Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz

Size: px
Start display at page:

Download "Biopsia Líquida: Oncología en Tiempo Real. Federico Rojo Fundación Jiménez Díaz"

Transcription

1 Biopsia Líquida: Oncología en Tiempo Real Federico Rojo Fundación Jiménez Díaz

2 Liquid Biopsy in Cancer

3 Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace Surgical Biopsies to create a new multibillion dollar market opportunity...

4 Liquid Biopsy in Cancer Analysis of therapeutic targets and drug resistance conferring gene mutations on peripheral blood samples: Estimation of risk for metastatic relapse or progression Understanding metastatic development Prediction of targeted therapy response Monitoring (minimal residual) disease Tracking secondary ( acquired ) resistance Assessing intratumor heterogeneity Tumor Targets CTCs cfdna cfrna Platelets Exosomes Origins Selected viable tumor cells leaving actively primary and/or metastasis Necrotic and apoptotic tumor cells Necrotic and apoptotic tumor cells Active incorporation of exosomes Active secretion of encapsulated particles by tumor cells Definition Tumor cells Fragmented genomes released from dying tumor cells of primary and/or metastasis Fragmented RNA released from dying tumor cells Circulating platelets Circulating encapsulated particles Analytes DNA, RNA, protein DNA RNA RNA RNA, protein

5 Liquid Biopsy and Cell-Free Tumor DNA Cell free tumor DNA released from a solid tumor cfdna CTCs Origin: Necrotic or apoptotic tumor cells; active secretion Small DNA fragments ( bp) Half life ~2h Clearance by kidney Healthy individual: 3,000 5,000 Genomic Equivalents/ml Cancer: >10,000 Genomic Equivalents/ml Concentration: 0.01% to 60% of total DNA Total DNA elevated for various reasons: inflammation, wound healing, malignant lesions, menstruation, sport

6 First Descriptions of Circulating Tumor DNA

7 Survey of ctdna in Advanced Human Cancer Cases with detectable cdna, Stage IV Cases with detectable cdna, localized vs metastatic Bettegowda et al, Sci Tran Med Feb 2014

8 Analytical Challenge for Plasma DNA Testing Blood Plasma cfdna isolation Analysis Diaz & Bardelli, J Clin Oncol 2014

9 Therascreeen EGFR mutation analysis in plasma 29 mutations in EGFR Sensitivity for activating mutations: 65.7% Specificity: 99.8%

10 Cobas EGFR mutation analysis in plasma 42 mutations in EGFR Semi-quantitative Index (SQI) Sensitivity for activating mutations: 82% Specificity: 98%

11 Principles of BEAMing: BEAMing Beads, Emulsions, Amplification & Magnetics Emulsion Characteristics Droplet size: 3-10 μm diameter fl volume Droplet density: ~ compartments / μl ~ beads / μl Up to 300 million PCR compartments per reaction Vogelstein et al. PNAS 1999; mod. Diehl et al Curr Opin Oncol Beads in Water-in-Oil Emulsions Magnetic beads (1 µm diameter) Light Microscopy of Emulsions (200x)

12

13 Analytical validation: EGFR mutation in NSCLC Reference Assay Sensitivity Specificity Wang S 2013 ARMS 0,22 0,67 Jing CW 2013 HRM 0,64 0,97 Zhang H 2013 MEL 0,67 0,99 Kim HR 2013 PNA-LNA 0,67 0,92 Liu X 2013 ARMS 0,67 0,99 Lv C 2013 DHPLC 0,13 0,88 Kim ST 2013 PNA-LNA 0,18 0,93 Xu F 2012 ARMS 0,25 0,96 Hu C 2012 HRM 0,98 0,17 Zhao X 2012 ME-PCR 0,36 0,95 Yam I 2012 AS-APEX 0,98 0,75 Goto K 2012 ARMS 0,43 0,99 Jiang B 2011 ME-Sequencing 0,76 0,99 He C 2009 ME-PCR 0,94 0,86 Bai H 2009 DHPLC 0,82 0,9 Kuang Y 2009 ARMS 0,7 0,85 Yung TK 2009 ddpcr 0,96 0,92 Kimura H 2007 ARMS 0,75 0,97 Kimura H 2006 ARMS 0,75 0,67 Huang Z 2012 DHPLC 0,64 0,85 Lee JY 2016 ddpcr 0,76 0,88 Reference Assay Sensitivity Specificity Mok t 2015 ME-PCR 0,75 0,96 Karlovich CA 2016 ddpcr 0,73 0,82 Karachaliou N 2015 PNA-LNA 0,81 0,95 Wang Z 2014 ddpcr 0,82 0,97 Zheng D ddpcr 0,84 0,91 Thress KS 2015 ARMS, ME-PCR, ddpcr 0,78-1 0,93-1 Que D 2016 ddpcr 0,89 0,85 Paquale R 2015 ARMS 0,65 0,99 Uchida J 2015 NGS 0,51 0,98 Sriram KB 2011 ME-PCR 0,62 0,97 Taniguchi K 2011 ddpcr 0,64 0,97 Nakamura T 2012 ME-PCR 0,67 0,99 Kim ST 2013 PNA-LNA 0,67 0,92 Brevet M 2011 Sequenom 0,67 0,99 Douillard JY 2014 ARMS 0,63 0,88 Weber B 2014 ME-PCR 0,68 0,93

