Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis
|
|
- Ruby Chapman
- 5 years ago
- Views:
Transcription
1 Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative and promising entirely new targeted therapy for cancer. Mammalian neuraminidase-1 (Neu1) in complex with matrix metalloproteinase-9 and G-protein coupled receptor tethered to RTKs and TLRs is identified as a major target in the multi-stage of tumorigenesis. Preclinical studies support an entirely new cancer targeted therapy: unaffected by mutations of growth factor receptors, blocks tumor neovascularization, overcomes chemo-resistance of tumors, blocks immune-mediated tumorigenesis, blocks tissue invasion and metastasis.
2 Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Oseltamivir phosphate Published: TLR-4, -7 & -9 EGFR Trk insulin Therapeutic efficacy of oseltamivir phosphate alone or in combination with chemotherapeutics tumor growth and metastatic spread, tumour neovascularization and chemoresistance pancreatic, breast and ovarian cancers heterotopic xenograft of tumors growing in RAGxCγ double mutant mice
3 Cellular Signalling 25 (213) Highlights.. EGFR is fully glycosylated on 8 of the 11 Asn-X-Ser/Thr (X Pro) canonical N- glycosylation sites; two of the sites are not glycosylated, and one is partially glycosylated. The mechanism(s) behind epidermal growth factor (EGF)-induced receptors is unknown. The modification of glycosylation on EGF receptors involves the activation of Neu1. EGF binding receptor activates neuromedin B receptor (NMBR or BB1) GPCR Neu1 MMP-9 crosstalk tethered to EGFR at the ectodomain on the cell
4 EGF Fluorogenic sialidase specific substrate, 4-MUNANA 45 nm methylumbelliferone Gilmour, Abdulkhalek et al 213 Cellular Signalling 25: 2587 (open access)
5 Gilmour, Abdulkhalek etal. 213 Cellular Signalling 25 (213) (open access)
6 pegfr pstat1 Highlights Individual necropsied tumors were taken from untreated and 1 mg/kg OP treated cohorts. Freshly frozen tumors were thawed on ice, and lysed in lysis buffer containing proteinase and phosphatase inhibitors. Tamiflu treatment at 1 mg/kg (i.p.) attenuated pegfr, pstat1 and pnfκb activity in heterotopic xenografts of MiaPaCa-2-eGFP tumors growing in RAGxCγ double mutant mice. pnfκb Oseltamivir phosphate targets xenografts of MiaPaCa-2 tumors growing in RAGxCγ double mutant mice.
7 Biophotonic imaging of live necropsy tissues egfp-miapaca-2
8 egfp-miapaca-2 Gilmour, Abdulkhalek et al Cellular Signalling (open access)
9 Clinical problem... Resistance to drug therapy, along with high rates of metastasis, contributes to the low survival rate in patients diagnosed with pancreatic cancer.
10 Established chemo-resistant PANC1 against.1μm gemcitabine for over 1 yr
11 Established chemo-resistant PANC1 against 8μM Cisplatin for over 1 yr
12 Established chemo-resistant PANC1 against 8μM Cisplatin +.1μM Gem for over 1 yr
13 C o r r e c te d D e n s ity m e a n S.E. (n = 6 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) PANC1 untreated Tamiflu 24 hrs no 1 Ab E -c a d h e r r in N -c a d h e r in V E -c a d h e r in P < P = P < B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L
14 C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) PANC1 GemR.1μM untreated Tamiflu 24 hrs no 1 Ab E -c a d h e r in N -c a d h e r in V E -c a d h e r in 2 5 P = P < P =.7 B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L
15 PANC1 CisR 8μM C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) untreated Tamiflu 24 hrs no 1 Ab E -c a d h e r in N -c a d h e r in V E -c a d h e r in 1 5 n.s P = P =.9 B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L
16 Paraffinembedded tumor staining: Fluorescence microscopic analyses Findings indicate a reversal of EMT following treatment with oseltamivir phosphate, as demonstrated by expression of N- cadherin, VE-cadherin, and E-cadherin as characteristic markers of EMT, and an increase in the sensitivity of chemoresistant pancreatic cancer cells to drug therapy.
17 Highlights.. Triple-negative breast cancers (TNBCs) lack the estrogen, progesterone, and epidermal growth factor (EGF) receptor-2 (HER2/neu) receptors. Patients with TNBC have typical high grading, more frequent relapses, and exhibit poorer outcomes or prognosis compared with the other subtypes of breast cancers. Currently, there are no targeted therapies that are effective for TNBC.
