Cancer therapeutics in the clinical setting. Need for alternate therapeutics. Target multiple cancer pathways. Circumvent the genetic mutations
|
|
- Hector Horn
- 6 years ago
- Views:
Transcription
1 Transcriptional factor Snail and MMP-9 signaling axis controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma Samar Abdulkhalek 1, Olivia Geen 1, Lacey Brodhagen 1, Fiona Haxho 1, Farah Alghamdi 1, Stephanie Allison 2, Duncan Simmons 1, Leah O Shea 1, Ronald J Neufeld 2, and Myron R Szewczuk 1*. Depts of 1 Biomedical and Molecular Sciences, and 2 Chemical Engineering, Queen s University, Kingston, ON K7L 3N6, Canada. *speaker
2 Cancer therapeutics in the clinical setting Need for alternate therapeutics Target multiple cancer pathways Circumvent the genetic mutations
3 OP: Oseltamivir phosphate Published: TLR-4, -7 & -9 EGFR Trk insulin Identified a new anticancer therapeutic approach: Oseltamivir phosphate (OP) monotherapy or in combination with chemotherapeutics against human ovarian cancer regulates tumour neovascularization, growth and invasiveness.
4 Neu1 sialidase activity is associated with epidermal growth factor (EGF) stimulation of ovarian carcinoma cells Mean fluorescence Control EGF 30ng/ml OP 164µ g/ml + EGF Anti-Neu1 100µ g/ml + EGF MMP9i 50 µ g/ml + EGF Mean fluorescence Control EGF 33ng/ml OP 333µ g/m L + EG F Control EGF 33ng/ml OP 333µ g/ml + EGF
5 Oseltamivir phosphate (OP) decreases the cell viability of, cis, -shrna Slug and -shrna Snail cells cis Stable shrna Slug KD Stable shrna Snail KD LD 50 = 7 μm at 48 hr LD 50 = 4 μm at 48 hr LD 50 > 488 μm at 48hr LD 50 > 488 μm at 48 hr C ell V iab ility (% of Control)+ SEM Cell Viability (% of Control)+ SEM Cell Viability (% of Control) ± SEM Cell Viability (% of Control) ± S.E. OP LD 50 of 7μM for OP LD 50 of 4μM for cisplatin-resistant cis OP LD 50 of 488μM for shrna Slug and Snail KD
6 Cell viability of cells treated with different dosages of OP in combination with 1μM of cisplatin, 5-FU, gemcitabine and paclitaxel Cisplatin 5-FU Gemcitabine Paclitaxel C ell Viability (% of C ontrol) ± S.E. Cell Viability (% of Control) ± S.E. C ell Viability (% of C ontrol) ± S.E. C ell Viability (% of C ontrol) ± S.E. untreated control C isplatin 1 µ M OP 300 µ g/ml + Cis 1µ M OP 600 µ g/m L + C is 1µ M OP 800 µ g/ml + Cis 1µ M untreated control 5-FU 1 µ M OP 300µ g/ml+ 5-FU 1µ M OP 600µ g/ml + 5-FU 1µ M OP 800µ g/m L + 5-FU 1µ M untreated control Gem 1µ M OP 600 µ g/ml + Gem 1µ M OP 300 µ g/ml + Gem 1µ M OP 800 µ g/m L + G em 1µ M untreated control Paclitaxel 1µ M OP 300µ g/ml + Pac 1µ M OP 600µ g/ml + Pac 1µ M OP 800µ g/m L + P ac 1 µ M Beneficial effect using combination therapy of OP and standard clinical chemotherapeutics on amplifying chemo-drug sensitivity. Hypersensitivity reactions to oxaliplatin, gemcitabine are noted complications in cancer patients.
