Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis

Size: px
Start display at page:

Download "Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis"

Transcription

1 Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative and promising entirely new targeted therapy for cancer. Mammalian neuraminidase-1 (Neu1) in complex with matrix metalloproteinase-9 and G-protein coupled receptor tethered to RTKs and TLRs is identified as a major target in the multi-stage of tumorigenesis. Preclinical studies support an entirely new cancer targeted therapy: unaffected by mutations of growth factor receptors, blocks tumor neovascularization, overcomes chemo-resistance of tumors, blocks immune-mediated tumorigenesis, blocks tissue invasion and metastasis.

2 Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Oseltamivir phosphate Published: TLR-4, -7 & -9 EGFR Trk insulin Therapeutic efficacy of oseltamivir phosphate alone or in combination with chemotherapeutics tumor growth and metastatic spread, tumour neovascularization and chemoresistance pancreatic, breast and ovarian cancers heterotopic xenograft of tumors growing in RAGxCγ double mutant mice

3 Cellular Signalling 25 (213) Highlights.. EGFR is fully glycosylated on 8 of the 11 Asn-X-Ser/Thr (X Pro) canonical N- glycosylation sites; two of the sites are not glycosylated, and one is partially glycosylated. The mechanism(s) behind epidermal growth factor (EGF)-induced receptors is unknown. The modification of glycosylation on EGF receptors involves the activation of Neu1. EGF binding receptor activates neuromedin B receptor (NMBR or BB1) GPCR Neu1 MMP-9 crosstalk tethered to EGFR at the ectodomain on the cell

4 EGF Fluorogenic sialidase specific substrate, 4-MUNANA 45 nm methylumbelliferone Gilmour, Abdulkhalek et al 213 Cellular Signalling 25: 2587 (open access)

5 Gilmour, Abdulkhalek etal. 213 Cellular Signalling 25 (213) (open access)

6 pegfr pstat1 Highlights Individual necropsied tumors were taken from untreated and 1 mg/kg OP treated cohorts. Freshly frozen tumors were thawed on ice, and lysed in lysis buffer containing proteinase and phosphatase inhibitors. Tamiflu treatment at 1 mg/kg (i.p.) attenuated pegfr, pstat1 and pnfκb activity in heterotopic xenografts of MiaPaCa-2-eGFP tumors growing in RAGxCγ double mutant mice. pnfκb Oseltamivir phosphate targets xenografts of MiaPaCa-2 tumors growing in RAGxCγ double mutant mice.

7 Biophotonic imaging of live necropsy tissues egfp-miapaca-2

8 egfp-miapaca-2 Gilmour, Abdulkhalek et al Cellular Signalling (open access)

9 Clinical problem... Resistance to drug therapy, along with high rates of metastasis, contributes to the low survival rate in patients diagnosed with pancreatic cancer.

10 Established chemo-resistant PANC1 against.1μm gemcitabine for over 1 yr

11 Established chemo-resistant PANC1 against 8μM Cisplatin for over 1 yr

12 Established chemo-resistant PANC1 against 8μM Cisplatin +.1μM Gem for over 1 yr

13 C o r r e c te d D e n s ity m e a n S.E. (n = 6 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) PANC1 untreated Tamiflu 24 hrs no 1 Ab E -c a d h e r r in N -c a d h e r in V E -c a d h e r in P < P = P < B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L

14 C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) PANC1 GemR.1μM untreated Tamiflu 24 hrs no 1 Ab E -c a d h e r in N -c a d h e r in V E -c a d h e r in 2 5 P = P < P =.7 B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L

15 PANC1 CisR 8μM C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) C o r r e c te d D e n s ity m e a n S.E. (n = 7 ) untreated Tamiflu 24 hrs no 1 Ab E -c a d h e r in N -c a d h e r in V E -c a d h e r in 1 5 n.s P = P =.9 B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L B k g u n tr e a te d T a m iflu 6 g /m L

16 Paraffinembedded tumor staining: Fluorescence microscopic analyses Findings indicate a reversal of EMT following treatment with oseltamivir phosphate, as demonstrated by expression of N- cadherin, VE-cadherin, and E-cadherin as characteristic markers of EMT, and an increase in the sensitivity of chemoresistant pancreatic cancer cells to drug therapy.