14 Analytical validation: EGFR mutation in NSCLC Phase I trial with AZD9291 in NSCLC (AURA): 38 pre-dose plasma samples and matched tumor biopsies, after first development of resistance and 2 nd look biopsy have been evaluated cfdna was tested for 3 EGFR mutations (T790M, L858R, Exon 19 del) by 3 methods and compared with tissue Roche cobas PCR Qiagen Therascreen ARMS Sysmex Inostics BEAMing Exon 19 Deletion Assays Sensitivity 86% 82% 90% Specificity 100% 100% 100% Concordance 89% 87% 93% L858R (Exon 21) Assays Sensitivity 90% 78% 100% Specificity 100% 100% 91% Concordance 97% 95% 93% T790M (Exon 20) Assay Sensitivity 41% 29% 69% Specificity 100% 100% 67% Concordance 57% 48% 68% Thress, KS et al. Lung Cancer 2015

15 Clinical validation: 1. Prognosis after neoadjuvant treatment in early breast cancer ChemoNEAR study design Garcia-Murillas, I et al. Science Trans Med 2015

16 Clinical validation: 1. Prognosis after neoadjuvant treatment in early breast cancer Pre-therapy ctdna was not associated to prognosis Post-therapy ctdna was linked to poor prognosis Dynamic mutation tracking is highly accurate in predicting relapse Garcia-Murillas, I et al. Science Trans Med 2015

17 Clinical validation: 1. Prognosis after neoadjuvant treatment in early breast cancer Garcia-Murillas, I et al. Science Trans Med 2015

18 Normal signal Clinical validation: 2. Minimal residual disease in colorectal cancer N= 162 plasma samples (18 patients) Cell-Free Tumor DNA Levels Before and After Surgery Before surgery Day of Surgery After surgery Day 3 After surgery Day 244 Residual Mutant cfdna Diehl et al. Nature Medicine 2008 Mutant signal

19 Clinical validation: 3. Predictive value of plasma EGFR in NSCLC Plasma EGFR mut+ Plasma EGFR mut- Mok, T et al. Clin Cancer Res 2015

20 Clinical validation: 4. Emergence of secondary mutations in colorectal cancer TISSUE PLASMA Bettegowda et al, Sci Tran Med Feb 2014 Misale et al. Nature 2012 Diaz et al. Nature 2012

21 Mensajes finales El estudio de mutaciones en ctdna en algunos escenarios, como NSCLC, está ya analíticamente validado para su uso en la práctica asistencial El estudio de ctdna puede tener utilidad pronóstica, de predicción de respuesta, en el seguimiento y la monitorización de la enfermedad y en la detección de segundas mutaciones asociadas a resistencia Qué método de laboratorio y circuito se debe de crear en cada centro?

Qué es la Biopsia Líquida? Circulantes y Ácidos Nucleicos Circulantes. Federico Rojo

Qué es la Biopsia Líquida? Circulantes y Ácidos Nucleicos Circulantes. Federico Rojo Qué es la Biopsia Líquida? Células Tumorales Circulantes y Ácidos Nucleicos Circulantes Federico Rojo Liquid Biopsy in Cancer Liquid Biopsy in Cancer Publication Date: April 5, 2016 Blood Tests replace

More information

Pros and cons of liquid biopsy: Ready to replace tissue?

Pros and cons of liquid biopsy: Ready to replace tissue? Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:

More information

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro

La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Diagnostic with alternative sample types (liquid biopsy)

Diagnostic with alternative sample types (liquid biopsy) MOLECULAR DIAGNOSTICS OF EGFR AND T790M MUTATIONS CHALLENGES AND SOLUTIONS Diagnostic with alternative sample types (liquid biopsy) James CH Yang, MD, PhD Director, Professor, Graduate Institute of Oncology

More information

Cell-free tumor DNA for cancer monitoring

Cell-free tumor DNA for cancer monitoring Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the

