in EGFR Semi-quantitative Index (SQI) Sensitivity for activating mutations: 82% Specificity: 98%
11 Principles of BEAMing: BEAMing Beads, Emulsions, Amplification & Magnetics Emulsion Characteristics Droplet size: 3-10 μm diameter fl volume Droplet density: ~ compartments / μl ~ beads / μl Up to 300 million PCR compartments per reaction Vogelstein et al. PNAS 1999; mod. Diehl et al Curr Opin Oncol Beads in Water-in-Oil Emulsions Magnetic beads (1 µm diameter) Light Microscopy of Emulsions (200x)
12
13 Analytical validation: EGFR mutation in NSCLC Reference Assay Sensitivity Specificity Wang S 2013 ARMS 0,22 0,67 Jing CW 2013 HRM 0,64 0,97 Zhang H 2013 MEL 0,67 0,99 Kim HR 2013 PNA-LNA 0,67 0,92 Liu X 2013 ARMS 0,67 0,99 Lv C 2013 DHPLC 0,13 0,88 Kim ST 2013 PNA-LNA 0,18 0,93 Xu F 2012 ARMS 0,25 0,96 Hu C 2012 HRM 0,98 0,17 Zhao X 2012 ME-PCR 0,36 0,95 Yam I 2012 AS-APEX 0,98 0,75 Goto K 2012 ARMS 0,43 0,99 Jiang B 2011 ME-Sequencing 0,76 0,99 He C 2009 ME-PCR 0,94 0,86 Bai H 2009 DHPLC 0,82 0,9 Kuang Y 2009 ARMS 0,7 0,85 Yung TK 2009 ddpcr 0,96 0,92 Kimura H 2007 ARMS 0,75 0,97 Kimura H 2006 ARMS 0,75 0,67 Huang Z 2012 DHPLC 0,64 0,85 Lee JY 2016 ddpcr 0,76 0,88 Reference Assay Sensitivity Specificity Mok t 2015 ME-PCR 0,75 0,96 Karlovich CA 2016 ddpcr 0,73 0,82 Karachaliou N 2015 PNA-LNA 0,81 0,95 Wang Z 2014 ddpcr 0,82 0,97 Zheng D ddpcr 0,84 0,91 Thress KS 2015 ARMS, ME-PCR, ddpcr 0,78-1 0,93-1 Que D 2016 ddpcr 0,89 0,85 Paquale R 2015 ARMS 0,65 0,99 Uchida J 2015 NGS 0,51 0,98 Sriram KB 2011 ME-PCR 0,62 0,97 Taniguchi K 2011 ddpcr 0,64 0,97 Nakamura T 2012 ME-PCR 0,67 0,99 Kim ST 2013 PNA-LNA 0,67 0,92 Brevet M 2011 Sequenom 0,67 0,99 Douillard JY 2014 ARMS 0,63 0,88 Weber B 2014 ME-PCR 0,68 0,93
14 Analytical validation: EGFR mutation in NSCLC Phase I trial with AZD9291 in NSCLC (AURA): 38 pre-dose plasma samples and matched tumor biopsies, after first development of resistance and 2 nd look biopsy have been evaluated cfdna was tested for 3 EGFR mutations (T790M, L858R, Exon 19 del) by 3 methods and compared with tissue Roche cobas PCR Qiagen Therascreen ARMS Sysmex Inostics BEAMing Exon 19 Deletion Assays Sensitivity 86% 82% 90% Specificity 100% 100% 100% Concordance 89% 87% 93% L858R (Exon 21) Assays Sensitivity 90% 78% 100% Specificity 100% 100% 91% Concordance 97% 95% 93% T790M (Exon 20) Assay Sensitivity 41% 29% 69% Specificity 100% 100% 67% Concordance 57% 48% 68% Thress, KS et al. Lung Cancer 2015
15 Clinical validation: 1. Prognosis after neoadjuvant treatment in early breast cancer ChemoNEAR study design Garcia-Murillas, I et al. Science Trans Med 2015
16 Clinical validation: 1. Prognosis after neoadjuvant treatment in early breast cancer Pre-therapy ctdna was not associated to prognosis Post-therapy ctdna was linked to poor prognosis Dynamic mutation tracking is highly accurate in predicting relapse Garcia-Murillas, I et al. Science Trans Med 2015
17 Clinical validation: 1. Prognosis after neoadjuvant treatment in early breast cancer Garcia-Murillas, I et al. Science Trans Med 2015
18 Normal signal Clinical validation: 2. Minimal residual disease in colorectal cancer N= 162 plasma samples (18 patients) Cell-Free Tumor DNA Levels Before and After Surgery Before surgery Day of Surgery After surgery Day 3 After surgery Day 244 Residual Mutant cfdna Diehl et al. Nature Medicine 2008 Mutant signal
19 Clinical validation: 3. Predictive value of plasma EGFR in NSCLC Plasma EGFR mut+ Plasma EGFR mut- Mok, T et al. Clin Cancer Res 2015
20 Clinical validation: 4. Emergence of secondary mutations in colorectal cancer TISSUE PLASMA Bettegowda et al, Sci Tran Med Feb 2014 Misale et al. Nature 2012 Diaz et al. Nature 2012
