Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations

Size: px
Start display at page:

Download "Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations"

Transcription

1 Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen 1, Fiona Haxho 1, Farah Alghamdi 1, Stephanie Allison 2, Duncan Simmons 1, Leah O Shea 1, Ronald J Neufeld 2, and Myron R Szewczuk 1*. Depts of 1 Biomedical and Molecular Sciences, and 2 Chemical Engineering, Queen s University, Kingston, ON K7L 3N6, Canada. *speaker

2 Cancer therapeutics in the clinical setting Need for alternate therapeutics Target multiple cancer pathways Circumvent the genetic mutations

3 OP: Oseltamivir phosphate Published: TLR-4, -7 & -9 EGFR Trk insulin Identified a new anticancer therapeutic approach: Oseltamivir phosphate (OP) monotherapy or in combination with chemotherapeutics against human ovarian cancer regulates tumour neovascularization, growth and invasiveness.

4 Neu1 sialidase activity is associated with epidermal growth factor (EGF) stimulation of ovarian carcinoma cells Mean fluorescence Control EGF 30ng/ml OP 164µ g/ml + EGF Anti-Neu1 100µ g/ml + EGF MMP9i 50 µ g/ml + EGF Mean fluorescence Control EGF 33ng/ml OP 333µ g/m L + EG F Control EGF 33ng/ml OP 333µ g/ml + EGF

5 Oseltamivir phosphate (OP) decreases the cell viability of, cis, -shrna Slug and -shrna Snail cells cis Stable shrna Slug KD Stable shrna Snail KD LD 50 = 7 μm at 48 hr LD 50 = 4 μm at 48 hr LD 50 > 488 μm at 48hr LD 50 > 488 μm at 48 hr C ell V iab ility (% of Control)+ SEM Cell Viability (% of Control)+ SEM Cell Viability (% of Control) ± SEM Cell Viability (% of Control) ± S.E. OP LD 50 of 7μM for OP LD 50 of 4μM for cisplatin-resistant cis OP LD 50 of 488μM for shrna Slug and Snail KD

6 Cell viability of cells treated with different dosages of OP in combination with 1μM of cisplatin, 5-FU, gemcitabine and paclitaxel Cisplatin 5-FU Gemcitabine Paclitaxel C ell Viability (% of C ontrol) ± S.E. Cell Viability (% of Control) ± S.E. C ell Viability (% of C ontrol) ± S.E. C ell Viability (% of C ontrol) ± S.E. untreated control C isplatin 1 µ M OP 300 µ g/ml + Cis 1µ M OP 600 µ g/m L + C is 1µ M OP 800 µ g/ml + Cis 1µ M untreated control 5-FU 1 µ M OP 300µ g/ml+ 5-FU 1µ M OP 600µ g/ml + 5-FU 1µ M OP 800µ g/m L + 5-FU 1µ M untreated control Gem 1µ M OP 600 µ g/ml + Gem 1µ M OP 300 µ g/ml + Gem 1µ M OP 800 µ g/m L + G em 1µ M untreated control Paclitaxel 1µ M OP 300µ g/ml + Pac 1µ M OP 600µ g/ml + Pac 1µ M OP 800µ g/m L + P ac 1 µ M Beneficial effect using combination therapy of OP and standard clinical chemotherapeutics on amplifying chemo-drug sensitivity. Hypersensitivity reactions to oxaliplatin, gemcitabine are noted complications in cancer patients.

7 human ovarian cancer cell line implanted cutaneously in RAGxCγ double mutant mice A Untreated Control 30mg/kg OP 50mg/kg OP B Tumor volume (mm 3 ) Tumor volume (mm 3 ) Tumor volume (mm 3 ) Control TV

8 H&E staining of microtome 5µm sections of paraffin-embedded necropsy lungs taken from tumor-bearing RAGxCy double mutant mice Lungs Untreated OP 50mg/kg OP 30mg/kg B Number m etastatic clusters per lung untreated O P 30 mg/kg OP 50 mg/kg

9 OVARIAN CANCER human ovarian cancer cell line in RAGxCy double mutant mice Ovarian Ovarian SLUG KD Ovarian SNAIL KD SLUG: represses E-cadherin expression and induces epithelial to mesenchymal transitions SNAIL: repressor of E-cadherin gene expression in epithelial tumour cells

10 H&E staining of microtome 5µm sections of paraffin-embedded necropsy lungs taken from tumor-bearing RAGxCy double mutant mice Necropsy Lungs Untreated Slug shrna Snail shrna B Number m etastatic clusters per lung Slug KD SNAIL KD

