Supporting Information

Transcription

1 Supporting Information Shime et al /pnas SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience and PL InterferonSource, respectively. Recombinant TNF-α was purchased from R&D Systems. Tumor ells and Tumor-Infiltrated Immune ells. We first tested the amounts of macrophages (Mfs) in implant tumors formed in 6 mice. Mouse lymphoma (EL4), Lewis lung carcinoma (3LL), adenocarcinoma M38, and melanoma (16D8) lines grew well in the back of mice, and the Mf content was maximal in the 3LL tumor. M38, a murine colon adenocarcinoma cell line, was a gift from S. A. Rosenberg (National ancer Institute, ethesda) (1). Hemorrhagic necrosis shown in Fig. 1A was typically induced in response to polyi: in 3LL tumor. We then used the 3LL line for this study. 3LL cells were found to express very low amounts of detectable MH class I or class II (Table S1), suggesting this cell type as a possible target for natural killer (NK) cells but not cytotoxic T lymphocytes (TLs). 3LL cells were found to express appreciable amounts of the NKG2D ligand, retinoic acid-inducible gene 1, consistent with previous reports (Table S1) (2, 3). 3LL cells also expressed mrna transcripts for Toll-like receptor 3 (TLR3), Toll IL-1 receptor domain-containing adaptor molecule 1 (TIAM-1), IFN-β promoter stimulator 1 (IPS-1), and melanoma differentiation-associated protein 5 (MDA5). Exposure to polyi:-stimulated peritoneal Mfs caused significant death of 3LL cells, which was likely an effect of liberated inflammatory cytokines such as TNF-α (4). onsistent with previously reported data about 3LL properties in vitro, the 3LL cells we used were not damaged by direct polyi: treatment or exposure to 3LL-derived cytokines (Fig. S8). When 3LL cells were implanted s.c. in mice, the resulting tumors were found to contain a high amount (>3%) of D cells (Fig. S5A). The major population of those D cells was determined to be of D11b + myeloid lineage cells that coexpressed F4/8 +, Gr1 +, or D11c +. A small population of NK1.1 + cells was also detected. D4 + T cells, D8 + T cells, and cells were rarely detected in these implant tumors (Fig. S5A). ytotoxic Activity Assay. Mice bearing 3LL tumor were injected i.p. with polyi:. Mice were killed and F4/8 + cells were isolated from tumor by using MAS-positive selection beads (Miltenyi) as described previously. 3LL cells were labeled with 51 r for 3 5 h and then washed three times with the medium. F4/8 + cells, and 3LL cells were cocultured at the indicated ratio. After 2 h, supernatants were harvested and 51 r release was measured in each sample. Specific lysis was calculated by the following formula: cytotoxicity (%) = [(experimental release spontaneous release)/ (max release spontaneous release)] 1. Flow ytometric Analysis. Mononuclear cells prepared from spleen and tumor were treated with anti-d16/32 (no. 93) and stained with AP anti-d45.2 (no. 14), FIT anti-d11b (M1/7), PE anti-gr1 (R6-85), FIT anti-d11c (N418), PE or AP anti-f4/8 (M8), PE anti-nk1.1 (PK136), PE anti- D49b (DX5), PE anti-d3e ( ), FIT anti-d4 (GK1.5), FIT anti-d8a (53-6.7), and PE- and anti-d19 (M19-1; eioscience and iolegend; Table S2). Samples were analyzed with FASalibur (D iosciences), and data analysis was performed using FlowJo software (Tree Star). For intracellular cytokine staining, we freshly isolated tumors from polyi: or -injected mice at 1 h and incubated the cells in the presence of 1 μg/ml refeldin A for 3 h. ells were fixed and stained with the combination of anti-d45.2 Ab and anti-f4/8 Ab or anti-gr1 Ab, followed by permeabilizing and staining with anti-tnf Ab using D ytofix/ytoperm Kit (D iosciences). Quantitative PR Analysis. Tumor samples were cut into small pieces and homogenized with TRIzol Reagent (Invitrogen). Total RNA was isolated according to the manufacturer s instruction. Reverse transcription was performed using High-apacity cdna Reverse Transcription Kit (Applied iosystems). Real-time PR was performed with Power SYR Green PR Master Mix (Applied iosystems) with a StepOne Real-Time PR System (Applied iosystems). Expression of the cytokine gene was normalized to the expression of GAPDH. We used primer pairs listed in Table S3. Data were analyzed by the ΔΔt method. ELISA and ytokine eads Assay. Tumor samples were cut into small pieces and homogenized with ellytic MT Mammalian Tissue Lysis/Extraction Reagent (Sigma) supplemented with omplete Protease Inhibitor Mixture (Roche) on ice. Lysate was centrifuged to remove insoluble materials, and the supernatant was used for ELISA. Serum cytokine concentration was determined by ELISA or cytokine bead assays. Data were shown as TNF-α (pg) per weight of tumor (g). Histochemistry and Immunohistochemistry. 3LL tumor was fixed with buffered 1% formalin overnight and embedded in paraffin wax, and sections 4 μm in thickness were stained with H&E. For immunohistochemistry, tumor was embedded in optimal cuttingtemperature compound, and snap-frozen in liquid nitrogen. ryosections 6 μm in thickness were air-dried for 6 min and fixed for 15 min with prechilled acetone and then incubated with FIT anti-d31 antibody (39; iolegend). The sections were mounted in Prolong Gold Antifade Reagent with DAPI (Invitrogen). Images were obtained with a Leica LSM51 confocal laser-scanning microscope. Tumor hallenge and Treatment. Mice were shaved at the back and injected s.c with 2 μl of LL cells in ( ). Tumor size was measured using a caliper. Tumor volume was calculated using the following formula: tumor volume (cm 3 )= (long diameter) (short diameter) 2.4. (25 μg/head) with no detectable LPS was injected i.p. as indicated. In some cases, polymixin -treated polyi: was used. When an average tumor volume of.5.8 cm 3 was reached, the treatment was started and repeated every 4 d. Isolation of F4/8 + ells from Tumor. Tumors formed by 3LL cells were excised at 2 wk after transplantation and treated with.5 mg/ml ollagenase I (Sigma),.5 mg/ml ollagenase IV (Sigma),.25 mg/ml hyaluronidase (Sigma), and.1 mg/ml DNase I (Roche) in HSS at 37 for 1 min. F4/8 + cells were isolated by using biotinylated anti-f4/8 antibody (M8) and Streptavidin Microeads (Miltenyi). We routinely prepared F4/ 8 + cells at >9% purity from tumor. Shime et al. 1of12