7 human ovarian cancer cell line implanted cutaneously in RAGxCγ double mutant mice A Untreated Control 30mg/kg OP 50mg/kg OP B Tumor volume (mm 3 ) Tumor volume (mm 3 ) Tumor volume (mm 3 ) Control TV
8 H&E staining of microtome 5µm sections of paraffin-embedded necropsy lungs taken from tumor-bearing RAGxCy double mutant mice Lungs Untreated OP 50mg/kg OP 30mg/kg B Number m etastatic clusters per lung untreated O P 30 mg/kg OP 50 mg/kg
9 OVARIAN CANCER human ovarian cancer cell line in RAGxCy double mutant mice Ovarian Ovarian SLUG KD Ovarian SNAIL KD SLUG: represses E-cadherin expression and induces epithelial to mesenchymal transitions SNAIL: repressor of E-cadherin gene expression in epithelial tumour cells
10 H&E staining of microtome 5µm sections of paraffin-embedded necropsy lungs taken from tumor-bearing RAGxCy double mutant mice Necropsy Lungs Untreated Slug shrna Snail shrna B Number m etastatic clusters per lung Slug KD SNAIL KD
11 Necropsy tumors Untreated Slug Snail Untreated A4 mouse SLUG KD B2 mouse SNAIL KD C2 mouse D E-cadherin Untreated N-cadherin A Tumor B Tumor H&E E C Bkg E-cad N-cad relative total staining density VE-cad SLUG KD SNAIL KD
12 Snail-MMP-9 signaling axis potentiates Neu1 sialidase and MMP-9 cross-talk in regulating RTK receptors, tumor neovascularization, growth and invasiveness Abdulkhalek et al 2014 Clinical and Translational Medicine 3:28 (open access) MMP9 Snail Signaling cascade Slug Tumor vasculature
13
14 A B Tumor volume (mm 3 ) A4 B4 C4 Confidential unpublished data
15 OVARIAN CANCER human ovarian cancer cell line was established from tumour tissue from an untreated patient Control EGF 30ng/ml Tamiflu 400 μm + EGF Anti-Neu1 100 μg/ml + EGF MMP9i 50 μg/ml + EGF Phase Sialidase activity Snail shrna Sialidase activity Confidential unpublished data
16 A B C C ell V iability (% of C ontrol) + S.E. LD 50 = 50 μm C ell V iability (% of C ontrol) + S.E. cis LD 50 = 8 μm C ell Viability (% of C ontrol) ± S E M (n=6) untreated control C isplatin 1µ M Tam iflu 0.73m M + C isplatin 1 µ M Tamiflu 1.46mM + Cisplatin 1 µ M Tamiflu 1.95mM + Cisplatin 1 µ M Tamiflu 0.73mM Tam iflu 1.46m M Confidential unpublished data
17 A Tumor volume (mm 3 ) B Confidential unpublished data
18 A Untreated 50mg/kg OP 30mg/kg OP Number m etastatic clusters per liver untreated Tamiflu 30 mg/kg Tamiflu 50 mg/kg B Number m etastatic clusters per lung untreated Tamiflu 30 m g/kg Tamiflu 50 mg/kg Confidential unpublished data
19 A Number m etastatic clusters per lung Number m etastatic clusters per liver B Slug KD SNAIL KD Slug KD SNAIL KD Confidential unpublished data
20 Untreated A4 mouse SLUG KD B2 mouse SNAIL KD C2 mouse A Tumor D B C Tumor H&E Bkg E-cad relative total staining density N-cad VE-cad SLUG KD SNAIL KD
21 Novelty Abdulkhalek et al 2013 Research and Reports in Biochemistry 3: SNAIL: a zinc finger transcriptional repressor SLUG KD SNAIL KD Snail genes act primarily as survival factors and inducers of cell movement? Signaling cascade Tumor vasculature secreted cytokines
22 Conclusions Tamiflu provides an unexpected therapeutic benefit in cancer, by interfering with growth factor receptor-induced survival signals and disabling cancer cell survival in acquire chemoresistance. Tamiflu alone or in combination with chemotherapeutics against pancreatic and breast impedes the growth and metastatic spread, tumor neovascularization and chemoresistance in heterotopic xenograft of tumors growing in RAGxCγ double mutant mice.