11 Necropsy tumors Untreated Slug Snail Untreated A4 mouse SLUG KD B2 mouse SNAIL KD C2 mouse D E-cadherin Untreated N-cadherin A Tumor B Tumor H&E E C Bkg E-cad N-cad relative total staining density VE-cad SLUG KD SNAIL KD

12 Snail-MMP-9 signaling axis potentiates Neu1 sialidase and MMP-9 cross-talk in regulating RTK receptors, tumor neovascularization, growth and invasiveness Abdulkhalek et al 2014 Clinical and Translational Medicine 3:28 (open access) MMP9 Snail Signaling cascade Slug Tumor vasculature

13

14 A B Tumor volume (mm 3 ) A4 B4 C4 Confidential unpublished data

15 OVARIAN CANCER human ovarian cancer cell line was established from tumour tissue from an untreated patient Control EGF 30ng/ml Tamiflu 400 μm + EGF Anti-Neu1 100 μg/ml + EGF MMP9i 50 μg/ml + EGF Phase Sialidase activity Snail shrna Sialidase activity Confidential unpublished data

16 A B C C ell V iability (% of C ontrol) + S.E. LD 50 = 50 μm C ell V iability (% of C ontrol) + S.E. cis LD 50 = 8 μm C ell Viability (% of C ontrol) ± S E M (n=6) untreated control C isplatin 1µ M Tam iflu 0.73m M + C isplatin 1 µ M Tamiflu 1.46mM + Cisplatin 1 µ M Tamiflu 1.95mM + Cisplatin 1 µ M Tamiflu 0.73mM Tam iflu 1.46m M Confidential unpublished data

17 A Tumor volume (mm 3 ) B Confidential unpublished data

18 A Untreated 50mg/kg OP 30mg/kg OP Number m etastatic clusters per liver untreated Tamiflu 30 mg/kg Tamiflu 50 mg/kg B Number m etastatic clusters per lung untreated Tamiflu 30 m g/kg Tamiflu 50 mg/kg Confidential unpublished data

19 A Number m etastatic clusters per lung Number m etastatic clusters per liver B Slug KD SNAIL KD Slug KD SNAIL KD Confidential unpublished data

20 Untreated A4 mouse SLUG KD B2 mouse SNAIL KD C2 mouse A Tumor D B C Tumor H&E Bkg E-cad relative total staining density N-cad VE-cad SLUG KD SNAIL KD

21 Novelty Abdulkhalek et al 2013 Research and Reports in Biochemistry 3: SNAIL: a zinc finger transcriptional repressor SLUG KD SNAIL KD Snail genes act primarily as survival factors and inducers of cell movement? Signaling cascade Tumor vasculature secreted cytokines

22 Conclusions Tamiflu provides an unexpected therapeutic benefit in cancer, by interfering with growth factor receptor-induced survival signals and disabling cancer cell survival in acquire chemoresistance. Tamiflu alone or in combination with chemotherapeutics against pancreatic and breast impedes the growth and metastatic spread, tumor neovascularization and chemoresistance in heterotopic xenograft of tumors growing in RAGxCγ double mutant mice.

23 Priority #1: Clinical trials Priority #2: To study the broad range efficacy of Tamiflu therapy in combination with standard chemotherapeutics. Priority #3: To test this novel therapy on surgically obtained patient primary tumors in culture

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis

Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative

More information

Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma

Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Abdulkhalek et al. Clinical and Translational Medicine 2014, 3:28 RESEARCH Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Cancer Biology Course. Invasion and Metastasis

Cancer Biology Course. Invasion and Metastasis Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example

Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Dennis J Slamon, MD, PhD Professor of Medicine Chief, Division of Hematology/Oncology; Director of Clinical/Translational

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium. Rosita Winkler Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

Understanding patent claims (f) Drug for the treatment of cancer

Understanding patent claims (f) Drug for the treatment of cancer Understanding patent claims (f) Drug for the treatment of cancer Treatment of cancer Explanation of terms Heat shock protein 90 (HSP 90) Belongs to a class of proteins that protect cells when stressed

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

EGFR: fundamenteel en klinisch

EGFR: fundamenteel en klinisch EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation

More information

Cell Polarity and Cancer

Cell Polarity and Cancer Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

More information

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus

More information

LAG-3: Validation Of Next Generation Checkpoint Pathways

LAG-3: Validation Of Next Generation Checkpoint Pathways LAG-3: Validation Of Next Generation Checkpoint Pathways Frédéric Triebel, CO/CMO Immune Checkpoint Modulation & Combination Therapies April 13, 2016 London, UK. 1 AX:PRR; NADAQ:PBMD Notice: Forward Looking

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Catechin s anti-angiogenic effects in epithelial ovarian cancer