2 1. Zitvogel L, et al. (1995) ancer immunotherapy of established tumors with IL-12. Effective delivery by genetically engineered fibroblasts. J Immunol 155: Masuda H, et al. (22) High levels of RAE-1 isoforms on mouse tumor cell lines assessed by the anti-pan-rae-1 polyclonal antibody confers tumor cell cytotoxicity on mouse NK cells. iochem iophys Res ommun 29: Smyth MJ, et al. (24) NKG2D recognition and perforin effector function mediate effective cytokine immunotherapy of cancer. J Exp Med 2: Remels L, Fransen L, Huygen K, De aetselier P (199) Poly I: activated macrophages are tumoricidal for TNF-α-resistant 3LL tumor cells. J Immunol 144: H&E D31 / DAPI Fig. S1. induces hemorrhagic necrosis of tumor. 3LL tumor-bearing mice were i.p. injected with 2 μg polyi: and tumors were isolated 12 h later. Formalin-fixed tumors stained with H&E (Upper) and frozen sections stained with anti-d31 antibody and DAPI nuclear stain (Lower). Original magnification 1 for all panels. (Scale bars, 1 μm.) A representative experiment of three with similar outcomes is shown. Shime et al. 2of12

3 T umor volume (cm 3) ** Days after tumor challenge M38 16D8 EL4 4 4 % ytotoxicity TNF-α (ng/ml) TNF-α (pg/ml) M38 ** WT TIAM-1-/- D TNF-α (pg/ml) D8 ** EL4 35 ** Fig. S2. induces TNF-α production by tumor-associated F4/8 + Mfs in various types of tumor. (A) M38 cells (1 1 5 ) were s.c implanted into 57L/6 mice (day ). (2 μg) was i.p. injected on day 16. Data are shown as tumor average size ± SE; n =3 4 mice per group. () Sensitivity of M38, 16D8, and EL4 cells to recombinant TNF-α. ( and D) M38, 16D8, and EL4 tumor-bearing mice were i.p injected with 2 μg polyi:. After 1 h, F4/8 + cells were isolated from tumors and incubated for 24 h. TNF-α concentration in the conditioned medium was determined by ELISA; n = 3. Data are shown as average ± SD.., not detected. A representative experiment of two with similar outcomes is shown. 3. T umor volume (cm 3 ) Ab Anti-NK1.1 + anti-nk1.1 Ab + anti-nk1.1 Ab Days after tumor challenge Fig. S3. NK cells are not essential for polyi:-induced antitumor activity in vivo. 3LL tumor cells (3 1 6 ) were s.c transplanted into 57L/6 mice (day ). NK cells were depleted by injection of anti-nk1.1 antibody (PK136) into 3LL tumor-bearing mice on day 14. All doses of antibody and treatment regimens were determined in preliminary studies using the same lot of antibodies used for the experiments. Treatment was confirmed to deplete completely the desired cell populations for the entire duration of the study. (25 μg) was i.p injected on day 15 and the tumor volume was measured. Data shown are means ± SE, n = 3. A representative experiment of two with similar outcomes is shown. Shime et al. 3of12

4 TNF-α pg/ml Time after polyi: injection (h) TNF-α IFN-β pg/ml 8 6 pg/ml WT TIAM-1-/- IPS-1-/- 2 WT TIAM-1-/- IPS-1-/- Fig. S4. ytokine production in polyi:-treated mouse. (A) WT mice were injected i.p with 2 μg polyi:. After, 1, 2, and 3 h, TNF-α concentration in serum was determined by ELISA. ( and ) WT, TIAM-1 /, and IPS-1 / mice were injected i.p with 2 μg polyi:. After 1 h for TNF-α () and 4 h for IFN-β (), serum cytokine levels were determined by ELISA. Data represents mean ± SD (n = 3).., not detected. A representative experiment of three with similar outcomes is shown. Shime et al. 4of12

5 S S o u n t s FS D N K 1. c r G 1 2 D F 4 / non D11b D11b D11b D D 1 2 D S S D o u n t s D8α non FS D G r N K F 4 / D 1 1 c D11 b D D11 b D8 α 1. 8 Fig. S5. Analysis of immune cells infiltrated into tumor. 3LL tumor cells (3 1 6 )(A) or M38 (1 1 6 )() were transplanted s.c into 6 WT mice. After 2 wk, flow cytometric analysis was performed using freshly isolated whole tumor cell preparations in combination with staining of surface markers. D cells were gated, and the expression of indicated surface markers was further analyzed. Numbers represent percentage of the gated and positive cells. A representative experiment of two with similar outcomes is shown. FS, forward scatter; SS, side scatter. Shime et al. 5of12

6 3LL tumor F 4/ R F 4/ R R ounts (% of Ma x ) TNF-α TNF-α D26 Isotype control R1 R2 R3 Spleen (naive mouse) R1 R2 F4/ R D11b R2 ounts (% of Ma x ) D26 ounts (% of Ma x ) D26 Isotype control Anti-D26 Ab Fig. S6. oth TNF-α producing and nonproducing F4/8 + macrophages in 3LL tumor of polyi:-injected mouse express D26 (macrophage mannose receptor). (A) 3LL tumor-bearing mice were injected i.p with 2 μg polyi:. After 1 h, single-cell suspension of tumor was incubated in the presence of 1 μg/ml refeldin A for 3 h. Intracellular cytokine staining for TNF-α in D F4/8 + cells was performed. R2, and R1 and R3 indicates TNF-α producing and nonproducing F4/8 + cells, respectively. () D26 expression in splenic F4/8 + D11b + cells (R1 and R2) of naive mouse. Shime et al. 6of12