21 Mensajes finales El estudio de mutaciones en ctdna en algunos escenarios, como NSCLC, está ya analíticamente validado para su uso en la práctica asistencial El estudio de ctdna puede tener utilidad pronóstica, de predicción de respuesta, en el seguimiento y la monitorización de la enfermedad y en la detección de segundas mutaciones asociadas a resistencia Qué método de laboratorio y circuito se debe de crear en cada centro?
Qué es la Biopsia Líquida? Circulantes y Ácidos Nucleicos Circulantes. Federico Rojo
Qué es la Biopsia Líquida? Células Tumorales Circulantes y Ácidos Nucleicos Circulantes Federico Rojo Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace
More informationPros and cons of liquid biopsy: Ready to replace tissue?
Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:
More informationLa biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro
La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationDiagnostic with alternative sample types (liquid biopsy)
MOLECULAR DIAGNOSTICS OF EGFR AND T790M MUTATIONS CHALLENGES AND SOLUTIONS Diagnostic with alternative sample types (liquid biopsy) James CH Yang, MD, PhD Director, Professor, Graduate Institute of Oncology
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationLiquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director
Liquid Biopsy Jesus Garcia-Foncillas MD PhD Director Main issues about liquid biopsies New paradigm: Precision Medicine Heterogeneity & Dynamics Surrogate mirror for the tumor CTCs in colon cancer ctdna:
More informationIntroduction to liquid biopsies. Rachel Butler All Wales Genetics Laboratory
Introduction to liquid biopsies Rachel Butler All Wales Genetics Laboratory What is cell free DNA? Non-Invasive Prenatal Testing (NIPT) Extract DNA Genetic alterations detectable in circulating cell-free
More informationLukas Bubendorf Pathologie. Liquid biopsies
Lukas Bubendorf Pathologie Liquid biopsies Liquid biopsies 1. Circulating cell-free tumor-dna (ctdna) 2. Circulating tumor cells (CTC) Source: Sysmex CTCs ctdna ctrna exosomes Quantification Protein RNA
More informationThe OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice
The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice Sysmex Inostics Dr. Friederike Lehmann Head of CRO Marketing Sysmex Corporation Kobe 2 Sysmex Corporation
More informationAplicaciones de la biopsia líquida en Oncología
Aplicaciones de la biopsia líquida en Oncología Congreso Nacional del Laboratorio Clínico 2017 Emilio Alba UGCI Oncología Médica. Hospital Universitario Regional y Virgen de la Victoria Departamento de
More informationECMC cfdna consensus meeting
ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients
More informationCirculating Tumor DNA in GIST and its Implications on Treatment
Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna
More informationResultados del estudio Concordance: Relevancia clínica de la determinación del ADNtc mediante la tecnología BEAMing. Ana Vivancos
Resultados del estudio Concordance: Relevancia clínica de la determinación del ADNtc mediante la tecnología BEAMing Ana Vivancos Circulating tumor DNA extended RAS mutational analysis as a surrogate of
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationThe OncoBEAM RAS liquid biopsy experience in real-world clinical practice Frederick S. Jones, Ph.D., Global Director, Medical Scientific
The OncoBEAM RAS liquid biopsy experience in real-world clinical practice Frederick S. Jones, Ph.D., Global Director, Medical Scientific Affairs,Sysmex 2 OncoBEAM liquid biopsy: circulating tumor DNA (ctdna)
More informationEGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester
EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology
More informationCirculating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)
Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Policy Number: Original Effective Date: MM.02.044 10/01/2018 Line(s) of Business: Current Effective Date Section: 10/01/2018
More informationIntroduction to liquid biopsy in a Specialized Cancer Center