Catechin s anti-angiogenic effects in epithelial ovarian cancer Catechin s anti-angiogenic effects in epithelial ovarian cancer Brian Krug Background Epithelial ovarian cancer (EOC) is a common and lethal malignancy of the female reproductive tract (2). Often detected

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

METACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY

METACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF- 02341066 Assay IC 50 nm Selectivity Ratio d Biochemical Activity In Vitro c-met/hgfr enzyme (Ki, nm) a 4 NA Cellular Activity

More information

Biomarkers in oncology drug development

Biomarkers in oncology drug development Biomarkers in oncology drug development Andrew Stone Stone Biostatistics Ltd EFSPI Biomarkers and Subgroups June 2016 E: andrew@stonebiostatistics.com T: +44 (0) 7919 211836 W: stonebiostatistics.com available

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

OMICS Journals are welcoming Submissions

OMICS Journals are welcoming Submissions OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible

More information

Primary Mucinous Ovarian Cancer (PMOC) Michael Frumovitz

Primary Mucinous Ovarian Cancer (PMOC) Michael Frumovitz Primary Mucinous Ovarian Cancer (PMOC) Michael Frumovitz Epithelial Subtypes Serous Endometrioid Mucinous Transitional Clear Cell Mixed Undifferentiated Squamous Ovarian Surface Epithelium Naora et al.,

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

A holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI

A holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI A holistic approach to targeting breast cancer part II: Micronutrient synergy Presented by: Dr. Neha Shanker DRRI Overview of the previous webinar In the last presentation we talked about: Increase in

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal

CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal transition and breast cancer progression Rhonda L. Brown,, Jing Yang, Chonghui Cheng J Clin Invest. 2011;121(3):1064-1074.

More information

Cetuximab with Chemotherapy as Treatment for Stage III Colon or Metastatic Colorectal Cancer

Cetuximab with Chemotherapy as Treatment for Stage III Colon or Metastatic Colorectal Cancer Cetuximab with Chemotherapy as Treatment for Stage III Colon or Metastatic Colorectal Cancer Cetuximab with Chemotherapy (CT) as First-Line Treatment for Metastatic Colorectal Cancer (mcrc): Analysis of

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 16 December 2009

The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 16 December 2009 The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION 16 December 2009 REMOVAB 10 microgram concentrate for infusion solution Carton containing 1 pre-filled syringe (CIP:

More information

Title Cancer Drug Phase Status

Title Cancer Drug Phase Status Clinical Trial Identifier Title Cancer Drug Phase Status NCT01164995 Study With Wee-1 Inhibitor MK-1775 and Carboplatin to Treat p53 Mutated Refractory and Resistant Ovarian Cancer Epithelial Ovarian Cancer

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

European consortium study on the availability of anti-neoplastic medicines

European consortium study on the availability of anti-neoplastic medicines European consortium study on the availability of anti-neoplastic medicines Nathan I Cherny Alexandru ENIU, MD, PhD Norman Levan Chair in Humanistic Chair, Emerging Countries Committee Medicine Department

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Table S1. Reclassification of 5-year risk of all-cause mortality among colorectal cancer patients by continuous E-cadherin (n=188)

Table S1. Reclassification of 5-year risk of all-cause mortality among colorectal cancer patients by continuous E-cadherin (n=188) Diagnostic Accuracy and Prediction Increment of Markers of Epithelial-Mesenchymal Transition to Assess Cancer Cell Detachment from Primary Tumors BMC Cancer Evan L. Busch, Prabhani Kuruppumullage Don,

More information

Pancreatic Adenocarcinoma: What`s hot

Pancreatic Adenocarcinoma: What`s hot Pancreatic Adenocarcinoma: What`s hot Eva Karamitopoulou-Diamantis Institute of Pathology University of Bern 11.09.2018, 30th ECP, Bilbao Pancreatic Cancer and the Microbiome The Pancreatic Cancer Microbiome

More information

Chemoresistance: Detectors to Dormancy

Chemoresistance: Detectors to Dormancy Chemoresistance: Detectors to Dormancy Andy Redfern University of Western Australia Harry Perkins Institute of Medical Research Fiona Stanley Hospital Ongoing Projects: What to pack? The Route to Efficacy

More information

Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research

Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research Presented by: Thomas C. Tucker, PhD, MPH Associate Director for Cancer Control Markey Cancer Center University of

More information

Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition

Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells

More information

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one

More information

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs

Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Indian Patent Application No. 1623/DEL/2014 Inventors: Prof. Kulbhushan Tikoo and Jasmine Kaur Department of Pharmacology