17 Highlights.. Triple-negative breast cancers (TNBCs) lack the estrogen, progesterone, and epidermal growth factor (EGF) receptor-2 (HER2/neu) receptors. Patients with TNBC have typical high grading, more frequent relapses, and exhibit poorer outcomes or prognosis compared with the other subtypes of breast cancers. Currently, there are no targeted therapies that are effective for TNBC.

18 T u m o u r W e ig h t / M o u s e w t (g ) untreated OP 3mg/kg OP 5mg/kg p < untreated OP 3mg/kg OP 5mg/kg U n tr e a te d c o n tr o l O P 3 m g /k g O P 5 m g /k g

19 L u n g W e ig h t/ M o u s e w t (g ) N u m b e r o f m e ta s ta tic c lu s te rs p e r lu n g L u n g m e ts 6 5 A B u n tr e a te d c o n tr o l O P 3 m g /k g O P 5 m g /k g C. 8 A v e r a g e L u n g W e ig h ts. 6 untreated OP 3mg/kg OP 5mg/kg A4 B2 C U n tr e a te d c o n tr o l O P 3 m g /k g O P 5 m g /k g

20 Highlights.. Snail, a transcriptional factor and repressor of E-cadherin is well known for its role in cellular invasion. It can regulate epithelial to mesenchymal transition (EMT) during embryonic development and in epithelial cells. Snail also mediates tumor progression and metastases. Silencing of Snail and its associate member Slug in human A278 ovarian epithelial carcinoma cell line was investigated to identify its role in tumor neovascularization.

21 T u m o r v o lu m e (m m 3 ) A B 2 5 A (n = 4 ) 2 A S L U G K D (n = 4 ) A S N A IL K D (n = 4 ) A4 B4 C4 D a y s P o s t O v a r ia n A Im p la n ta tio n

22 Novelty Abdulkhalek et al. Clinical and Translational Medicine 214, 3:28 SNAIL: a zinc finger transcriptional repressor SNAIL KD SLUG KD Snail genes act primarily as survival factors and inducers of cell movement? Signaling cascade Tumor vasculature secreted cytokines

23 Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis

24 Conclusions The role of mammalian neuraminidase-1 (Neu1) is identified as a major target in the multi-stage of tumorigenesis. An innovative and promising entirely new targeted therapy for cancer.

25

26 A C 1G needle B PLGA-empty PLGA-OP 2mg

27 T u m o r v o lu m e ( m m 3 ) T u m o u r W e ig h t/ M o u s e (g ) 1 6 U n tre a te d 1 2 P L G A e m p ty P L G A -O P 2 m g. 6 8 P L G A s u r g ic a l im p la n t U p < D a y s P o s t P a n c -1 Im p la n ta tio n U n tr e a te d c o n tr o l P L G A e m p ty P L G A -O P 2 m g p <

28 r e l a t i v e t o t a l s t a i n i n g d e n s i t y A C B D p <. 6 8 p < H o s t C D 3 1 T u m o r E - c a d h e r i n T u m o r N - c a d h e r i n 2 A b c t r l 1 5 p <. 8 1 p < n. s. p < Blank PLGA U n t r e a t e d P L G A P L G A - O P U n t r e a t e d P L G A P L G A - O P U n t r e a t e d P L G A P L G A - O P PLGA 2mg OP U n t r e a t e d P L G A P L G A - O P

29 N u m b e r m e ta s ta tic c lu s te rs p e r lu n g N u m b e r m e ta s ta tic c lu s te rs p e r liv e r A U n tr e a te d c o n tr o l P L G A P L G A -O P 2 m g /k g B U n tr e a te d c o n tr o l P L G A P L G A -O P 2 m g

Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations

Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen

More information

Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma

Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Abdulkhalek et al. Clinical and Translational Medicine 2014, 3:28 RESEARCH Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma

More information

Cancer Biology Course. Invasion and Metastasis

Cancer Biology Course. Invasion and Metastasis Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta

More information

Cell Polarity and Cancer

Cell Polarity and Cancer Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium. Rosita Winkler Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

More information

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5

More information

Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer.

Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer. National Cancer Institute Slovakia Translational Research Unit Slovakia Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer. Mego M 1, 2, Karaba M 2, Cierna Z 1, Janega P 1, Minarik

More information

OUTLINE PAST PRESENTFUTURE BREAST CANCER INCIDENCE AND MORTALITY CURRENT STATE OF MEDICAL ONCOLOGY SECOND ANNUAL BREAST CANCER SYMPOSIUM

OUTLINE PAST PRESENTFUTURE BREAST CANCER INCIDENCE AND MORTALITY CURRENT STATE OF MEDICAL ONCOLOGY SECOND ANNUAL BREAST CANCER SYMPOSIUM OUTLINE CURRENT STATE OF MEDICAL ONCOLOGY SECOND ANNUAL BREAST CANCER SYMPOSIUM October 11, 2014 SARA M GARRIDO, M.D., F.A.C.P Chief Medical Officer at AMS Miami, October 11, 2014 PAST PRESENTFUTURE -BRIEF

More information

Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated

Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated apoptosis and inhibition of epithelial-to-mesenchymal transition Ramadevi Subramani a, Ph.D., Elizabeth Gonzalez b, MS.,

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Tumour Markers. For these reasons, only a handful of tumour markers are commonly used by most doctors.

Tumour Markers. For these reasons, only a handful of tumour markers are commonly used by most doctors. Tumour Markers What are Tumour Markers? Tumour markers are substances that can be found in the body when cancer is present. They are usually found in the blood or urine. They can be products of cancer

More information

Evaluation the Correlation between Ki67 and 5 Years Disease Free Survival of Breast Cancer Patients

Evaluation the Correlation between Ki67 and 5 Years Disease Free Survival of Breast Cancer Patients BIOSCIENCES BIOTECHNOLOGY RESEARCH ASIA, December 2015. Vol. 12(3), 2221-2225 Evaluation the Correlation between Ki67 and 5 Years Disease Free Survival of Breast Cancer Patients S.M. Hosseini¹, H. Shahbaziyan

More information

Cancer Prevention and Research Institute of Texas. November 2017

Cancer Prevention and Research Institute of Texas. November 2017 Cancer Prevention and Research Institute of Texas November 2017 Best In Class Significant Upside Strong Non-Dilutive Funding Focused on Epigenetics The way cancer cells regulate gene expression Lead drug,

More information

Yanrong Su *, Nathan R. Hopfinger, Theresa D. Nguyen, Thomas J. Pogash, Julia Santucci-Pereira and Jose Russo *

Yanrong Su *, Nathan R. Hopfinger, Theresa D. Nguyen, Thomas J. Pogash, Julia Santucci-Pereira and Jose Russo * Su et al. Journal of Experimental & Clinical Cancer Research (2018) 37:314 https://doi.org/10.1186/s13046-018-0988-8 RESEARCH Open Access Epigenetic reprogramming of epithelial mesenchymal transition in

More information

Francesco Parlati, Ph.D.

Francesco Parlati, Ph.D. Novel Pharmacodynamic Assays to Measure Glutaminase Inhibition Following Oral Administration of CB-839 Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, California Disclosure Information

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

METACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY

METACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Recent advances in breast cancers

Recent advances in breast cancers Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response

More information

EGFR: fundamenteel en klinisch

EGFR: fundamenteel en klinisch EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Pathology Report Patient Companion Guide

Pathology Report Patient Companion Guide Pathology Report Patient Companion Guide Breast Cancer - Understanding Your Pathology Report Pathology Reports can be overwhelming. They contain scientific terms that are unfamiliar and might be a bit

More information

Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research

Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research Presented by: Thomas C. Tucker, PhD, MPH Associate Director for Cancer Control Markey Cancer Center University of

More information

maintrac What's the future in precision diagnostics? From screening to stem cells and back!

maintrac What's the future in precision diagnostics? From screening to stem cells and back! maintrac What's the future in precision diagnostics? From screening to stem cells and back! Cancer is a frightening diagnosis: why? Malignant tumours are detectable when they have reached a size of about

More information

Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They?

Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They? Identifying Novel Targets for Non-Small Cell Lung Cancer Just How Novel Are They? Dubovenko Alexey Discovery Product Manager Sonia Novikova Solution Scientist September 2018 2 Non-Small Cell Lung Cancer

More information

Can we prevent metastasis?