Introduction to liquid biopsy in a Specialized Cancer Center Dr. Antonio Cubillo Head, Medical OncologyDepartment HM-CIOCC In collaboration with OUTLINE Need Liquid Biopsy: Definition and techniques Sensitivity
More informationYoungnam Cho. National Cancer Center Biomarker Branch
Youngnam Cho National Cancer Center Biomarker Branch Contents 1. Liquid Biopsy 2. Circulating Tumor Cells from Blood 3. Cell-free DNA from Blood 1. Liquid biopsy Cancer Diagnosis IMAGING TISSUE BIOPSY
More informationCirculating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)
Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Policy Number: 2.04.143 Last Review: 1/2018 Origination: 1/2018 Next Review: 1/2019 Policy Blue Cross and Blue Shield
More informationEnterprise Interest No
Enterprise Interest No SY-05 Pulmonary Pathology: Options for targeted therapy in lung cancer Liquid biopsy in thoracic oncology Where are we now? Paul Hofman Laboratory of Clinical and Experimental Pathology
More informationTissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~
16 th Dec. 2016. ESMO Preceptorship Program Non-Small-Cell Lung Cancer @Singapore Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ Research Institute for Disease of
More informationCirculating DNA in diagnosis and monitoring EGFR gene mutations in advanced non-small cell lung cancer
Review Article on Lung Cancer Diagnostics and Treatments 2015: A Renaissance of Patient Care Circulating DNA in diagnosis and monitoring EGFR gene mutations in advanced non-small cell lung cancer Paola
More informationPersonalized oncology: the potential for tissue and cell-free DNA
Open Citation: J Med Discov (2016); 1(1):jmd16005; doi:10.24262/jmd.1.1.16005 Commentary Personalized oncology: the potential for tissue and cell-free DNA biopsies to capture tumor heterogeneity Young
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationTransforming Oncology With Precision Medicine Solutions. Company Overview January 2017
Transforming Oncology With Precision Medicine Solutions Company Overview January 2017 FORWARD-LOOKING STATEMENTS Statements in this presentation about the Company's expectations, applications of its technology,
More informationRobert Beer
Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free
More informationLa biopsia liquida dei tumori: il viaggio. Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome
La biopsia liquida dei tumori: il viaggio Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome Must Know Necessary Travel Tips There is lack of drugs to treat all the
More informationCirculating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)
Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Policy Number: 2.04.143 Last Review: 1/2019 Origination: 1/2018 Next Review: 1/2020 Policy Blue Cross and Blue Shield
More informationMP Circulating Tumor DNA Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)
Medical Policy BCBSA Ref. Policy: 2.04.143 Last Review: 10/18/2018 Effective Date: 10/18/2018 Section: Medicine Related Policies 2.04.121 Miscellaneous Genetic and Molecular Diagnostic Tests 2.04.45 Molecular
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
Circulating Tumor DNA Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Page 1 of 36 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Circulating Tumor DNA
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationFUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER
FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER C. NADAL 1-3, T. WINDER 4, A. GERGER 5-6, D. TOUGERON 7-8 SELECTED HIGHLIGHTS 1 Medical Oncology Department, Institut Clínic de Malalties
More informationCirculating DNA in EGFR-mutated lung cancer
Review Article Page 1 of 11 Circulating DNA in EGFR-mutated lung cancer Aditi P. Singh 1, Shenduo Li 2, Haiying Cheng 1 1 Department of Oncology, Montefiore Medical Center, Bronx, NY, USA; 2 Department