More information

Liquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director

Liquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director Liquid Biopsy Jesus Garcia-Foncillas MD PhD Director Main issues about liquid biopsies New paradigm: Precision Medicine Heterogeneity & Dynamics Surrogate mirror for the tumor CTCs in colon cancer ctdna:

More information

Introduction to liquid biopsies. Rachel Butler All Wales Genetics Laboratory

Introduction to liquid biopsies. Rachel Butler All Wales Genetics Laboratory Introduction to liquid biopsies Rachel Butler All Wales Genetics Laboratory What is cell free DNA? Non-Invasive Prenatal Testing (NIPT) Extract DNA Genetic alterations detectable in circulating cell-free

More information

Lukas Bubendorf Pathologie. Liquid biopsies

Lukas Bubendorf Pathologie. Liquid biopsies Lukas Bubendorf Pathologie Liquid biopsies Liquid biopsies 1. Circulating cell-free tumor-dna (ctdna) 2. Circulating tumor cells (CTC) Source: Sysmex CTCs ctdna ctrna exosomes Quantification Protein RNA

More information

The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice

The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice The OncoBEAM Platform: The Use of a High Sensitive Technology for Liquid Biopsies in Clinical Practice Sysmex Inostics Dr. Friederike Lehmann Head of CRO Marketing Sysmex Corporation Kobe 2 Sysmex Corporation

More information

Aplicaciones de la biopsia líquida en Oncología

Aplicaciones de la biopsia líquida en Oncología Aplicaciones de la biopsia líquida en Oncología Congreso Nacional del Laboratorio Clínico 2017 Emilio Alba UGCI Oncología Médica. Hospital Universitario Regional y Virgen de la Victoria Departamento de

More information

ECMC cfdna consensus meeting

ECMC cfdna consensus meeting ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients

More information

Circulating Tumor DNA in GIST and its Implications on Treatment

Circulating Tumor DNA in GIST and its Implications on Treatment Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna

More information

Resultados del estudio Concordance: Relevancia clínica de la determinación del ADNtc mediante la tecnología BEAMing. Ana Vivancos

Resultados del estudio Concordance: Relevancia clínica de la determinación del ADNtc mediante la tecnología BEAMing. Ana Vivancos Resultados del estudio Concordance: Relevancia clínica de la determinación del ADNtc mediante la tecnología BEAMing Ana Vivancos Circulating tumor DNA extended RAS mutational analysis as a surrogate of

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

The OncoBEAM RAS liquid biopsy experience in real-world clinical practice Frederick S. Jones, Ph.D., Global Director, Medical Scientific

The OncoBEAM RAS liquid biopsy experience in real-world clinical practice Frederick S. Jones, Ph.D., Global Director, Medical Scientific The OncoBEAM RAS liquid biopsy experience in real-world clinical practice Frederick S. Jones, Ph.D., Global Director, Medical Scientific Affairs,Sysmex 2 OncoBEAM liquid biopsy: circulating tumor DNA (ctdna)

More information

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology

More information

Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)

Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Policy Number: Original Effective Date: MM.02.044 10/01/2018 Line(s) of Business: Current Effective Date Section: 10/01/2018

More information

Introduction to liquid biopsy in a Specialized Cancer Center

Introduction to liquid biopsy in a Specialized Cancer Center Introduction to liquid biopsy in a Specialized Cancer Center Dr. Antonio Cubillo Head, Medical OncologyDepartment HM-CIOCC In collaboration with OUTLINE Need Liquid Biopsy: Definition and techniques Sensitivity

More information

Youngnam Cho. National Cancer Center Biomarker Branch

Youngnam Cho. National Cancer Center Biomarker Branch Youngnam Cho National Cancer Center Biomarker Branch Contents 1. Liquid Biopsy 2. Circulating Tumor Cells from Blood 3. Cell-free DNA from Blood 1. Liquid biopsy Cancer Diagnosis IMAGING TISSUE BIOPSY

More information

Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)

Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Policy Number: 2.04.143 Last Review: 1/2018 Origination: 1/2018 Next Review: 1/2019 Policy Blue Cross and Blue Shield

More information

Enterprise Interest No

Enterprise Interest No Enterprise Interest No SY-05 Pulmonary Pathology: Options for targeted therapy in lung cancer Liquid biopsy in thoracic oncology Where are we now? Paul Hofman Laboratory of Clinical and Experimental Pathology

More information

Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~

Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ 16 th Dec. 2016. ESMO Preceptorship Program Non-Small-Cell Lung Cancer @Singapore Tissue or Liquid Biopsy? ~For Diagnosis, Monitoring and Early detection of Resistance~ Research Institute for Disease of

More information

Circulating DNA in diagnosis and monitoring EGFR gene mutations in advanced non-small cell lung cancer