More information

Appendix Figure S1 A B C D E F G H

Appendix Figure S1 A B C D E F G H ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with

More information

this mutation. However, VEM was not effective. The PDOX model thus helped identify

this mutation. However, VEM was not effective. The PDOX model thus helped identify /, Vol. 7, No. 44 Vemurafenib-resistant BRAF-V600E-mutated melanoma is regressed by MEK-targeting drug trametinib, but not cobimetinib in a patient-derived orthotopic xenograft (PDOX) mouse model Kei Kawaguchi

More information

IVC History, Cancer Research

IVC History, Cancer Research Riordan Clinic IVC Academy 5 IVC History, Cancer Research O (slides 41-80) Pharmacokinetics of Oral Vitamin C using Liposomal Form* To test whether plasma vitamin C levels, following oral doses in supplemented

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Pancreas Quizzes c. Both A and B a. Directly into the blood stream (not using ducts)

Pancreas Quizzes c. Both A and B a. Directly into the blood stream (not using ducts) Pancreas Quizzes Quiz 1 1. The pancreas produces hormones. Which type of hormone producing organ is the pancreas? a. Endocrine b. Exocrine c. Both A and B d. Neither A or B 2. Endocrine indicates hormones

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013 Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40

More information

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,

More information

Trevigen s Extracellular Matrix Proteins for Triculture of Breast Cancer Spheroids, Endothelial Tubules, and Human Mesenchymal Stem Cells

Trevigen s Extracellular Matrix Proteins for Triculture of Breast Cancer Spheroids, Endothelial Tubules, and Human Mesenchymal Stem Cells Trevigen s Extracellular Matrix Proteins for Triculture of Breast Cancer Spheroids, Endothelial Tubules, and Human Mesenchymal Stem Cells Gabriel Benton, Ph.D. and Jay George, Ph.D., Trevigen, Inc. Gaithersburg,

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata

More information

London Cancer New Drugs Group. February London Cancer New Drugs Group (LCNDG) Work Plan for the London Cancer Drugs Fund list.

London Cancer New Drugs Group. February London Cancer New Drugs Group (LCNDG) Work Plan for the London Cancer Drugs Fund list. February 2013 London Cancer New s Group (LCNDG) Work Plan for the London Cancer s Fund London Cancer s Fund List This Cancer s Fund (CDF) list of medicines and s is in two parts. 1. The standard list of

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

Supplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance

Supplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance Cancer Cell, Volume 25 Supplemental Information Angiocrine Factors Deployed by Tumor Vascular Niche Induce B Cell Lymphoma Invasiveness and Chemoresistance Zhongwei Cao, Bi-Sen Ding, Peipei Guo, Sharrell

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

For personal use only

For personal use only ASX and Media release 6 April 211 Circadian s Inhibits Tumour Growth in Models of Lung, Ovarian and Prostate Cancer Data demonstrates efficacy of with other therapeutic agents in mouse models of lung,

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Biobehavioral Pathways in Epithelial Ovarian Cancer

Biobehavioral Pathways in Epithelial Ovarian Cancer Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa

More information

Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated

Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated apoptosis and inhibition of epithelial-to-mesenchymal transition Ramadevi Subramani a, Ph.D., Elizabeth Gonzalez b, MS.,

More information

The 2010 Gastrointestinal Cancers Symposium Oral Abstract Session: Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract

The 2010 Gastrointestinal Cancers Symposium Oral Abstract Session: Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract The 2010 Gastrointestinal Cancers Symposium : Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract Abstract #131: Phase I study of MK 0646 (dalotuzumab), a humanized monoclonal antibody against

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

RAB2A controls MT1-MMP endocytic and E-cadherin polarized Golgi trafficking to promote invasive breast cancer programs

RAB2A controls MT1-MMP endocytic and E-cadherin polarized Golgi trafficking to promote invasive breast cancer programs APPENDIX RAB2A controls MT1-MMP endocytic and E-cadherin polarized Golgi trafficking to promote invasive breast cancer programs Hiroaki Kajiho, Yuko Kajiho, Emanuela Frittoli, Stefano Confalonieri, Giovanni

More information

Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma

Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma EXPERIMENTAL AND THERAPEUTIC MEDICINE 6: 1489-1493, 2013 Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma JINQUAN CAI Department of Urology, Fuzhou

More information

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

K-Ras signalling in NSCLC

K-Ras signalling in NSCLC Targeting the Ras-Raf-Mek-Erk pathway Egbert F. Smit MD PhD Dept. Pulmonary Diseases Vrije Universiteit VU Medical Centre Amsterdam, The Netherlands K-Ras signalling in NSCLC Sun et al. Nature Rev. Cancer