18 T u m o u r W e ig h t / M o u s e w t (g ) untreated OP 3mg/kg OP 5mg/kg p < untreated OP 3mg/kg OP 5mg/kg U n tr e a te d c o n tr o l O P 3 m g /k g O P 5 m g /k g
19 L u n g W e ig h t/ M o u s e w t (g ) N u m b e r o f m e ta s ta tic c lu s te rs p e r lu n g L u n g m e ts 6 5 A B u n tr e a te d c o n tr o l O P 3 m g /k g O P 5 m g /k g C. 8 A v e r a g e L u n g W e ig h ts. 6 untreated OP 3mg/kg OP 5mg/kg A4 B2 C U n tr e a te d c o n tr o l O P 3 m g /k g O P 5 m g /k g
20 Highlights.. Snail, a transcriptional factor and repressor of E-cadherin is well known for its role in cellular invasion. It can regulate epithelial to mesenchymal transition (EMT) during embryonic development and in epithelial cells. Snail also mediates tumor progression and metastases. Silencing of Snail and its associate member Slug in human A278 ovarian epithelial carcinoma cell line was investigated to identify its role in tumor neovascularization.
21 T u m o r v o lu m e (m m 3 ) A B 2 5 A (n = 4 ) 2 A S L U G K D (n = 4 ) A S N A IL K D (n = 4 ) A4 B4 C4 D a y s P o s t O v a r ia n A Im p la n ta tio n
22 Novelty Abdulkhalek et al. Clinical and Translational Medicine 214, 3:28 SNAIL: a zinc finger transcriptional repressor SNAIL KD SLUG KD Snail genes act primarily as survival factors and inducers of cell movement? Signaling cascade Tumor vasculature secreted cytokines
23 Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis
24 Conclusions The role of mammalian neuraminidase-1 (Neu1) is identified as a major target in the multi-stage of tumorigenesis. An innovative and promising entirely new targeted therapy for cancer.
25
26 A C 1G needle B PLGA-empty PLGA-OP 2mg
27 T u m o r v o lu m e ( m m 3 ) T u m o u r W e ig h t/ M o u s e (g ) 1 6 U n tre a te d 1 2 P L G A e m p ty P L G A -O P 2 m g. 6 8 P L G A s u r g ic a l im p la n t U p < D a y s P o s t P a n c -1 Im p la n ta tio n U n tr e a te d c o n tr o l P L G A e m p ty P L G A -O P 2 m g p <
28 r e l a t i v e t o t a l s t a i n i n g d e n s i t y A C B D p <. 6 8 p < H o s t C D 3 1 T u m o r E - c a d h e r i n T u m o r N - c a d h e r i n 2 A b c t r l 1 5 p <. 8 1 p < n. s. p < Blank PLGA U n t r e a t e d P L G A P L G A - O P U n t r e a t e d P L G A P L G A - O P U n t r e a t e d P L G A P L G A - O P PLGA 2mg OP U n t r e a t e d P L G A P L G A - O P
29 N u m b e r m e ta s ta tic c lu s te rs p e r lu n g N u m b e r m e ta s ta tic c lu s te rs p e r liv e r A U n tr e a te d c o n tr o l P L G A P L G A -O P 2 m g /k g B U n tr e a te d c o n tr o l P L G A P L G A -O P 2 m g
Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations
Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen
More informationTranscriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma
Abdulkhalek et al. Clinical and Translational Medicine 2014, 3:28 RESEARCH Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma
More informationCancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationClaudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression
Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta
More informationCell Polarity and Cancer
Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationFundamental research on breast cancer in Belgium. Rosita Winkler
Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -
More informationGamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells
Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationContents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ
Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5
More informationMatrix metalloproteinase 1 and circulating tumor cells in early breast cancer.
National Cancer Institute Slovakia Translational Research Unit Slovakia Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer. Mego M 1, 2, Karaba M 2, Cierna Z 1, Janega P 1, Minarik
More informationOUTLINE PAST PRESENTFUTURE BREAST CANCER INCIDENCE AND MORTALITY CURRENT STATE OF MEDICAL ONCOLOGY SECOND ANNUAL BREAST CANCER SYMPOSIUM
OUTLINE CURRENT STATE OF MEDICAL ONCOLOGY SECOND ANNUAL BREAST CANCER SYMPOSIUM October 11, 2014 SARA M GARRIDO, M.D., F.A.C.P Chief Medical Officer at AMS Miami, October 11, 2014 PAST PRESENTFUTURE -BRIEF
More informationNimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated
Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated apoptosis and inhibition of epithelial-to-mesenchymal transition Ramadevi Subramani a, Ph.D., Elizabeth Gonzalez b, MS.,
More informationCHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
More informationTumour Markers. For these reasons, only a handful of tumour markers are commonly used by most doctors.