Circulating DNA in diagnosis and monitoring EGFR gene mutations in advanced non-small cell lung cancer Review Article on Lung Cancer Diagnostics and Treatments 2015: A Renaissance of Patient Care Circulating DNA in diagnosis and monitoring EGFR gene mutations in advanced non-small cell lung cancer Paola

More information

Personalized oncology: the potential for tissue and cell-free DNA

Personalized oncology: the potential for tissue and cell-free DNA Open Citation: J Med Discov (2016); 1(1):jmd16005; doi:10.24262/jmd.1.1.16005 Commentary Personalized oncology: the potential for tissue and cell-free DNA biopsies to capture tumor heterogeneity Young

More information

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy

More information

Transforming Oncology With Precision Medicine Solutions. Company Overview January 2017

Transforming Oncology With Precision Medicine Solutions. Company Overview January 2017 Transforming Oncology With Precision Medicine Solutions Company Overview January 2017 FORWARD-LOOKING STATEMENTS Statements in this presentation about the Company's expectations, applications of its technology,

More information

Robert Beer

Robert Beer Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free

More information

La biopsia liquida dei tumori: il viaggio. Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome

La biopsia liquida dei tumori: il viaggio. Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome La biopsia liquida dei tumori: il viaggio Paola Gazzaniga Liquid Biopsy Unit Dept. Molecular Medicine Sapienza University of Rome Must Know Necessary Travel Tips There is lack of drugs to treat all the

More information

Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)

Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Circulating Tumor DNA for Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Policy Number: 2.04.143 Last Review: 1/2019 Origination: 1/2018 Next Review: 1/2020 Policy Blue Cross and Blue Shield

More information

MP Circulating Tumor DNA Management of Non-Small-Cell Lung Cancer (Liquid Biopsy)

MP Circulating Tumor DNA Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Medical Policy BCBSA Ref. Policy: 2.04.143 Last Review: 10/18/2018 Effective Date: 10/18/2018 Section: Medicine Related Policies 2.04.121 Miscellaneous Genetic and Molecular Diagnostic Tests 2.04.45 Molecular

More information

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Medical Policy An independent licensee of the Blue Cross Blue Shield Association Circulating Tumor DNA Management of Non-Small-Cell Lung Cancer (Liquid Biopsy) Page 1 of 36 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Circulating Tumor DNA

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER

FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER FUTURE PERSPECTIVES OF CIRCULATING TUMOR DNA IN COLORECTAL CANCER C. NADAL 1-3, T. WINDER 4, A. GERGER 5-6, D. TOUGERON 7-8 SELECTED HIGHLIGHTS 1 Medical Oncology Department, Institut Clínic de Malalties

More information

Circulating DNA in EGFR-mutated lung cancer

Circulating DNA in EGFR-mutated lung cancer Review Article Page 1 of 11 Circulating DNA in EGFR-mutated lung cancer Aditi P. Singh 1, Shenduo Li 2, Haiying Cheng 1 1 Department of Oncology, Montefiore Medical Center, Bronx, NY, USA; 2 Department

More information

Chenguang Li 1,2,3,4*, Rui Jia 1,2,3,4, Hailin Liu 1,2,3,4, Bin Zhang 1,2,3,4 and Changli Wang 1,2,3,4

Chenguang Li 1,2,3,4*, Rui Jia 1,2,3,4, Hailin Liu 1,2,3,4, Bin Zhang 1,2,3,4 and Changli Wang 1,2,3,4 Li et al. Diagnostic Pathology (2018) 13:49 https://doi.org/10.1186/s13000-018-0728-6 RESEARCH EGFR T790M detection and osimertinib treatment response evaluation by liquid biopsy in lung adenocarcinoma

More information

CTC in clinical studies: Latest reports on GI cancers

CTC in clinical studies: Latest reports on GI cancers CTC in clinical studies: Latest reports on GI cancers François-Clément Bidard, MD PhD GI cancers are characterized by Multimodal treatment strategies Treatments are adapted to tumor burden & prognosis

More information

ANTI-EGFR IN MCRC? Assoc. Prof. Gerald Prager, Medical University of Vienna, Austria

ANTI-EGFR IN MCRC? Assoc. Prof. Gerald Prager, Medical University of Vienna, Austria IS IT TIME TO RE-CHALLENGE ANTI-EGFR IN MCRC? Assoc. Prof. Gerald Prager, Medical University of Vienna, Austria Dr. Andrea Sartore-Bianchi, Oncologia Clinica Molecolare, Niguarda Cancer Center, Milano,

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

Medical Coverage Policy Circulating Tumor DNA and. Circulating Tumor Cells for Cancer Management (Liquid Biopsy)

Medical Coverage Policy Circulating Tumor DNA and. Circulating Tumor Cells for Cancer Management (Liquid Biopsy) Medical Coverage Policy Circulating Tumor DNA and Circulating Tumor Cells for Cancer Management (Liquid Biopsy) EFFECTIVE DATE: 12 01 2016 POLICY LAST UPDATED: 07 17 2018 OVERVIEW Circulating tumor DNA

More information

PRECISION INSIGHTS. Liquid GPS. Blood-based tumor profiling and quantitative monitoring. Reveal more with cfdna + cfrna.