More informationChenguang Li 1,2,3,4*, Rui Jia 1,2,3,4, Hailin Liu 1,2,3,4, Bin Zhang 1,2,3,4 and Changli Wang 1,2,3,4
Li et al. Diagnostic Pathology (2018) 13:49 https://doi.org/10.1186/s13000-018-0728-6 RESEARCH EGFR T790M detection and osimertinib treatment response evaluation by liquid biopsy in lung adenocarcinoma
More informationCTC in clinical studies: Latest reports on GI cancers
CTC in clinical studies: Latest reports on GI cancers François-Clément Bidard, MD PhD GI cancers are characterized by Multimodal treatment strategies Treatments are adapted to tumor burden & prognosis
More informationANTI-EGFR IN MCRC? Assoc. Prof. Gerald Prager, Medical University of Vienna, Austria
IS IT TIME TO RE-CHALLENGE ANTI-EGFR IN MCRC? Assoc. Prof. Gerald Prager, Medical University of Vienna, Austria Dr. Andrea Sartore-Bianchi, Oncologia Clinica Molecolare, Niguarda Cancer Center, Milano,
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationMedical Coverage Policy Circulating Tumor DNA and. Circulating Tumor Cells for Cancer Management (Liquid Biopsy)
Medical Coverage Policy Circulating Tumor DNA and Circulating Tumor Cells for Cancer Management (Liquid Biopsy) EFFECTIVE DATE: 12 01 2016 POLICY LAST UPDATED: 07 17 2018 OVERVIEW Circulating tumor DNA
More informationPRECISION INSIGHTS. Liquid GPS. Blood-based tumor profiling and quantitative monitoring. Reveal more with cfdna + cfrna.
PRECISION INSIGHTS Liquid GPS Blood-based tumor profiling and quantitative monitoring Reveal more with cfdna + cfrna www.nanthealth.com Why Blood-Based Tumor Profiling? Although tissue-based molecular
More informationIntegrated platform for liquid biopsy-based personalized cancer medicine
Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy Personalized cancer therapy Primary tumor single tumor
More informationOsimertinib as first-line treatment of EGFR mutant advanced nonsmall-cell
Editorial Osimertinib as first-line treatment of EGFR mutant advanced nonsmall-cell lung cancer Chong-Kin Liam Department of Medicine, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia
More informationInformation Guide - August Liquid Biopsies for Cancer Management
Information Guide - August 2017 Liquid Biopsies for Cancer Management INFORMATION GUIDE - AUGUST 2017 Liquid Biopsies for Cancer Management CIRCULATING TUMOR DNA IN BLOOD AS A LIQUID BIOPSY FOR CANCER
More informationCirculating tumour DNA in breast cancer. Kathleen Burke, PhD Bioinformatics Postdoctoral Fellow Laboratory of Dr. Jorge Reis-Filho
Circulating tumour DNA in breast cancer Kathleen Burke, PhD Bioinformatics Postdoctoral Fellow Laboratory of Dr. Jorge Reis-Filho Conflicts of Interest I have no financial relationships to disclose I will
More informationUrinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring. Summit August 19,2015
Urinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring Mark G. Erlander, Ph.D., CSO CHI Next Generation Summit August 19,2015 Circulating Tumor DNA (ctdna) Tumor cells Main Advantages of
More informationRole of liquid biopsy in lung cancer 20/10/2017
Role of liquid biopsy in lung cancer 20/10/2017 Overview of Seminar Background Concept of liquid biopsy Different Biological Components of Liquid Biopsy Various samples used in liquid biopsy EGFR mutation
More informationDNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias
More informationIncorporating pharmacodynamic, response and patient selection biomarkers. Paul Elvin PhD Chief Translational Science Officer Aptus Clinical
Incorporating pharmacodynamic, response and patient selection biomarkers Paul Elvin PhD Chief Translational Science Officer Aptus Clinical 22 Oncology drug development Biomarkers key for: Strong hypothesis
More informationThor Nilsen NeoGeneStar LLC January 22, 2015