7 (%) ytotoxicity ng/ml IFN-β.2 ng/ml IFN-β.2 ng/ml IFN-β 2 ng/ml IFN-β TNF-α (pg/ml) IFNAR1-/- TLR3 TIAM-1 T umor volume (cm 3) PI Days after tumor challenge N.S. Relative expression of mrna.8.4 Poly I: WT IFNAR1 -/-.8.4 WT IFNAR1 -/- D TNF-α (pg) / tumor (g) Tumor Serum TNF-α (pg/ml) Time after poly: injection (h) Fig. S7. Involvement of type I IFN signaling in 3LL tumor regression induced by polyi:. (A) Effect of IFN-β on cytotoxic activity of TNF-α against 3LL tumor cells. 3LL cells were incubated in the presence of, 5, and 5 pg/ml recombinant mouse TNF-α in combination with,.2,.2, and 2 ng/ml recombinant mouse IFN-β. ytotoxicity was determined by 51 r release assay. () Disabling polyi: for 3LL tumor regression in IFN-α/β receptor (IFNAR1) / mice. was i.p injected on day 11; n =3 4mice per group. Data are shown as average ± SE. N.S., not significant. () Levels of the mrna of TLR3 and TIAM-1 in 3LL tumor-associated F4/8 + cellsofwtorifnar1 / mice. (D) TNF-α levels in tumor and serum in polyi:-stimulated IFNAR / mice. Mice bearing 3LL tumors were i.p. injected with 2 μg polyi:. Tumor (Left) andserum(right) were collected at, 2, and 3 h after polyi: injection, and TNF-α concentration was determined by ELISA. TNF-α level in tumor is presented as [TNF-α protein (pg)/tumor weight (g)]. Shime et al. 7of12

8 3 25 ** 3 3 ** WT TIAM-1-/- IPS-1-/- TLR3-/- T NF-α ( pg/ml) WT TIAM-1-/- IPS-1-/- ** ** 2 2 No F4/8 + cells 2 (%) (%) ytotoxicity 1 5 ytotoxicity Fig. S8. In vitro polyi:-stimulated F4/8 + cells secrete TNF-α and have cytotoxic activity. (A) F4/8 + cells isolated from 3LL tumor were stimulated with polyi: (5 μg/ml) in vitro. After 24 h, the conditioned medium was collected and TNF-α concentration was determined by ELISA. () F4/8 + cells isolated from tumor were mixed with 51 r-labeled 3LL tumor cells in the presence or absence of polyi: (5 μg/ml). After 2 h, radioactivity of the conditioned medium was measured. E/T = 1. () 51 r-labeled 3LL tumor cells were incubated for 2 h in the presence or absence of polyi: (5 μg/ml); n = 3. Data are shown as average ± SD. **P <.1. A representative experiment of three with similar outcomes is shown. Shime et al. 8of12

9 Fold increase IFN-β WT TIAM-1-/- IPS-1-/- Fold increase IL-12p4 WT TIAM-1-/- IPS-1-/- Fold increase Fold increase xcl11 Arg1 increase Fold increase Fold IL-6 WT TIAM-1-/- IPS-1-/- WT TIAM-1-/- IPS-1-/ hi3l3 WT TIAM-1-/- IPS-1-/- WT TIAM-1-/- IPS-1-/- Fold increase MMR increase Fold MMP9 WT TIAM-1-/- IPS-1-/- WT TIAM-1-/- IPS-1-/- increase Fold VEGFA WT TIAM-1-/- IPS-1-/- Poly I: Fig. S9. induces the expression of M1 but not M2 macrophage-associated genes in tumor-infiltrated F4/8 + cells through the TIAM-1 pathway. 3LL tumor-bearing mice were i.p injected with 2 μg polyi:. After 3 h, tumors pooled from two mice treated with polyi: or were mixed. F4/8 + cells were isolated from the mixed tumor, and the expression of (A) M1- and () M2-related genes was analyzed. A representative experiment of two with similar outcomes is shown. Shime et al. 9of12

10 Template β-actin TLR3 TIAM-1 MDA5 IPS ount (% of Max) D45+F4/8+ cells Isotype control Anti-TLR3 Ab kda Anti-MDA5 rabbit IgG ontrol rabbit IgG MDA TLR D TLR TIAM-1.. TAM M-Mf TAM Relative expression M-Mf Fig. S1. Expression of TLR3 and MDA5 in 3LL tumor-associated F4/8 + cells. (A) mrna expression of TLR3, TIAM-1, MDA5, and IPS-1 in 3LL tumor-associated F4/8 + cells. Total RNA (1 μg) of F4/8 + cells isolated from 3LL tumor was used as a template for RT-PR analysis. () Single-cell suspension of 3LL tumor was stained with FIT-labeled anti-d45 and PE-labeled anti-f4/8 antibody, followed by intracellular staining with Alexa 647-labeled anti-tlr3 antibody (11F8) or isotype control antibody (rat IgG2a). D45 + F4/8 + cells are shown. () ytoplasmic extract of F4/8 + cells was subjected to SDS/PAGE and immunoblotted with rabbit anti-mda5 antibody or control IgG purified from rabbit serum. (D) mrna expression of TLR3 and TIAM-1 in F4/8 + tumor-associated macrophages (TAM) and macrophage colony-stimulating factor-induced bone marrow-derived macrophages (M-Mf). Shime et al. 1 of 12