Tumour Markers What are Tumour Markers? Tumour markers are substances that can be found in the body when cancer is present. They are usually found in the blood or urine. They can be products of cancer
More informationEvaluation the Correlation between Ki67 and 5 Years Disease Free Survival of Breast Cancer Patients
BIOSCIENCES BIOTECHNOLOGY RESEARCH ASIA, December 2015. Vol. 12(3), 2221-2225 Evaluation the Correlation between Ki67 and 5 Years Disease Free Survival of Breast Cancer Patients S.M. Hosseini¹, H. Shahbaziyan
More informationCancer Prevention and Research Institute of Texas. November 2017
Cancer Prevention and Research Institute of Texas November 2017 Best In Class Significant Upside Strong Non-Dilutive Funding Focused on Epigenetics The way cancer cells regulate gene expression Lead drug,
More informationYanrong Su *, Nathan R. Hopfinger, Theresa D. Nguyen, Thomas J. Pogash, Julia Santucci-Pereira and Jose Russo *
Su et al. Journal of Experimental & Clinical Cancer Research (2018) 37:314 https://doi.org/10.1186/s13046-018-0988-8 RESEARCH Open Access Epigenetic reprogramming of epithelial mesenchymal transition in
More informationFrancesco Parlati, Ph.D.
Novel Pharmacodynamic Assays to Measure Glutaminase Inhibition Following Oral Administration of CB-839 Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, California Disclosure Information
More informationIn vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
More informationMETACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY
METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationRecent advances in breast cancers
Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response
More informationEGFR: fundamenteel en klinisch
EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationNeoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
More informationPathology Report Patient Companion Guide
Pathology Report Patient Companion Guide Breast Cancer - Understanding Your Pathology Report Pathology Reports can be overwhelming. They contain scientific terms that are unfamiliar and might be a bit
More informationMaximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research
Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research Presented by: Thomas C. Tucker, PhD, MPH Associate Director for Cancer Control Markey Cancer Center University of
More informationmaintrac What's the future in precision diagnostics? From screening to stem cells and back!
maintrac What's the future in precision diagnostics? From screening to stem cells and back! Cancer is a frightening diagnosis: why? Malignant tumours are detectable when they have reached a size of about
More informationIdentifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They?
Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They? Dubovenko Alexey Discovery Product Manager Sonia Novikova Solution Scientist September 2018 2 Non-Small Cell Lung Cancer
More informationCan we prevent metastasis?
Can we prevent metastasis? A research example to translate from the bench to the bedside Diane Palmieri, Ph.D. Women s Cancers Section Laboratory of Molecular Pharmacology CCR, NCI Some Basic Truths Most
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationMaram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine
Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine The most common non-skin malignancy of women 2 nd most common cause of cancer deaths in women, following
More informationMolecular factors influencing epithelial-mesenchymal transition in breast cancer
Molecular factors influencing epithelial-mesenchymal transition in breast cancer Gisela Nilsson Department of Medical Biochemistry and Cell Biology Institute of Biomedicine Sahlgrenska Academy at University
More informationCCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask.
CCN1: A NOVEL TARGET FOR PANCREATIC CANCER Andrew Leask CIHR Group in Skeletal Development and Remodeling, Division of Oral Biology and Department of Physiology and Pharmacology, Schulich School of Medicine
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationRoles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma
EXPERIMENTAL AND THERAPEUTIC MEDICINE 6: 1489-1493, 2013 Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma JINQUAN CAI Department of Urology, Fuzhou
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationCirculating Tumor Cells in non- Metastatic Triple Negative Breast Cancer
Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer Carolyn Hall, Ph.D. Department of Surgical Oncology The University of Texas MD Anderson Cancer Center Triple Negative Breast Cancer
More informationMesenchymal stem cells mediate the clinical phenotype of inflammatory breast cancer in a preclinical model
Lacerda et al. Breast Cancer Research (2015) 17:42 DOI 10.1186/s13058-015-0549-4 RESEARCH ARTICLE Open Access Mesenchymal stem cells mediate the clinical phenotype of inflammatory breast cancer in a preclinical
More informationExosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study
GBCC 2017: ABS-0017 Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study Soo Jung Lee 1, Jeeyeon Lee 2, Jin Hyang Jung 2, Ho Yong Park 2, Chan Hyeong Lee 3, Pyong
More informationSYSTEMIC TREATMENT OF TRIPLE NEGATIVE BREAST CANCER
SYSTEMIC TREATMENT OF TRIPLE NEGATIVE BREAST CANCER Sunil Shrestha 1*, Ji Yuan Yang, Li Shuang and Deepika Dhakal Clinical School of Medicine, Yangtze University, Jingzhou, Hubei Province, PR. China Department
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationA holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI
A holistic approach to targeting breast cancer part II: Micronutrient synergy Presented by: Dr. Neha Shanker DRRI Overview of the previous webinar In the last presentation we talked about: Increase in
More informationTumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.
Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications
More informationnumber Done by Corrected by Doctor Maha Shomaf
number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:
More informationINTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for
INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for more deaths than both cervical and endometrial tumours.
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationBreast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment?
Breast Cancer Breast Cancer Excess Estrogen Exposure Nulliparity or late pregnancy + Early menarche + Late menopause + Cystic ovarian disease + External estrogens exposure + Breast Cancer Excess Estrogen
More informationRTWG - Carcinosarcoma. Max Parmar, Jane Bryce, Andreas Poveda, Amit Oza
RTWG - Carcinosarcoma Max Parmar, Jane Bryce, Andreas Poveda, Amit Oza Overview Background Questions urgent and timely investigations? Proposed Approach Regulatory Solutions Output Carcinosarcomas Background
More informationSupplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
More informationIMMUNOMEDICS, INC. Advanced Antibody-Based Therapeutics. Jefferies 2014 Global Healthcare Conference Cynthia L. Sullivan, President and CEO
IMMUNOMEDICS, INC. Advanced Antibody-Based Therapeutics Oncology Autoimmune Diseases Jefferies 2014 Global Healthcare Conference Cynthia L. Sullivan, President and CEO Forward-Looking Statements This presentation,
More informationClinico- Pathological Features And Out Come Of Triple Negative Breast Cancer
Clinico- Pathological Features And Out Come Of Triple Negative Breast Cancer Dr. HassanAli Al-Khirsani, MBChB, CABM, F.I.C.M.S AL-Sadder teaching hospital, oncology unit Dr. Nasser Ghaly Yousif, MBChB,G.P.
More informationContemporary Classification of Breast Cancer
Contemporary Classification of Breast Cancer Laura C. Collins, M.D. Vice Chair of Anatomic Pathology Professor of Pathology Beth Israel Deaconess Medical Center and Harvard Medical School Boston, MA Outline
More informationCorrelation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer
Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,
More informationAravive Corporate Presentation October 2018
Aravive Corporate Presentation October 2018 Important Information Forward-Looking Statements This presentation contains forward-looking statements that may discuss Aravive s plans, goals, intentions and
More informationShould the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer?
Should the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer? Sonja Kesselmans. S2242362. Bachelorscriptie. 20-06-2014 Supervisor: Marcel van
More informationChemoresistance: Detectors to Dormancy
Chemoresistance: Detectors to Dormancy Andy Redfern University of Western Australia Harry Perkins Institute of Medical Research Fiona Stanley Hospital Ongoing Projects: What to pack? The Route to Efficacy
More informationImpact of Prognostic Factors
Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,
More informationDOWNLOAD OR READ : UNDERSTANDING BREAST CANCER CELL BIOLOGY AND THERAPY A VISUAL APPROACH PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : UNDERSTANDING BREAST CANCER CELL BIOLOGY AND THERAPY A VISUAL APPROACH PDF EBOOK EPUB MOBI Page 1 Page 2 understanding breast cancer cell biology and therapy a visual approach understanding
More informationTargeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example
Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Dennis J Slamon, MD, PhD Professor of Medicine Chief, Division of Hematology/Oncology; Director of Clinical/Translational
More informationUNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationAfrican-American Triple Negative Breast Cancer: What it is, how it happens, how it spreads
African-American Triple Negative Breast Cancer: What it is, how it happens, how it spreads BRIANA LO PEZ, BS M A ST E R O F S C I E N C E I N B I O M E D I C A L S C I E N C ES C A N D I DAT E, C L A S
More informationThe PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction
The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have
More informationALM301: Allosteric Isoform selective Akt inhibitor
ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric
More informationDevelopment of Next-generation Therapeutic
2015 World Biologics Korea Development of Next-generation Therapeutic Antibodies for Treating Ovarian Cancer (Therapeutic Targeting of Tetraspanin8 in Epithelial Ovarian Cancer Invasion and Metastasis)
More informationResearch Article Stromal Expression of CD10 in Invasive Breast Carcinoma and Its Correlation with ER, PR, HER2-neu, and Ki67