PRECISION INSIGHTS. Liquid GPS. Blood-based tumor profiling and quantitative monitoring. Reveal more with cfdna + cfrna. PRECISION INSIGHTS Liquid GPS Blood-based tumor profiling and quantitative monitoring Reveal more with cfdna + cfrna www.nanthealth.com Why Blood-Based Tumor Profiling? Although tissue-based molecular

More information

Integrated platform for liquid biopsy-based personalized cancer medicine

Integrated platform for liquid biopsy-based personalized cancer medicine Integrated platform for liquid biopsy-based personalized cancer medicine Dr. Bernhard Polzer Fraunhofer ITEM-Regensburg Personalized Tumor Therapy Personalized cancer therapy Primary tumor single tumor

More information

Osimertinib as first-line treatment of EGFR mutant advanced nonsmall-cell

Osimertinib as first-line treatment of EGFR mutant advanced nonsmall-cell Editorial Osimertinib as first-line treatment of EGFR mutant advanced nonsmall-cell lung cancer Chong-Kin Liam Department of Medicine, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia

More information

Information Guide - August Liquid Biopsies for Cancer Management

Information Guide - August Liquid Biopsies for Cancer Management Information Guide - August 2017 Liquid Biopsies for Cancer Management INFORMATION GUIDE - AUGUST 2017 Liquid Biopsies for Cancer Management CIRCULATING TUMOR DNA IN BLOOD AS A LIQUID BIOPSY FOR CANCER

More information

Circulating tumour DNA in breast cancer. Kathleen Burke, PhD Bioinformatics Postdoctoral Fellow Laboratory of Dr. Jorge Reis-Filho

Circulating tumour DNA in breast cancer. Kathleen Burke, PhD Bioinformatics Postdoctoral Fellow Laboratory of Dr. Jorge Reis-Filho Circulating tumour DNA in breast cancer Kathleen Burke, PhD Bioinformatics Postdoctoral Fellow Laboratory of Dr. Jorge Reis-Filho Conflicts of Interest I have no financial relationships to disclose I will

More information

Urinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring. Summit August 19,2015

Urinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring. Summit August 19,2015 Urinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring Mark G. Erlander, Ph.D., CSO CHI Next Generation Summit August 19,2015 Circulating Tumor DNA (ctdna) Tumor cells Main Advantages of

More information

Role of liquid biopsy in lung cancer 20/10/2017

Role of liquid biopsy in lung cancer 20/10/2017 Role of liquid biopsy in lung cancer 20/10/2017 Overview of Seminar Background Concept of liquid biopsy Different Biological Components of Liquid Biopsy Various samples used in liquid biopsy EGFR mutation

More information

DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA

DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias

More information

Incorporating pharmacodynamic, response and patient selection biomarkers. Paul Elvin PhD Chief Translational Science Officer Aptus Clinical

Incorporating pharmacodynamic, response and patient selection biomarkers. Paul Elvin PhD Chief Translational Science Officer Aptus Clinical Incorporating pharmacodynamic, response and patient selection biomarkers Paul Elvin PhD Chief Translational Science Officer Aptus Clinical 22 Oncology drug development Biomarkers key for: Strong hypothesis

More information

Thor Nilsen NeoGeneStar LLC January 22, 2015

Thor Nilsen NeoGeneStar LLC January 22, 2015 Thor Nilsen NeoGeneStar LLC January 22, 2015 NeoGeneStar TM I. Liquid biopsy using circulating cell-free DNA: Cancer diagnostics Prenatal diagnostics Other disease states II. NeoGeneStar TM cell-free DNA

More information

MET skipping mutation, EGFR

MET skipping mutation, EGFR New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM

More information

See how you can guide the path her cancer takes

See how you can guide the path her cancer takes See how you can guide the path her cancer takes The need for improved diagnostics At the advanced edge of oncology, rapid access to accurate data on disease state is vital. Current technologies such as

More information

Liquid biopsy: the experience of real life case studies

Liquid biopsy: the experience of real life case studies Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal

More information

LUNG CANCER Searching early biomarkers in blood

LUNG CANCER Searching early biomarkers in blood LUNG CANCER Searching early biomarkers in blood Eloisa Jantus Lewintre Laboratorio Oncología Molecular- FIHGUV Servicio Oncología Médica, CHGUV Dpto Biotecnología- Universitat Politècnica de València CIBERONC,

