Development of important genes during breast carcinogenesis
|
|
- Fay Hutchinson
- 5 years ago
- Views:
Transcription
1 Nagoya Med. J., 107 Development of important genes during breast carcinogenesis AYA NAIKI-ITO Department of experimental pathology and tumor biology Nagoya City University Graduate School of Medical Sciences Carcinogen exposure induces many gene expression changes in either target or non-target organ, some of them may be important for carcinogenic process but others not. In this study, we attempt to find crucial genes which may be important for mammary carcinogenesis. For this purpose, we used human c-ha-ras proto-oncogene transgenic rats Hraswhich are highly sensitive for mammary carcinogens, N-methyl-N-nitrosourea MNU,, -dimethyl benz a anthracene DMBA and -amino- methyl phenylimidazo-b pyridine PhIP. We found Gpx as an up-regulated gene commonly in all mammary carcinomas induced the different three carcinogens by DNA microarray analysis, and its up-regulation was confirmed by quantitative RT-PCR. In addition, immunohistochemically highly expression of GPX was detected in not only rat mammary carcinomas but also human breast cancers. Knockdown of GPX expression by sirna resulted in significant growth inhibition in both rat and human mammary carcinoma cell lines by p dependent manner. Thus, those data clearly demonstrated that GPX is involved in mammary carcinogenesis and cell proliferation in both rat and human, indicating that GPX may be a novel target of prevention and therapy for breast cancers. HER c-ha-ras 107
2 108 Hras Hras N-methyl-N-nitrosourea MNU dimethylbenz a - anthracene DMBA amino- -methyl- -phenylimidazo-b]pyridine PhIP Hras RNA DNA CodeLink rat whole genome Hras Glutathione peroxidase Gpx Hras MNU DMBA PhIP RNA Gpx mrna RT- PCR Figure Hras - DMBA RMC- Gpx mrna Table Western blotting Gpx Gpx Figure MCF- T D MDA-MB- GPX mrna Table Figure. Relative Gpx expression levels in carcinogeninduced mammary cancers. The data were obtained by quantitative RT-PCR as described in the materials and methods. Gpx mrna expression level was adjusted by cytokeratin.*, p,**, p compared with control value Student s t test. Table. GPX mrna level of rat and human mammary carcinoma cell lines.
3 109 Figure. A. Western blot of normal mammary tissue and carcinoma in Hras rats. Lane to, normal mammary tissue. Lane to, carcinogen-induced mammary cancer; to, MNU, to, DMBA,and to, PhIP-induced. C. Immunohistochemical findings of Gpx in rat mammary carcinomas induced by MNU, DMBA and PhIP. Gpx was strongly positive in the cytoplasm of tumor cells. Non-tumorous mammary glands of Hras rats were completely negative. GPX GPX GPX Figure GPX GPX sirna Figure. Histological appearance of human breast cancers and GPX immunohistochemical staining. A, C, E : H&E,and B, D, F : immunohistochemistry. GPX staining was positive in the cytoplasm of human breast cancer cells regardless of tumor type. A to F were invasive ductal carcinoma; A and B were papillotubular carcinoma, C and D were solid-tubular carcinoma and E and F were scirrhous carcinoma. GPX GPX p p p p GPX p GPX Figure DNA
4 110 GPX GPX GPX p in vitro GPX GPX p Figure. GPX affects p -dependent cell proliferation in both rat and human mammary cancer cells. A. Rat mammary cancer cell lines, C with wild-type p showed clear inhibition of cell proliferation by Gpx silencing but not in the C with mutant p. *: Student s t test, p, **: p. Lower graphs show knockdown efficiency by quantitative RT-PCR. B. Human mammary carcinoma cell line, MCF- with wild-type p, showed significant inhibition of cell proliferation by GPX suppression, while another human breast cancer cell line, T D with mutant p showed no apparent change **: Student s t test, p. Lower graphs show knockdown efficiency by quantitative RT-PCR. Gpx GPX mrna GPX MCF- T D MDA-MB- GPX mrna Dumitrescu RG, Cotarla I: Understanding breast cancer risk wheredowestandin? JCell Mol Med : -, Asamoto M, Ochiya T, Toriyama-Baba H, et al.: Transgenic rats carrying human c-ha-ras protooncogenes are highly susceptible to N-methyl-Nnitrosourea mammary carcinogenesis Carcinogenesis : -, Naito A, Suzuki A, Ueda S, et al.: Preferential mammary carcinogenic effects of -amino- methyl- -phenylimidazo, -b pyridine PhIP in human c-ha-ras proto-oncogene transgenic rats Cancer Sci : -, Tsuda H, Asamoto M, Ochiya T, et al.: Highsusceptibility of transgenic rats carrying the human c- Ha-ras proto-oncogene to chemically-induced mammary carcinogenesis Mutat Res : -, YanW,ChenX:GPX, a direct target of p, inhibits oxidative stress-induced apoptosis in a p dependent manner J Biol Chem : -,