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Clinical Policy: Cetuximab (Erbitux) Reference Number: PA.CP.PHAR.317

Clinical Policy: Cetuximab (Erbitux) Reference Number: PA.CP.PHAR.317 Clinical Policy: (Erbitux) Reference Number: PA.CP.PHAR.317 Effective Date: 01/18 Last Review Date: 11/17 Coding Implications Revision Log Description The intent of the criteria is to ensure that patients

More information

Targeting the ERBB family in cancer: couples therapy

Targeting the ERBB family in cancer: couples therapy OPINION Targeting the ERBB family in cancer: couples therapy Niall Tebbutt, Mikkel W. Pedersen and Terrance G. Johns Abstract The ERBB family of receptor tyrosine kinases has a central role in the tumorigenesis

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:

More information

GASTRIC & PANCREATIC CANCER

GASTRIC & PANCREATIC CANCER GASTRIC & PANCREATIC CANCER ASCO HIGHLIGHTS 2005 Fadi Sami Farhat, MD Head of Hematology Oncology Division Hammoud Hospital University Medical Center Saida Lebanon Tel: +961 3 753 155 E-Mail: drfadi@drfadi.org

More information

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression

More information

Copyright. Tocagen Inc. Lead Product Candidate: Toca 511 & Toca FC Preclinical Overview

Copyright. Tocagen Inc. Lead Product Candidate: Toca 511 & Toca FC Preclinical Overview Lead Product Candidate: Toca 511 & Toca FC Preclinical Overview Toca 511, delivers CD prodrug activator gene selectively to cancer cells Regulatory genes Structural RRV genes CD gene Regulatory genes Toca

More information

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Nature Medicine: doi: /nm.4078

Nature Medicine: doi: /nm.4078 Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios

More information

Drug Resistance: Oncology 520 March 27, 2012

Drug Resistance: Oncology 520 March 27, 2012 Drug Resistance: Oncology 520 March 27, 2012 John R. Mackey MD Medical Oncologist, Cross Cancer Institute Professor of Oncology University of Alberta john.mackey@albertahealthservices.ca Outline General

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

STUDY OF TRC093 (HUMANIZED ANTI- CLEAVED COLLAGEN ANTIBODY) IN PATIENTS WITH SOLID CANCER

STUDY OF TRC093 (HUMANIZED ANTI- CLEAVED COLLAGEN ANTIBODY) IN PATIENTS WITH SOLID CANCER FINAL RESULTS FROM A PHASE 1 STUDY OF TRC093 (HUMANIZED ANTI- CLEAVED COLLAGEN ANTIBODY) IN PATIENTS WITH SOLID CANCER F Robert, MS Gordon, LS Rosen, DS Mendelson, M Mulay, BJ Adams, D Alvarez, CP Theuer,

More information

非臨床試験 臨床の立場から 京都大学医学部附属病院戸井雅和

非臨床試験 臨床の立場から 京都大学医学部附属病院戸井雅和 資料 2 2 非臨床試験 臨床の立場から 京都大学医学部附属病院戸井雅和 1 Preclinical studies Therapeutic Window: Efficacy/Toxicity Disease Specificity Subtype Specificity Combination: Concurrent/Sequential Therapeutic situation: Response/

More information

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types

More information

OBJECTIVES. 1. List the major hallmarks of cancer. 2. Relate specific genes/proteins to individual hallmarks

OBJECTIVES. 1. List the major hallmarks of cancer. 2. Relate specific genes/proteins to individual hallmarks OBJECTIVES 1. List the major hallmarks of cancer 2. Relate specific genes/proteins to individual hallmarks 3. Explain how hallmarks of cancer lead to cancer development Case Study 60 year old female Previously

More information

Necroptosis-Inducing Rhenium(V) Oxo Complexes

Necroptosis-Inducing Rhenium(V) Oxo Complexes Necroptosis-Inducing Rhenium(V) Oxo Complexes K. SUNTHARALINGAM, S.G. AWUAH, P.M. BRUNO, T.C. JOHNSTONE, F. WANG, W. LIN, Y.- R. ZHENG, J.E. PAGE, M.T. HEMANN, S.J. LIPPARD JACS ASAP 1 Celeste Alverez

More information

For Dr. Moriyama, Dusseldorf,

For Dr. Moriyama, Dusseldorf, Autologous Formalin-fixed Tumor Vaccine (AFTVac) For Dr. Moriyama, Dusseldorf, 2016.06.01 Background Nature Med, 1:267, 1995 Nature Med, 2:1283, 1996 Tumor-Associated Antigenic peptides (TAAs) in the formalin-fixed

More information

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro

More information