More information

Blood as a Substitute for Tumor Tissue in Detecting EGFR Mutations for Guiding EGFR TKIs Treatment of Nonsmall Cell Lung Cancer

Blood as a Substitute for Tumor Tissue in Detecting EGFR Mutations for Guiding EGFR TKIs Treatment of Nonsmall Cell Lung Cancer Blood as a Substitute for Tumor Tissue in Detecting EGFR Mutations for Guiding EGFR TKIs Treatment of Nonsmall Cell Lung Cancer A Systematic Review and Meta-Analysis Chen Mao, PhD, Jin-Qiu Yuan, PhD, Zu-Yao

More information

Liquid biopsy in lung cancer: The EGFR paradigm

Liquid biopsy in lung cancer: The EGFR paradigm Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships

More information

Heterogeneidad tumoral. Federico Rojo

Heterogeneidad tumoral. Federico Rojo Heterogeneidad tumoral Federico Rojo Outline of the presentation Definition and evidences Intertumor heterogeneity Spatial and temporal intratumor heterogeneity Clinical implications of tumor heterogeneity.

More information

Shingo Nishikawa, Hideharu Kimura, Hayato Koba, Taro Yoneda, Satoshi Watanabe, Tamami Sakai, Johsuke Hara, Takashi Sone, Kazuo Kasahara, Shinji Nakao

Shingo Nishikawa, Hideharu Kimura, Hayato Koba, Taro Yoneda, Satoshi Watanabe, Tamami Sakai, Johsuke Hara, Takashi Sone, Kazuo Kasahara, Shinji Nakao Original Article Selective gene amplification to detect the T790M mutation in plasma from patients with advanced non-small cell lung cancer (NSCLC) who have developed epidermal growth factor receptor tyrosine

More information

Assay Location Primer TaqMan probe Reference

Assay Location Primer TaqMan probe Reference Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original

More information

Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL

Round Table: Tissue Biopsy versus Liquid Biopsy. César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Round Table: Tissue Biopsy versus Liquid Biopsy César A. Rodríguez Hospital Universitario de Salamanca-IBSAL Introduction Classic Advantages of liquid biopsy collection over standard biopsy Standard biopsy

More information

What do liquid biopsies offer us for breast cancer patients?

What do liquid biopsies offer us for breast cancer patients? What do liquid biopsies offer us for breast cancer patients? Isaac Garcia-Murillas Breast Cancer Now Research Centre, The institute of Cancer Research, London, UK Molecular Analysis of breast cancer Invasive

More information

Qué hemos aprendido hasta hoy? What have we learned so far?

Qué hemos aprendido hasta hoy? What have we learned so far? Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;

More information

Resistances to EGFR tyrosine kinase inhibitors in lung cancer how to routinely track them in a molecular pathology laboratory?

Resistances to EGFR tyrosine kinase inhibitors in lung cancer how to routinely track them in a molecular pathology laboratory? Review Article Resistances to EGFR tyrosine kinase inhibitors in lung cancer how to routinely track them in a molecular pathology laboratory? Véronique Hofman 1,2,3, Paul Hofman 1,2,3 1 Laboratory of Clinical

More information

Consensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018

Consensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018 Consensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018 Summary: This document follows on from the findings of the CM-Path The

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Advances in Pathology and molecular biology of lung cancer. Lukas Bubendorf Pathologie

Advances in Pathology and molecular biology of lung cancer. Lukas Bubendorf Pathologie Advances in Pathology and molecular biology of lung cancer Lukas Bubendorf Pathologie Agenda The revolution of predictive markers Liquid biopsies PD-L1 Molecular subtypes (non-squamous NSCLC) Tsao AS et

More information

Personalized Healthcare Update

Personalized Healthcare Update Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

Introduction. Case Report

Introduction. Case Report Case Report Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report Clara Mayo de las Casas 1, Maria

More information

Diagnostica Molecolare!