23 Priority #1: Clinical trials Priority #2: To study the broad range efficacy of Tamiflu therapy in combination with standard chemotherapeutics. Priority #3: To test this novel therapy on surgically obtained patient primary tumors in culture
Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis
Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative
More informationTranscriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma
Abdulkhalek et al. Clinical and Translational Medicine 2014, 3:28 RESEARCH Transcriptional factor snail controls tumor neovascularization, growth and metastasis in mouse model of human ovarian carcinoma
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationCancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationTargeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example
Targeting the Oncogenic Pathway as Opposed to the Primary Tumor Site: HER2 as an Example Dennis J Slamon, MD, PhD Professor of Medicine Chief, Division of Hematology/Oncology; Director of Clinical/Translational
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationFundamental research on breast cancer in Belgium. Rosita Winkler
Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationUnderstanding patent claims (f) Drug for the treatment of cancer
Understanding patent claims (f) Drug for the treatment of cancer Treatment of cancer Explanation of terms Heat shock protein 90 (HSP 90) Belongs to a class of proteins that protect cells when stressed
More informationIn vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
More informationEGFR: fundamenteel en klinisch
EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation
More informationCell Polarity and Cancer
Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways
More informationComplexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies
Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus
More informationLAG-3: Validation Of Next Generation Checkpoint Pathways
LAG-3: Validation Of Next Generation Checkpoint Pathways Frédéric Triebel, CO/CMO Immune Checkpoint Modulation & Combination Therapies April 13, 2016 London, UK. 1 AX:PRR; NADAQ:PBMD Notice: Forward Looking
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationCatechin s anti-angiogenic effects in epithelial ovarian cancer
Catechin s anti-angiogenic effects in epithelial ovarian cancer Brian Krug Background Epithelial ovarian cancer (EOC) is a common and lethal malignancy of the female reproductive tract (2). Often detected
More informationFigure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
More information5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
More informationMETACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY
METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationSupplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF
Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF- 02341066 Assay IC 50 nm Selectivity Ratio d Biochemical Activity In Vitro c-met/hgfr enzyme (Ki, nm) a 4 NA Cellular Activity
More informationBiomarkers in oncology drug development
Biomarkers in oncology drug development Andrew Stone Stone Biostatistics Ltd EFSPI Biomarkers and Subgroups June 2016 E: andrew@stonebiostatistics.com T: +44 (0) 7919 211836 W: stonebiostatistics.com available
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationOMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
More informationPrimary Mucinous Ovarian Cancer (PMOC) Michael Frumovitz
Primary Mucinous Ovarian Cancer (PMOC) Michael Frumovitz Epithelial Subtypes Serous Endometrioid Mucinous Transitional Clear Cell Mixed Undifferentiated Squamous Ovarian Surface Epithelium Naora et al.,
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationA holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI
A holistic approach to targeting breast cancer part II: Micronutrient synergy Presented by: Dr. Neha Shanker DRRI Overview of the previous webinar In the last presentation we talked about: Increase in
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationCD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal
CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal transition and breast cancer progression Rhonda L. Brown,, Jing Yang, Chonghui Cheng J Clin Invest. 2011;121(3):1064-1074.
More informationCetuximab with Chemotherapy as Treatment for Stage III Colon or Metastatic Colorectal Cancer
Cetuximab with Chemotherapy as Treatment for Stage III Colon or Metastatic Colorectal Cancer Cetuximab with Chemotherapy (CT) as First-Line Treatment for Metastatic Colorectal Cancer (mcrc): Analysis of
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationThe legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 16 December 2009
The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION 16 December 2009 REMOVAB 10 microgram concentrate for infusion solution Carton containing 1 pre-filled syringe (CIP:
More informationTitle Cancer Drug Phase Status