Can we prevent metastasis? Can we prevent metastasis? A research example to translate from the bench to the bedside Diane Palmieri, Ph.D. Women s Cancers Section Laboratory of Molecular Pharmacology CCR, NCI Some Basic Truths Most

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine

Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine The most common non-skin malignancy of women 2 nd most common cause of cancer deaths in women, following

More information

Molecular factors influencing epithelial-mesenchymal transition in breast cancer

Molecular factors influencing epithelial-mesenchymal transition in breast cancer Molecular factors influencing epithelial-mesenchymal transition in breast cancer Gisela Nilsson Department of Medical Biochemistry and Cell Biology Institute of Biomedicine Sahlgrenska Academy at University

More information

CCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask.

CCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask. CCN1: A NOVEL TARGET FOR PANCREATIC CANCER Andrew Leask CIHR Group in Skeletal Development and Remodeling, Division of Oral Biology and Department of Physiology and Pharmacology, Schulich School of Medicine

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma

Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma EXPERIMENTAL AND THERAPEUTIC MEDICINE 6: 1489-1493, 2013 Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma JINQUAN CAI Department of Urology, Fuzhou

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer

Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer Circulating Tumor Cells in non- Metastatic Triple Negative Breast Cancer Carolyn Hall, Ph.D. Department of Surgical Oncology The University of Texas MD Anderson Cancer Center Triple Negative Breast Cancer

More information

Mesenchymal stem cells mediate the clinical phenotype of inflammatory breast cancer in a preclinical model

Mesenchymal stem cells mediate the clinical phenotype of inflammatory breast cancer in a preclinical model Lacerda et al. Breast Cancer Research (2015) 17:42 DOI 10.1186/s13058-015-0549-4 RESEARCH ARTICLE Open Access Mesenchymal stem cells mediate the clinical phenotype of inflammatory breast cancer in a preclinical

More information

Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study

Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study GBCC 2017: ABS-0017 Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study Soo Jung Lee 1, Jeeyeon Lee 2, Jin Hyang Jung 2, Ho Yong Park 2, Chan Hyeong Lee 3, Pyong

More information

SYSTEMIC TREATMENT OF TRIPLE NEGATIVE BREAST CANCER

SYSTEMIC TREATMENT OF TRIPLE NEGATIVE BREAST CANCER SYSTEMIC TREATMENT OF TRIPLE NEGATIVE BREAST CANCER Sunil Shrestha 1*, Ji Yuan Yang, Li Shuang and Deepika Dhakal Clinical School of Medicine, Yangtze University, Jingzhou, Hubei Province, PR. China Department

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

A holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI

A holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI A holistic approach to targeting breast cancer part II: Micronutrient synergy Presented by: Dr. Neha Shanker DRRI Overview of the previous webinar In the last presentation we talked about: Increase in

More information

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D. Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications

More information

number Done by Corrected by Doctor Maha Shomaf

number Done by Corrected by Doctor Maha Shomaf number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:

More information

INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for

INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for more deaths than both cervical and endometrial tumours.

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Breast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment?

Breast Cancer. Excess Estrogen Exposure. Alcohol use + Pytoestrogens? Abortion. Infertility treatment? Breast Cancer Breast Cancer Excess Estrogen Exposure Nulliparity or late pregnancy + Early menarche + Late menopause + Cystic ovarian disease + External estrogens exposure + Breast Cancer Excess Estrogen

More information

RTWG - Carcinosarcoma. Max Parmar, Jane Bryce, Andreas Poveda, Amit Oza

RTWG - Carcinosarcoma. Max Parmar, Jane Bryce, Andreas Poveda, Amit Oza RTWG - Carcinosarcoma Max Parmar, Jane Bryce, Andreas Poveda, Amit Oza Overview Background Questions urgent and timely investigations? Proposed Approach Regulatory Solutions Output Carcinosarcomas Background

More information

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

More information

IMMUNOMEDICS, INC. Advanced Antibody-Based Therapeutics. Jefferies 2014 Global Healthcare Conference Cynthia L. Sullivan, President and CEO

IMMUNOMEDICS, INC. Advanced Antibody-Based Therapeutics. Jefferies 2014 Global Healthcare Conference Cynthia L. Sullivan, President and CEO IMMUNOMEDICS, INC. Advanced Antibody-Based Therapeutics Oncology Autoimmune Diseases Jefferies 2014 Global Healthcare Conference Cynthia L. Sullivan, President and CEO Forward-Looking Statements This presentation,

More information

Clinico- Pathological Features And Out Come Of Triple Negative Breast Cancer

Clinico- Pathological Features And Out Come Of Triple Negative Breast Cancer Clinico- Pathological Features And Out Come Of Triple Negative Breast Cancer Dr. HassanAli Al-Khirsani, MBChB, CABM, F.I.C.M.S AL-Sadder teaching hospital, oncology unit Dr. Nasser Ghaly Yousif, MBChB,G.P.