Thor Nilsen NeoGeneStar LLC January 22, 2015 NeoGeneStar TM I. Liquid biopsy using circulating cell-free DNA: Cancer diagnostics Prenatal diagnostics Other disease states II. NeoGeneStar TM cell-free DNA
More informationMET skipping mutation, EGFR
New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM
More informationSee how you can guide the path her cancer takes
See how you can guide the path her cancer takes The need for improved diagnostics At the advanced edge of oncology, rapid access to accurate data on disease state is vital. Current technologies such as
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationLUNG CANCER Searching early biomarkers in blood
LUNG CANCER Searching early biomarkers in blood Eloisa Jantus Lewintre Laboratorio Oncología Molecular- FIHGUV Servicio Oncología Médica, CHGUV Dpto Biotecnología- Universitat Politècnica de València CIBERONC,
More informationBlood as a Substitute for Tumor Tissue in Detecting EGFR Mutations for Guiding EGFR TKIs Treatment of Nonsmall Cell Lung Cancer
Blood as a Substitute for Tumor Tissue in Detecting EGFR Mutations for Guiding EGFR TKIs Treatment of Nonsmall Cell Lung Cancer A Systematic Review and Meta-Analysis Chen Mao, PhD, Jin-Qiu Yuan, PhD, Zu-Yao
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationHeterogeneidad tumoral. Federico Rojo
Heterogeneidad tumoral Federico Rojo Outline of the presentation Definition and evidences Intertumor heterogeneity Spatial and temporal intratumor heterogeneity Clinical implications of tumor heterogeneity.
More informationShingo Nishikawa, Hideharu Kimura, Hayato Koba, Taro Yoneda, Satoshi Watanabe, Tamami Sakai, Johsuke Hara, Takashi Sone, Kazuo Kasahara, Shinji Nakao
Original Article Selective gene amplification to detect the T790M mutation in plasma from patients with advanced non-small cell lung cancer (NSCLC) who have developed epidermal growth factor receptor tyrosine
More informationAssay Location Primer TaqMan probe Reference
Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original
More informationRound Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL
Round Table: Tissue Biopsy versus Liquid Biopsy César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Introduction Classic Advantages of liquid biopsy collection over standard biopsy Standard biopsy
More informationWhat do liquid biopsies offer us for breast cancer patients?
What do liquid biopsies offer us for breast cancer patients? Isaac Garcia-Murillas Breast Cancer Now Research Centre, The institute of Cancer Research, London, UK Molecular Analysis of breast cancer Invasive
More informationQué hemos aprendido hasta hoy? What have we learned so far?
Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;
More informationResistances to EGFR tyrosine kinase inhibitors in lung cancer how to routinely track them in a molecular pathology laboratory?
Review Article Resistances to EGFR tyrosine kinase inhibitors in lung cancer how to routinely track them in a molecular pathology laboratory? Véronique Hofman 1,2,3, Paul Hofman 1,2,3 1 Laboratory of Clinical
More informationConsensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018
Consensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018 Summary: This document follows on from the findings of the CM-Path The
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationAdvances in Pathology and molecular biology of lung cancer. Lukas Bubendorf Pathologie
Advances in Pathology and molecular biology of lung cancer Lukas Bubendorf Pathologie Agenda The revolution of predictive markers Liquid biopsies PD-L1 Molecular subtypes (non-squamous NSCLC) Tsao AS et
More informationPersonalized Healthcare Update
Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationIntroduction. Case Report
Case Report Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report Clara Mayo de las Casas 1, Maria
More informationDiagnostica Molecolare!