Diagnostica Molecolare! Diagnostica Molecolare! Aldo Scarpa Unità Diagnostica Molecolare Azienda Ospedaliera Universitaria Integrata di Verona e ARC-NET Centro di Ricerca Applicata sul Cancro PDTA CARCINOMA POLMONARE - IL PAZIENTE

More information

Circulating Tumor DNA and Circulating Tumor Cells for Management (Liquid Biopsy) of Solid Tumor Cancers

Circulating Tumor DNA and Circulating Tumor Cells for Management (Liquid Biopsy) of Solid Tumor Cancers NOTE: This policy is not effective until December 1, 2018. To view the current policy, click here. Medical Policy Manual Laboratory, Policy No. 46 Circulating Tumor DNA and Circulating Tumor Cells for

More information

State of the Art in Molecular Testing and Current Diagnostic Challenges

State of the Art in Molecular Testing and Current Diagnostic Challenges State of the Art in Molecular Testing and Current Diagnostic Challenges. 2017 Conversations in Oncology in Shanghai, China Mike Zhu, MD/PhD Amoy Diagnostics Co., Ltd BI Symposium Headline Update on molecular

More information

Validated and promising predictive factors in mcrc: Recent updates on RAS testing Fotios Loupakis, MD PhD

Validated and promising predictive factors in mcrc: Recent updates on RAS testing Fotios Loupakis, MD PhD Validated and promising predictive factors in mcrc: Recent updates on RAS testing Fotios Loupakis, MD PhD U.O. Oncologia 2 Universitaria Azienda Ospedaliero-Universitaria Pisana Pisa, Italy Learning Objectives

More information

Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study

Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study Osimertinib Activity in Patients With Leptomeningeal Disease From Non-Small Cell Lung Cancer: Updated Results From the BLOOM Study Abstract 9002 Yang JC, Kim DW, Kim SW, Cho BC, Lee JS, Ye X, Yin X, Yang

More information

circulating nucleic acids in pdf Circulating nucleic acids in plasma and serum: diagnosis QIAamp Circulating Nucleic Acid Handbook - Qiagen

circulating nucleic acids in pdf Circulating nucleic acids in plasma and serum: diagnosis QIAamp Circulating Nucleic Acid Handbook - Qiagen DOWNLOAD OR READ : CIRCULATING NUCLEIC ACIDS IN EARLY DIAGNOSIS PROGNOSIS AND TREATMENT MONITORING AN INTRODUCTION ADVANCES IN PREDICTIVE PREVENTIVE AND PERSONALISED MEDICINE PDF EBOOK EPUB MOBI Page 1

More information

Converting the Hype into Reality: Realizing the Potential of Cell-Free DNA

Converting the Hype into Reality: Realizing the Potential of Cell-Free DNA Converting the Hype into Reality: Realizing the Potential of Cell-Free DNA Lucy Xu, Ph.D. Associate Director Clinical Biomarker Research Eisai Inc. Woodcliff Lake, NJ Precision LBx Summit San Diego, CA

More information

Editorial Process: Submission:10/27/2017 Acceptance:05/25/2018

Editorial Process: Submission:10/27/2017 Acceptance:05/25/2018 DOI:10.22034/APJCP.2018.19.7.1761 TKI by Liquid Biopsy RESEARCH ARTICLE Editorial Process: Submission:10/27/2017 Acceptance:05/25/2018 A Case-control Study Supporting the Use of Liquid Biopsy in the Targeted

More information

CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases

CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases CLIA Laboratory Testing of Urinary BRAF V600E DNA mutations: Application in the Management of Patients with Histiocytic Diseases Adriana Muniz 1, Mariko Matsutani 1, Karena Kosco 1, John Spinosa 1, Cecile

More information

Review Article Capturing Genomic Evolution of Lung Cancers through Liquid Biopsy for Circulating Tumor DNA

Review Article Capturing Genomic Evolution of Lung Cancers through Liquid Biopsy for Circulating Tumor DNA Hindawi Oncology Volume 2017, Article ID 4517834, 5 pages https://doi.org/.1155/2017/4517834 Review Article Capturing Genomic Evolution of Lung Cancers through Liquid Biopsy for Circulating Tumor DNA Michael

More information

Molecular Testing in Lung Cancer

Molecular Testing in Lung Cancer Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans

More information

Clonal evolution in response to anti-egfr therapies

Clonal evolution in response to anti-egfr therapies ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica Clonal

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

FEP Medical Policy Manual

FEP Medical Policy Manual FEP Medical Policy Manual Effective Date: January 15, 2019 Related Policies: None Circulating Tumor DNA for Management of Non-Small-Cell Lung Description Genetic testing of circulating tumor DNA (ctdna)

More information

T790M como marcador predictivo de respuesta. Mariano Provencio

T790M como marcador predictivo de respuesta. Mariano Provencio T790M como marcador predictivo de respuesta Mariano Provencio CASO 1 Provencio et al submitted. Provencio et al submitted. C + 450 días: Progresión Taponamiento cardiaco Distress respiratorio ingreso por

More information

Liquid biopsies come of age: towards implementation of circulating tumour DNA

Liquid biopsies come of age: towards implementation of circulating tumour DNA Liquid biopsies come of age: towards implementation of circulating tumour DNA Jonathan C. M. Wan 1,2, Charles Massie 1,2, Javier Garcia-Corbacho 3, Florent Mouliere 1,2, James D. Brenton 1,2, Carlos Caldas