5 111 Chu FF, Esworthy RS, Doroshow JH: Role of Sedependent glutathione peroxidases in gastrointestinal inflammation and cancer Free Radic Biol Med :-, Chu FF, Doroshow JH, Esworthy RS: Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase, GSHPx-GI J Biol Chem : -, Banning A, Kipp A, Schmitmeier S, et al.: Glutathione Peroxidase Inhibits Cyclooxygenase- - Mediated Migration and Invasion of HT- Adenocarcinoma Cells but Supports Their Growth as Tumors in Nude Mice Cancer Res : -, Dewa Y, Nishimura J, Muguruma M, et al.: Gene expression analyses of the liver in rats treated with oxfendazole Arch Toxicol : -, Lacroix M, Toillon RA, Leclercq G: p and breast cancer, an update Endocr Relat Cancer : -,
6 112
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationTitle: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis
Author's response to reviews Title: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis Authors: Kensuke Akaogi (kensuke.akaogi@gmail.com) Wakana Ono (wakana315@gmail.com)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationContents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ
Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5
More informationThe mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationTITLE: Enhancement of Tumor Immunotherapy by Blockade of a Prostate Tumor Derived Immunosuppressive Factor
AD AWARD NUMBER: W81XWH-04-1-0185 TITLE: Enhancement of Tumor Immunotherapy by Blockade of a Prostate Tumor Derived Immunosuppressive Factor PRINCIPAL INVESTIGATOR: Xu Hui, Ph.D. CONTRACTING ORGANIZATION:
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationFunctional genomics reveal that the serine synthesis pathway is essential in breast cancer
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer Results Presented by Stacey Lin Lloyd Lab http://www.amsbio.com/expression-ready-lentiviral-particles.aspx Overview
More informationEarly Embryonic Development
Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal
More informationFGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
More informationMolecular and genetic analysis of stromal fibroblasts in prostate cancer
Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationToxicity profiles of heterocyclic aromatic amines Bettina Seeger and Pablo Steinberg
Toxicity profiles of heterocyclic aromatic amines Bettina Seeger and Pablo Steinberg Institute for Food Toxicology and Analytical Chemistry Mutagenic compounds present in strongly heated meat polycyclic
More informationstability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationEpstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationKey words: epidermal growth factor receptor, c-erbb-2, esophageal cancer, gastric cancer, colonic cancer
Key words: epidermal growth factor receptor, c-erbb-2, esophageal cancer, gastric cancer, colonic cancer Table 1 Histologic types of esophageal, gastric and colonic cancer and human gastric cancer xenografts
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSmoke Like a Man, Survive Like a Woman
Smoke Like a Man, Survive Like a Woman Sex Specific Differences in Lung Cancer Pulmonary Grand Rounds Philippe R. Montgrain, M.D. May 1, 2008 Objectives 1. Review how lung cancer differs in men and women.
More informationTITLE: Induction of Ephs/Ephrins-Mediated Tumor Cells-Endothelial Cells Repulsion as an Anti-Cancer Therapeutic Approach
AD Award Number: W81XWH-04-1-0661 TITLE: Induction of Ephs/Ephrins-Mediated Tumor Cells-Endothelial Cells Repulsion as an Anti-Cancer Therapeutic Approach PRINCIPAL INVESTIGATOR: Gerald Batist, M.D. CONTRACTING
More informationSupplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationSection D: The Molecular Biology of Cancer
CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty
More informationTHE STUDY ON RELATIONSHIP BETWEEN CIGARETTE SMOKING AND THE p53 PROTEIN AND P21 PROTEIN EXPRESSION IN NON-SMALL LUNG CANCER
( Thmese Journal of ('ancer Research 8(3): 187-19L 1996. THE STUDY ON RELATIONSHIP BETWEEN CIGARETTE SMOKING AND THE p53 PROTEIN AND P21 PROTEIN EXPRESSION IN NON-SMALL LUNG CANCER ZhouBaosen )~j'#:~ lleanguang
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationNuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.