Diagnostica Molecolare! Aldo Scarpa Unità Diagnostica Molecolare Azienda Ospedaliera Universitaria Integrata di Verona e ARC-NET Centro di Ricerca Applicata sul Cancro PDTA CARCINOMA POLMONARE - IL PAZIENTE
More informationCirculating Tumor DNA and Circulating Tumor Cells for Management (Liquid Biopsy) of Solid Tumor Cancers
NOTE: This policy is not effective until December 1, 2018. To view the current policy, click here. Medical Policy Manual Laboratory, Policy No. 46 Circulating Tumor DNA and Circulating Tumor Cells for
More informationState of the Art in Molecular Testing and Current Diagnostic Challenges
State of the Art in Molecular Testing and Current Diagnostic Challenges. 2017 Conversations in Oncology in Shanghai, China Mike Zhu, MD/PhD Amoy Diagnostics Co., Ltd BI Symposium Headline Update on molecular
More informationValidated and promising predictive factors in mcrc: Recent updates on RAS testing Fotios Loupakis, MD PhD
Validated and promising predictive factors in mcrc: Recent updates on RAS testing Fotios Loupakis, MD PhD U.O. Oncologia 2 Universitaria Azienda Ospedaliero-Universitaria Pisana Pisa, Italy Learning Objectives
More informationOsimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study
Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study Abstract 9002 Yang JC, Kim DW, Kim SW, Cho BC, Lee JS, Ye X, Yin X, Yang
More informationcirculating nucleic acids in pdf Circulating nucleic acids in plasma and serum: diagnosis QIAamp Circulating Nucleic Acid Handbook - Qiagen
DOWNLOAD OR READ : CIRCULATING NUCLEIC ACIDS IN EARLY DIAGNOSIS PROGNOSIS AND TREATMENT MONITORING AN INTRODUCTION ADVANCES IN PREDICTIVE PREVENTIVE AND PERSONALISED MEDICINE PDF EBOOK EPUB MOBI Page 1
More informationConverting the Hype into Reality: Realizing the Potential of Cell-Free DNA
Converting the Hype into Reality: Realizing the Potential of Cell-Free DNA Lucy Xu, Ph.D. Associate Director Clinical Biomarker Research Eisai Inc. Woodcliff Lake, NJ Precision LBx Summit San Diego, CA
More informationEditorial Process: Submission:10/27/2017 Acceptance:05/25/2018
DOI:10.22034/APJCP.2018.19.7.1761 TKI by Liquid Biopsy RESEARCH ARTICLE Editorial Process: Submission:10/27/2017 Acceptance:05/25/2018 A Case-control Study Supporting the Use of Liquid Biopsy in the Targeted
More informationCLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases
CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases Adriana Muniz 1, Mariko Matsutani 1, Karena Kosco 1, John Spinosa 1, Cecile
More informationReview Article Capturing Genomic Evolution of Lung Cancers through Liquid Biopsy for Circulating Tumor DNA
Hindawi Oncology Volume 2017, Article ID 4517834, 5 pages https://doi.org/.1155/2017/4517834 Review Article Capturing Genomic Evolution of Lung Cancers through Liquid Biopsy for Circulating Tumor DNA Michael
More informationMolecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
More informationClonal evolution in response to anti-egfr therapies
ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica Clonal
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationFEP Medical Policy Manual
FEP Medical Policy Manual Effective Date: January 15, 2019 Related Policies: None Circulating Tumor DNA for Management of Non-Small-Cell Lung Description Genetic testing of circulating tumor DNA (ctdna)
More informationT790M como marcador predictivo de respuesta. Mariano Provencio
T790M como marcador predictivo de respuesta Mariano Provencio CASO 1 Provencio et al submitted. Provencio et al submitted. C + 450 días: Progresión Taponamiento cardiaco Distress respiratorio ingreso por
More informationLiquid biopsies come of age: towards implementation of circulating tumour DNA
Liquid biopsies come of age: towards implementation of circulating tumour DNA Jonathan C. M. Wan 1,2, Charles Massie 1,2, Javier Garcia-Corbacho 3, Florent Mouliere 1,2, James D. Brenton 1,2, Carlos Caldas