Clinical Trial Identifier Title Cancer Drug Phase Status NCT01164995 Study With Wee-1 Inhibitor MK-1775 and Carboplatin to Treat p53 Mutated Refractory and Resistant Ovarian Cancer Epithelial Ovarian Cancer
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationEuropean consortium study on the availability of anti-neoplastic medicines
European consortium study on the availability of anti-neoplastic medicines Nathan I Cherny Alexandru ENIU, MD, PhD Norman Levan Chair in Humanistic Chair, Emerging Countries Committee Medicine Department
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationTable S1. Reclassification of 5-year risk of all-cause mortality among colorectal cancer patients by continuous E-cadherin (n=188)
Diagnostic Accuracy and Prediction Increment of Markers of Epithelial-Mesenchymal Transition to Assess Cancer Cell Detachment from Primary Tumors BMC Cancer Evan L. Busch, Prabhani Kuruppumullage Don,
More informationPancreatic Adenocarcinoma: What`s hot
Pancreatic Adenocarcinoma: What`s hot Eva Karamitopoulou-Diamantis Institute of Pathology University of Bern 11.09.2018, 30th ECP, Bilbao Pancreatic Cancer and the Microbiome The Pancreatic Cancer Microbiome
More informationChemoresistance: Detectors to Dormancy
Chemoresistance: Detectors to Dormancy Andy Redfern University of Western Australia Harry Perkins Institute of Medical Research Fiona Stanley Hospital Ongoing Projects: What to pack? The Route to Efficacy
More informationMaximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research
Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research Presented by: Thomas C. Tucker, PhD, MPH Associate Director for Cancer Control Markey Cancer Center University of
More informationTumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
More informationSupplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
More informationSupplementary Figure 1
Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots
More informationCHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one
More informationEts-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs
Ets-1 identifying polynucleotide sequence for targeted delivery of anti-cancer drugs Indian Patent Application No. 1623/DEL/2014 Inventors: Prof. Kulbhushan Tikoo and Jasmine Kaur Department of Pharmacology
More informationAppendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
More informationthis mutation. However, VEM was not effective. The PDOX model thus helped identify
/, Vol. 7, No. 44 Vemurafenib-resistant BRAF-V600E-mutated melanoma is regressed by MEK-targeting drug trametinib, but not cobimetinib in a patient-derived orthotopic xenograft (PDOX) mouse model Kei Kawaguchi
More informationIVC History, Cancer Research
Riordan Clinic IVC Academy 5 IVC History, Cancer Research O (slides 41-80) Pharmacokinetics of Oral Vitamin C using Liposomal Form* To test whether plasma vitamin C levels, following oral doses in supplemented
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationPancreas Quizzes c. Both A and B a. Directly into the blood stream (not using ducts)
Pancreas Quizzes Quiz 1 1. The pancreas produces hormones. Which type of hormone producing organ is the pancreas? a. Endocrine b. Exocrine c. Both A and B d. Neither A or B 2. Endocrine indicates hormones
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40
More informationCorrelation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer
Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,
More informationTrevigen s Extracellular Matrix Proteins for Triculture of Breast Cancer Spheroids, Endothelial Tubules, and Human Mesenchymal Stem Cells
Trevigen s Extracellular Matrix Proteins for Triculture of Breast Cancer Spheroids, Endothelial Tubules, and Human Mesenchymal Stem Cells Gabriel Benton, Ph.D. and Jay George, Ph.D., Trevigen, Inc. Gaithersburg,
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationmtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions
Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata
More informationLondon Cancer New Drugs Group. February London Cancer New Drugs Group (LCNDG) Work Plan for the London Cancer Drugs Fund list.
February 2013 London Cancer New s Group (LCNDG) Work Plan for the London Cancer s Fund London Cancer s Fund List This Cancer s Fund (CDF) list of medicines and s is in two parts. 1. The standard list of
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSupplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance
Cancer Cell, Volume 25 Supplemental Information Angiocrine Factors Deployed by Tumor Vascular Niche Induce B Cell Lymphoma Invasiveness and Chemoresistance Zhongwei Cao, Bi-Sen Ding, Peipei Guo, Sharrell
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationFor personal use only
ASX and Media release 6 April 211 Circadian s Inhibits Tumour Growth in Models of Lung, Ovarian and Prostate Cancer Data demonstrates efficacy of with other therapeutic agents in mouse models of lung,
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationBiobehavioral Pathways in Epithelial Ovarian Cancer
Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa
More informationNimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated
Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated apoptosis and inhibition of epithelial-to-mesenchymal transition Ramadevi Subramani a, Ph.D., Elizabeth Gonzalez b, MS.,
More informationThe 2010 Gastrointestinal Cancers Symposium Oral Abstract Session: Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract
The 2010 Gastrointestinal Cancers Symposium : Cancers of the Pancreas, Small Bowel and Hepatobilliary Tract Abstract #131: Phase I study of MK 0646 (dalotuzumab), a humanized monoclonal antibody against
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationRAB2A controls MT1-MMP endocytic and E-cadherin polarized Golgi trafficking to promote invasive breast cancer programs
APPENDIX RAB2A controls MT1-MMP endocytic and E-cadherin polarized Golgi trafficking to promote invasive breast cancer programs Hiroaki Kajiho, Yuko Kajiho, Emanuela Frittoli, Stefano Confalonieri, Giovanni
More informationRoles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma
EXPERIMENTAL AND THERAPEUTIC MEDICINE 6: 1489-1493, 2013 Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma JINQUAN CAI Department of Urology, Fuzhou
More informationClaudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression
Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationK-Ras signalling in NSCLC
Targeting the Ras-Raf-Mek-Erk pathway Egbert F. Smit MD PhD Dept. Pulmonary Diseases Vrije Universiteit VU Medical Centre Amsterdam, The Netherlands K-Ras signalling in NSCLC Sun et al. Nature Rev. Cancer
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationClinical Policy: Cetuximab (Erbitux) Reference Number: PA.CP.PHAR.317
Clinical Policy: (Erbitux) Reference Number: PA.CP.PHAR.317 Effective Date: 01/18 Last Review Date: 11/17 Coding Implications Revision Log Description The intent of the criteria is to ensure that patients
More informationTargeting the ERBB family in cancer: couples therapy
OPINION Targeting the ERBB family in cancer: couples therapy Niall Tebbutt, Mikkel W. Pedersen and Terrance G. Johns Abstract The ERBB family of receptor tyrosine kinases has a central role in the tumorigenesis
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD
AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:
More informationGASTRIC & PANCREATIC CANCER
GASTRIC & PANCREATIC CANCER ASCO HIGHLIGHTS 2005 Fadi Sami Farhat, MD Head of Hematology Oncology Division Hammoud Hospital University Medical Center Saida Lebanon Tel: +961 3 753 155 E-Mail: drfadi@drfadi.org
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationCopyright. Tocagen Inc. Lead Product Candidate: Toca 511 & Toca FC Preclinical Overview
Lead Product Candidate: Toca 511 & Toca FC Preclinical Overview Toca 511, delivers CD prodrug activator gene selectively to cancer cells Regulatory genes Structural RRV genes CD gene Regulatory genes Toca
More informationCANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationDrug Resistance: Oncology 520 March 27, 2012
Drug Resistance: Oncology 520 March 27, 2012 John R. Mackey MD Medical Oncologist, Cross Cancer Institute Professor of Oncology University of Alberta john.mackey@albertahealthservices.ca Outline General
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSTUDY OF TRC093 (HUMANIZED ANTI- CLEAVED COLLAGEN ANTIBODY) IN PATIENTS WITH SOLID CANCER
FINAL RESULTS FROM A PHASE 1 STUDY OF TRC093 (HUMANIZED ANTI- CLEAVED COLLAGEN ANTIBODY) IN PATIENTS WITH SOLID CANCER F Robert, MS Gordon, LS Rosen, DS Mendelson, M Mulay, BJ Adams, D Alvarez, CP Theuer,
More information非臨床試験 臨床の立場から 京都大学医学部附属病院戸井雅和
資料 2 2 非臨床試験 臨床の立場から 京都大学医学部附属病院戸井雅和 1 Preclinical studies Therapeutic Window: Efficacy/Toxicity Disease Specificity Subtype Specificity Combination: Concurrent/Sequential Therapeutic situation: Response/
More informationGenetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department
Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types
More informationOBJECTIVES. 1. List the major hallmarks of cancer. 2. Relate specific genes/proteins to individual hallmarks
OBJECTIVES 1. List the major hallmarks of cancer 2. Relate specific genes/proteins to individual hallmarks 3. Explain how hallmarks of cancer lead to cancer development Case Study 60 year old female Previously
More informationNecroptosis-Inducing Rhenium(V) Oxo Complexes
Necroptosis-Inducing Rhenium(V) Oxo Complexes K. SUNTHARALINGAM, S.G. AWUAH, P.M. BRUNO, T.C. JOHNSTONE, F. WANG, W. LIN, Y.- R. ZHENG, J.E. PAGE, M.T. HEMANN, S.J. LIPPARD JACS ASAP 1 Celeste Alverez
More informationFor Dr. Moriyama, Dusseldorf,
Autologous Formalin-fixed Tumor Vaccine (AFTVac) For Dr. Moriyama, Dusseldorf, 2016.06.01 Background Nature Med, 1:267, 1995 Nature Med, 2:1283, 1996 Tumor-Associated Antigenic peptides (TAAs) in the formalin-fixed
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More information