SZENT ISTVÁN UNIVERSITY FACULTY OF VETERINARY MEDICINE Nuclear Receptors Estrogen and Thyroid Hormone Receptors and their Interaction Lior Kerner Budapest, 2012 What are Nuclear Receptors? o Proteins located
More informationExpression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma
Expression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma C.H. Zeng, B. Guo, J. Chen, W.M. He and Q.L. Luo Ophthalmology Department of West China Hospital, Sichuan University, Sichuan,
More informationER- 36, a Novel Variant of ER-, is Expressed in ER-positive and -negative Human Breast Carcinomas
ER- 36, a Novel Variant of ER-, is Expressed in ER-positive and -negative Human Breast Carcinomas LISA M.J. LEE 1, JIANG CAO 3, HAO DENG 4, PING CHEN 3, ZORAN GATALICA 1 and ZHAO-YI WANG 1,2 1 Department
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationTITLE: The Role of Constitutively Active Prolactin Receptors in the Natural History of Breast Cancer
AD Award Number: W81XWH-06-1-0448 TITLE: The Role of Constitutively Active Prolactin Receptors in the Natural History of Breast Cancer PRINCIPAL INVESTIGATOR: Kuang-tzu Huang CONTRACTING ORGANIZATION:
More information8/1/2016. FDG uptake in a heterogeneous microenvironment: A single-cell study. Heterogeneity of FDG uptake in tumors grafts. Goals of the study
FDG uptake in a heterogeneous microenvironment: A single-cell study J O IN T AAPM- W M I S S YMP O S IU M: M E TA B O L IC I MA G IN G OF C A N C E R Guillem Pratx, PhD Radiation Oncology & Medical Physics
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationIDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER"
IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER" Edmond Marzbani, MD December 2, 2008 Early diagnosis of cancer Many solid tumors are potentially curable if diagnosed at an early stage
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationSupplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationDown-regulation of CacyBP is associated with poor prognosis and the effects on COX-2 expression in breast cancer
INTERNATIONAL JOURNAL OF ONCOLOGY 37: 1261-1269, 2010 Down-regulation of CacyBP is associated with poor prognosis and the effects on COX-2 expression in breast cancer FANG NIE, XIAO-LING YU, XIAO-GE WANG,
More informationCELL CYCLE REGULATION AND CANCER. Cellular Reproduction II
CELL CYCLE REGULATION AND CANCER Cellular Reproduction II THE CELL CYCLE Interphase G1- gap phase 1- cell grows and develops S- DNA synthesis phase- cell replicates each chromosome G2- gap phase 2- cell
More informationSupplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
More informationCH Cho *, J Yu, WKK Wu 1,2
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Identification of pathogenic micrornas in Helicobacter pylori-associated gastric cancer using a combined approach of animal study and clinical sample
More informationHigh expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis
High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis Supplementary Material Supplementary Figure S1. Representative CRBP-1 immunostaining of non-neoplastic
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationBiochemistry of Cancer and Tumor Markers
Biochemistry of Cancer and Tumor Markers The term cancer applies to a group of diseases in which cells grow abnormally and form a malignant tumor. It is a long term multistage genetic process. The first
More informationCONTRACTING ORGANIZATION: University of Illinois Chicago, IL
AD Award Number: W81XWH-05-1-0009 TITLE: Selenoproteins and Prostate Cancer PRINCIPAL INVESTIGATOR: Veda Navsariwala, Ph.D. CONTRACTING ORGANIZATION: University of Illinois Chicago, IL 60612-7205 REPORT
More informationExploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
University of Windsor Scholarship at UWindsor UWill Discover Undergraduate Conference UWill Discover 2016 Mar 29th, 4:00 PM - 5:00 PM Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
More information5. Summary of Data Reported and Evaluation
326 5. Summary of Data Reported and Evaluation 5.1 Exposure data Combined estrogen progestogen menopausal therapy involves the co-administration of an estrogen and a progestogen to peri- or postmenopausal
More informationBIT 120. Copy of Cancer/HIV Lecture
BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations
More informationAbnormality of p16/p38mapk/p53/wipl pathway in papillary thyroid cancer