More informationLiquid biopsy based biomarkers in non-small cell lung cancer for diagnosis and treatment monitoring
Review Article Liquid biopsy based biomarkers in non-small cell lung cancer for diagnosis and treatment monitoring David Pérez-Callejo, Atocha Romero, Mariano Provencio, María Torrente Department of Medical
More informationCelvrij DNA: nieuwe diagnostische mogelijkheden
Celvrij DNA: nieuwe diagnostische mogelijkheden Dr. Helena Devos - Hematologie voor de huisarts 2.0 9 februari 2019 Content What is cell free DNA? Clinical applications: Prenatal: NIPT In oncology/hematology:
More informationLiquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System
Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular
More informationDevelopment of Circulating Tumor DNA
Development of Circulating Tumor DNA Title of presentation Arial Bold 30pt in White Biomarkers Secondary title 22pt using Arial Next in White Generation Sequencing Brian Dougherty PhD, MBA Translational
More informationBetter Cancer Monitoring with Circulating Tumor DNA. March 2016
Better Cancer Monitoring with Circulating Tumor DNA March 2016 Forward-Looking Statements Statements in this presentation about the Company's expectations, applications of its technology, markets, launch
More informationApplication of Cell-free DNA Analysis to Cancer Treatment
The new england journal of medicine Review Article From the Massachusetts General Hospital Cancer Center and the Department of Medicine, Harvard Medical School, Boston. Address reprint requests to Dr.
More informationExon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report
Case Report Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report Yu-Ting Wang, Wei-Wei Ning, Jing Li, Jian-n Huang Department of Respiratory Medicine, the First ffiliated
More informationSee how you can guide the path her cancer takes
See how you can guide the path her cancer takes 1 Idylla : easy, rapid and accurate molecular medicine for every patient Paola Valente Strategic Marketing Biocartis 6th meeting on external quality assessment
More informationSupplementary Online Content
Supplementary Online Content Venook AP, Niedzwiecki D, Lenz H-J, et al. Effect of first-line chemotherapy combined with cetuximab or bevacizumab on overall survival in patients with KRAS wild-type advanced
More informationLIQUID BIOPSY RESEARCH TOOLS, SERVICES AND DIAGNOSTICS: GLOBAL MARKETS
LIQUID BIOPSY RESEARCH TOOLS, SERVICES AND DIAGNOSTICS: GLOBAL MARKETS BIO150A January 2016 John Bergin Project Analyst ISBN: 1-62296-224-9 BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 USA
More informationPlasma ctdna RAS/RAF mutations analysis for monitoring overall survival (OS) and heterogeneity in metastatic colorectal cancer patients (mcrc)
Plasma ctdna RAS/RAF mutations analysis for monitoring overall survival (OS) and heterogeneity in metastatic colorectal cancer patients (mcrc) Authors: Andrea Petricca Mancuso, Veronica Varchetta, Fabrizio
More informationccfdna Webinar Series: The Basics and Beyond
ccfdna Webinar Series: The Basics and Beyond Part I Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. Introduction to Circulating,
More informationTreatment of EGFR mutant advanced NSCLC
Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and Manchester University Hospital Manchester, UK Outline Data on first-line Overcoming T790M mutation
More informationHOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY
HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering
More informationIndividualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy
Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy 1 st st International Oncological Conference Wrocław, October 6 th, 2012 Dr. Frank Kischkel Individualized Cancer Therapy:
More information