More information

Contemporary Classification of Breast Cancer

Contemporary Classification of Breast Cancer Contemporary Classification of Breast Cancer Laura C. Collins, M.D. Vice Chair of Anatomic Pathology Professor of Pathology Beth Israel Deaconess Medical Center and Harvard Medical School Boston, MA Outline

More information

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,

More information

Aravive Corporate Presentation October 2018

Aravive Corporate Presentation October 2018 Aravive Corporate Presentation October 2018 Important Information Forward-Looking Statements This presentation contains forward-looking statements that may discuss Aravive s plans, goals, intentions and

More information

Should the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer?

Should the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer? Should the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer? Sonja Kesselmans. S2242362. Bachelorscriptie. 20-06-2014 Supervisor: Marcel van

More information

Chemoresistance: Detectors to Dormancy

Chemoresistance: Detectors to Dormancy Chemoresistance: Detectors to Dormancy Andy Redfern University of Western Australia Harry Perkins Institute of Medical Research Fiona Stanley Hospital Ongoing Projects: What to pack? The Route to Efficacy

More information

Impact of Prognostic Factors

Impact of Prognostic Factors Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,

More information

DOWNLOAD OR READ : UNDERSTANDING BREAST CANCER CELL BIOLOGY AND THERAPY A VISUAL APPROACH PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : UNDERSTANDING BREAST CANCER CELL BIOLOGY AND THERAPY A VISUAL APPROACH PDF EBOOK EPUB MOBI DOWNLOAD OR READ : UNDERSTANDING BREAST CANCER CELL BIOLOGY AND THERAPY A VISUAL APPROACH PDF EBOOK EPUB MOBI Page 1 Page 2 understanding breast cancer cell biology and therapy a visual approach understanding

More information

Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example

Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Dennis J Slamon, MD, PhD Professor of Medicine Chief, Division of Hematology/Oncology; Director of Clinical/Translational

More information

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

African-American Triple Negative Breast Cancer: What it is, how it happens, how it spreads

African-American Triple Negative Breast Cancer: What it is, how it happens, how it spreads African-American Triple Negative Breast Cancer: What it is, how it happens, how it spreads BRIANA LO PEZ, BS M A ST E R O F S C I E N C E I N B I O M E D I C A L S C I E N C ES C A N D I DAT E, C L A S

More information

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction

The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have

More information

ALM301: Allosteric Isoform selective Akt inhibitor

ALM301: Allosteric Isoform selective Akt inhibitor ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric

More information

Development of Next-generation Therapeutic

Development of Next-generation Therapeutic 2015 World Biologics Korea Development of Next-generation Therapeutic Antibodies for Treating Ovarian Cancer (Therapeutic Targeting of Tetraspanin8 in Epithelial Ovarian Cancer Invasion and Metastasis)

More information

Research Article Stromal Expression of CD10 in Invasive Breast Carcinoma and Its Correlation with ER, PR, HER2-neu, and Ki67

Research Article Stromal Expression of CD10 in Invasive Breast Carcinoma and Its Correlation with ER, PR, HER2-neu, and Ki67 SAGE-Hindawi Access to Research International Breast Cancer Volume 20, Article ID 47957, 4 pages doi:0.406/20/47957 Research Article Stromal Expression of CD0 in Invasive Breast Carcinoma and Its Correlation

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

10/15/2012. Inflammatory Breast Cancer vs. LABC: Different Biology yet Subtypes Exist

10/15/2012. Inflammatory Breast Cancer vs. LABC: Different Biology yet Subtypes Exist Triple-Negative Breast Cancer: Optimizing Treatment for Locally Advanced Breast Cancer Beth Overmoyer MD Director, Inflammatory Breast Cancer Program Dana Farber Cancer Institute Overview Inflammatory