More information

Liquid biopsy based biomarkers in non-small cell lung cancer for diagnosis and treatment monitoring

Liquid biopsy based biomarkers in non-small cell lung cancer for diagnosis and treatment monitoring Review Article Liquid biopsy based biomarkers in non-small cell lung cancer for diagnosis and treatment monitoring David Pérez-Callejo, Atocha Romero, Mariano Provencio, María Torrente Department of Medical

More information

Celvrij DNA: nieuwe diagnostische mogelijkheden

Celvrij DNA: nieuwe diagnostische mogelijkheden Celvrij DNA: nieuwe diagnostische mogelijkheden Dr. Helena Devos - Hematologie voor de huisarts 2.0 9 februari 2019 Content What is cell free DNA? Clinical applications: Prenatal: NIPT In oncology/hematology:

More information

Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System

Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular

More information

Development of Circulating Tumor DNA

Development of Circulating Tumor DNA Development of Circulating Tumor DNA Title of presentation Arial Bold 30pt in White Biomarkers Secondary title 22pt using Arial Next in White Generation Sequencing Brian Dougherty PhD, MBA Translational

More information

Better Cancer Monitoring with Circulating Tumor DNA. March 2016

Better Cancer Monitoring with Circulating Tumor DNA. March 2016 Better Cancer Monitoring with Circulating Tumor DNA March 2016 Forward-Looking Statements Statements in this presentation about the Company's expectations, applications of its technology, markets, launch

More information

Application of Cell-free DNA Analysis to Cancer Treatment

Application of Cell-free DNA Analysis to Cancer Treatment The new england journal of medicine Review Article From the Massachusetts General Hospital Cancer Center and the Department of Medicine, Harvard Medical School, Boston. Address reprint requests to Dr.

More information

Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report

Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report Case Report Exon 19 L747P mutation presented as a primary resistance to EGFR-TKI: a case report Yu-Ting Wang, Wei-Wei Ning, Jing Li, Jian-n Huang Department of Respiratory Medicine, the First ffiliated

More information

See how you can guide the path her cancer takes

See how you can guide the path her cancer takes See how you can guide the path her cancer takes 1 Idylla : easy, rapid and accurate molecular medicine for every patient Paola Valente Strategic Marketing Biocartis 6th meeting on external quality assessment

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Venook AP, Niedzwiecki D, Lenz H-J, et al. Effect of first-line chemotherapy combined with cetuximab or bevacizumab on overall survival in patients with KRAS wild-type advanced

More information

LIQUID BIOPSY RESEARCH TOOLS, SERVICES AND DIAGNOSTICS: GLOBAL MARKETS

LIQUID BIOPSY RESEARCH TOOLS, SERVICES AND DIAGNOSTICS: GLOBAL MARKETS LIQUID BIOPSY RESEARCH TOOLS, SERVICES AND DIAGNOSTICS: GLOBAL MARKETS BIO150A January 2016 John Bergin Project Analyst ISBN: 1-62296-224-9 BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 USA

More information

Plasma ctdna RAS/RAF mutations analysis for monitoring overall survival (OS) and heterogeneity in metastatic colorectal cancer patients (mcrc)

Plasma ctdna RAS/RAF mutations analysis for monitoring overall survival (OS) and heterogeneity in metastatic colorectal cancer patients (mcrc) Plasma ctdna RAS/RAF mutations analysis for monitoring overall survival (OS) and heterogeneity in metastatic colorectal cancer patients (mcrc) Authors: Andrea Petricca Mancuso, Veronica Varchetta, Fabrizio

More information

ccfdna Webinar Series: The Basics and Beyond

ccfdna Webinar Series: The Basics and Beyond ccfdna Webinar Series: The Basics and Beyond Part I Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. Introduction to Circulating,

More information

Treatment of EGFR mutant advanced NSCLC

Treatment of EGFR mutant advanced NSCLC Treatment of EGFR mutant advanced NSCLC Raffaele Califano Department of Medical Oncology The Christie and Manchester University Hospital Manchester, UK Outline Data on first-line Overcoming T790M mutation

More information

HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY

HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY HOW TO GET THE MOST INFORMATION FROM A TUMOR BIOPSY 7 TH Annual New York Lung Cancer Symposium Saturday, November 10, 2012 William D. Travis, M.D. Attending Thoracic Pathologist Memorial Sloan Kettering

More information

Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy

Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy Individualized Cancer Therapy: Chemotherapy Resistance Testing before Therapy 1 st st International Oncological Conference Wrocław, October 6 th, 2012 Dr. Frank Kischkel Individualized Cancer Therapy:

More information