SAGE-Hindawi Access to Research International Breast Cancer Volume 20, Article ID 47957, 4 pages doi:0.406/20/47957 Research Article Stromal Expression of CD0 in Invasive Breast Carcinoma and Its Correlation
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More information10/15/2012. Inflammatory Breast Cancer vs. LABC: Different Biology yet Subtypes Exist
Triple-Negative Breast Cancer: Optimizing Treatment for Locally Advanced Breast Cancer Beth Overmoyer MD Director, Inflammatory Breast Cancer Program Dana Farber Cancer Institute Overview Inflammatory
More informationTargeting the Notch Pathway: Killing Cancer Stem Cells
Targeting the Notch Pathway: Killing Cancer Stem Cells 1 Celeste Alverez Frontiers of Chemistry January 2, 2016 Outline 2 Background Cancer Stem Cells The Notch Pathway Targeting agents Drugs Antibodies
More informationValidation & Assay Performance Summary
Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation
More informationThe 2010 Gastrointestinal Cancers Symposium Oral Abstract Session: Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract
The 2010 Gastrointestinal Cancers Symposium : Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract Abstract #131: Phase I study of MK 0646 (dalotuzumab), a humanized monoclonal antibody against
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationreceive adjuvant chemotherapy
Women with high h risk early stage endometrial cancer should receive adjuvant chemotherapy Michael Friedlander The Prince of Wales Cancer Centre and Royal Hospital for Women The Prince of Wales Cancer
More informationOMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationCB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response
CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, CA Arginine Depletion by Arginase
More informationSU2C TOP SCIENCE ACCOMPLISHMENTS
SU2C TOP SCIENCE ACCOMPLISHMENTS INTRODUCTION Since our founding in 2008, Stand Up To Cancer has funded 87 team science projects, with budgets ranging from $250,000 for a short research project to over
More informationTargeting the ERBB family in cancer: couples therapy
OPINION Targeting the ERBB family in cancer: couples therapy Niall Tebbutt, Mikkel W. Pedersen and Terrance G. Johns Abstract The ERBB family of receptor tyrosine kinases has a central role in the tumorigenesis
More informationIVC History, Cancer Research
Riordan Clinic IVC Academy 5 IVC History, Cancer Research O (slides 41-80) Pharmacokinetics of Oral Vitamin C using Liposomal Form* To test whether plasma vitamin C levels, following oral doses in supplemented
More informationSupplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
More informationCarcinosarcoma Trial rial in s a in rare malign rare mali ancy
Carcinosarcoma Trials in a rare malignancy BACKGROUND Rare and highly aggressive epithelial malignancies Biphasic tumors with epithelial and mesenchymal components Uterine carcinomas (UCS) uncommon with
More informationIJC International Journal of Cancer
IJC International Journal of Cancer Short Report Exosomes derived from mesenchymal non-small cell lung cancer cells promote chemoresistance Richard J. Lobb 1,2, Rosa van Amerongen 1, Adrian Wiegmans 1,
More informationBreast cancer as a systemic disease: a view of metastasis
Review Click here for more articles from the symposium doi: 10.1111/joim.12084 Breast cancer as a systemic disease: a view of metastasis A. J. Redig 1 & S. S. McAllister 1,2,3 From the 1 Division of Hematology,
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationAnti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis
Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis V. Deshmukh 1, T. Seo 1, C. Swearingen 1, Y. Yazici 1 1 Samumed,
More informationRole of Primary Resection for Patients with Oligometastatic Disease
GBCC 2018, April 6, Songdo ConvensiA, Incheon, Korea Panel Discussion 4, How Can We Better Treat Patients with Metastatic Disease? Role of Primary Resection for Patients with Oligometastatic Disease Tadahiko
More informationANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich
ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationBiobehavioral Pathways in Epithelial Ovarian Cancer
Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa
More informationCANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
More informationCytoSelect Tumor Transendothelial Migration Assay
Product Manual CytoSelect Tumor Transendothelial Migration Assay Catalog Number CBA-216 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cancer metastasis comprises several
More informationYong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women
More informationCancer cells in vitro
Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More information