More information

Targeting the Notch Pathway: Killing Cancer Stem Cells

Targeting the Notch Pathway: Killing Cancer Stem Cells Targeting the Notch Pathway: Killing Cancer Stem Cells 1 Celeste Alverez Frontiers of Chemistry January 2, 2016 Outline 2 Background Cancer Stem Cells The Notch Pathway Targeting agents Drugs Antibodies

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

The 2010 Gastrointestinal Cancers Symposium Oral Abstract Session: Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract

The 2010 Gastrointestinal Cancers Symposium Oral Abstract Session: Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract The 2010 Gastrointestinal Cancers Symposium : Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract Abstract #131: Phase I study of MK 0646 (dalotuzumab), a humanized monoclonal antibody against

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro

More information

receive adjuvant chemotherapy

receive adjuvant chemotherapy Women with high h risk early stage endometrial cancer should receive adjuvant chemotherapy Michael Friedlander The Prince of Wales Cancer Centre and Royal Hospital for Women The Prince of Wales Cancer

More information

OMICS Journals are welcoming Submissions

OMICS Journals are welcoming Submissions OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response

CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response Francesco Parlati, Ph.D. Calithera Biosciences South San Francisco, CA Arginine Depletion by Arginase

More information

SU2C TOP SCIENCE ACCOMPLISHMENTS

SU2C TOP SCIENCE ACCOMPLISHMENTS SU2C TOP SCIENCE ACCOMPLISHMENTS INTRODUCTION Since our founding in 2008, Stand Up To Cancer has funded 87 team science projects, with budgets ranging from $250,000 for a short research project to over

More information

Targeting the ERBB family in cancer: couples therapy

Targeting the ERBB family in cancer: couples therapy OPINION Targeting the ERBB family in cancer: couples therapy Niall Tebbutt, Mikkel W. Pedersen and Terrance G. Johns Abstract The ERBB family of receptor tyrosine kinases has a central role in the tumorigenesis

More information

IVC History, Cancer Research

IVC History, Cancer Research Riordan Clinic IVC Academy 5 IVC History, Cancer Research O (slides 41-80) Pharmacokinetics of Oral Vitamin C using Liposomal Form* To test whether plasma vitamin C levels, following oral doses in supplemented

More information

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung

More information

Carcinosarcoma Trial rial in s a in rare malign rare mali ancy

Carcinosarcoma Trial rial in s a in rare malign rare mali ancy Carcinosarcoma Trials in a rare malignancy BACKGROUND Rare and highly aggressive epithelial malignancies Biphasic tumors with epithelial and mesenchymal components Uterine carcinomas (UCS) uncommon with

More information

IJC International Journal of Cancer

IJC International Journal of Cancer IJC International Journal of Cancer Short Report Exosomes derived from mesenchymal non-small cell lung cancer cells promote chemoresistance Richard J. Lobb 1,2, Rosa van Amerongen 1, Adrian Wiegmans 1,

More information

Breast cancer as a systemic disease: a view of metastasis

Breast cancer as a systemic disease: a view of metastasis Review Click here for more articles from the symposium doi: 10.1111/joim.12084 Breast cancer as a systemic disease: a view of metastasis A. J. Redig 1 & S. S. McAllister 1,2,3 From the 1 Division of Hematology,

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis

Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis Anti-inflammatory properties of SM04690, a small molecule inhibitor of the Wnt pathway as a potential treatment for knee osteoarthritis V. Deshmukh 1, T. Seo 1, C. Swearingen 1, Y. Yazici 1 1 Samumed,

More information

Role of Primary Resection for Patients with Oligometastatic Disease

Role of Primary Resection for Patients with Oligometastatic Disease GBCC 2018, April 6, Songdo ConvensiA, Incheon, Korea Panel Discussion 4, How Can We Better Treat Patients with Metastatic Disease? Role of Primary Resection for Patients with Oligometastatic Disease Tadahiko

More information

ANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich

ANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Biobehavioral Pathways in Epithelial Ovarian Cancer

Biobehavioral Pathways in Epithelial Ovarian Cancer Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa

More information

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

More information

CytoSelect Tumor Transendothelial Migration Assay

CytoSelect Tumor Transendothelial Migration Assay Product Manual CytoSelect Tumor Transendothelial Migration Assay Catalog Number CBA-216 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cancer metastasis comprises several

More information

Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science

Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women

More information

Cancer cells in vitro

Cancer cells in vitro Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information