Original Article Abnormality of p16/p38mapk/p53/wipl pathway in papillary thyroid cancer Dehua Yang, Hao Zhang, Xinhua Hu, Shijie Xin, Zhiquan Duan Department of Vascular and Thyroid Surgery, the First
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationHuman Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop
Human Lung Cancer Pathology and Cellular Biology Mouse Lung Tumor Workshop Jan 7 th and 8 th, 2014 Brigitte Gomperts, MD University of California, Los Angeles Lung Structure and Function Airway Epithelial
More informationTHYROID TUMOR DIAGNOSIS: MARKER OF THE MONTH CLUB
THYROID TUMOR DIAGNOSIS: MARKER OF THE MONTH CLUB CHARACTERISTIC OF THE IDEAL TUMOR MARKER Specific Sensitive Easy to perform Easy to interpret Adaptable to FNA Reasonable cost (CHEAP) THYROID TUMOR MARKERS
More information5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationSUPPLEMENTARY INFORMATION
Supplementary Information S3 Tumor inhibitory effects of calcitriol and vitamin D in animal models The multiple anti-cancer actions exerted by calcitriol, analogs or dietary vitamin D in rodent models
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationChapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
More informationRare Breast Tumours. 1. Breast Tumours. 1.1 General Results. 1.2 Incidence
Rare Breast Tumours 1. Breast Tumours 1.1 General Results Table 1. Epithelial Tumours of Breast: Incidence, Trends, Survival Flemish Region 2001-2010 Incidence Trend Survival Females EAPC Relative survival
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationBasement membrane in lobule.
Bahram Memar, MD Basement membrane in lobule. Normal lobule-luteal phase Normal lobule-follicular phase Lactating breast Greater than 95% are adenocarcinomas in situ carcinomas and invasive carcinomas.
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationGenes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationPage 2. When sirna binds to mrna, name the complementary base pairs holding the sirna and mrna together. One of the bases is named for you. ...with...
Q1.Human immunodeficiency virus (HIV) particles have a specific protein on their surface.this protein binds to a receptor on the plasma membrane of a human cell and allows HIV to enter. This HIV protein
More informationCCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask.
CCN1: A NOVEL TARGET FOR PANCREATIC CANCER Andrew Leask CIHR Group in Skeletal Development and Remodeling, Division of Oral Biology and Department of Physiology and Pharmacology, Schulich School of Medicine
More informationAntioxidants and Viral Infections: Host Immune Response and Viral Pathogenicity
Review Antioxidants and Viral Infections: Host Immune Response and Viral Pathogenicity Melinda A. Beck, PhD Departments of Pediatrics and Nutrition, University of North Carolina at Chapel Hill, Chapel
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 1 Molecular Basis of Cancer Molecular Oncology Keisha
More informationDevelopment of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs
Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs Emmanuel. Akala, R.Ph., Ph.D. Department of Pharmaceutical Sciences School of Pharmacy First Generation Polymeric
More informationIntroduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.
Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationMicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee
MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -
More informationAbstract : Julian Spallholz; Texas Tech University, Lubbock, Texas
Abstract : Julian Spallholz; Texas Tech University, Lubbock, Texas Redox Selenium ADCs Improve Cancer Cell Monoclonal Antibody Cytotoxicity Julian E. Spallholz, PhD Texas Tech University, Lubbock, Texas
More informationSUPPRESSION OF CLAUDIN-7 ENHACES HUMAN LUNG CANCER CELL SURVIVAL. Spencer M. Jackson. Honors College. East Carolina University
SUPPRESSION OF CLAUDIN-7 ENHACES HUMAN LUNG CANCER CELL SURVIVAL By Spencer M. Jackson A Senior Honors Project Presented to the Honors College East Carolina University In Partial Fulfillment of the Requirements
More informationTitle: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients
Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang
More informationSection D. Genes whose Mutation can lead to Initiation
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More information1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to
More information