11 Fold increase of IFN-β mrna F4/8+ TAMs F4/8+ TAMs WT TIAM-1-/- IPS-1-/- WT TIAM-1-/- IPS-1-/- IFN-β (pg/ml) PEs D PEs IFN-β (pg/ml) TNF-α (pg/ml) WT TIAM-1-/- IPS-1-/- 1 WT TIAM-1-/- IPS-1-/- E IFN-β (pg/ml) M-SF-MDM WT IPS-1-/- F TNF-α (pg/ml) M-SF-MDM WT IPS-1-/- Fig. S11. In vitro stimulation with polyi: increases the production of IFN-β and TNF-α by Mfs. (A and ) F4/8 + cells were isolated from 3LL tumor implanted in WT, TIAM-1 /, and IPS-1 / mice and stimulated with 5 μg/ml polyi:. After 4 h, cells were harvested and IFN-β mrna expression was analyzed by quantitative PR analysis (A). After 2 h, IFN-β concentration in culture supernatant was determined by ELISA (). ( and D) Peritoneal exudate cells (PEs) isolated from WT, TIAM-1 /, and IPS-1 / mouse were stimulated with 5 μg/ml polyi: for 2 h. The concentrations of IFN-β () and TNF-α (D) in culture supernatant were determined by ELISA. (E and F) Macrophage colony-stimulating factor (M-SF)-induced bone marrow-derived macrophages (MDM) were prepared from WT and IPS-1 / mouse and cultured in the presence of 3% L929 supernatant containing M-SF. After 6 d, adherent cells were harvested and stimulated with 5 μg/ml polyi: for 2 h. The concentrations of IFN-β (E) and TNF-α (F) in culture supernatant were determined by ELISA. Data are shown as mean ± SD (n =3).., not detected. A representative experiment of two with similar outcomes is shown. Table S1. cells Expression of various markers on 3LL and M38 tumor Surface marker 3LL M38 H2-K b ++ H2-D b ± ++ RAE1 ++ Not determined D45 Expression of surface markers was analyzed by flow cytometry. Expression was evaluated by mean fluorescence shift:,.99 ; ±, 1 1 ; +, 11 1 ; ++, 11. Shime et al of 12

12 Table S2. RT-PR primers used in this study Forward primer (5 3 ) Reverse primer (5 3 ) IFN-β AGTAAGAAAGGAGA GTGTAGGTGAGGTTGAT IL-12p4 AATGTTGGTGAAGTA ATGATTGTGATGA IL-6 GTGATATGTTGTTATAAAT TGGGAAATGTGGAAATGAG TNF-α AGGGATGAGAAGTTAAATG GTTGTATGAATTTTGAGAAG IL-1β TGAGGAAAAAGATGA TGTGTGGAGATTTGAAG IL-1 GGGTGTATGATTTT TGTATGTTGTTTA xcl11 GGTGGAAAAGTTGAAGTGA TTGGAAGAGTTTTATTGGAG IRF4 AGAGAGGTTATAATAA TGTGGGAAAGT IRF5 GGTAAGGGGAAAAGAAAT ATATTAGTGTAT Jmjd3 GAGTGGTTGGGTAAT GAAGGGTAAAAGGAATATTGGA Arg1 GGAATTGATGGGAATGTGT AGGGTTAGTTGAAGA MMP9 AAGTGGGAATATAAATA GATATGTTGGGAAGT VEGFA GAATTTAGGAGTA TGTGTAGGAAGTATT hi3l3 TATTAAAATGAGAAGA GGTTTGAGGAGTAGAGAA Mrc1 TTGTTAGTATTGGAG GGAATTTTGGGATTAGTT Retnla AATAGTAATATT AAGTAGAGTATA GAPDH GTGGAGAAATGA TAGATGTGTTA Table S3. Expression of surface markers on tumor-infiltrated F4/ 8 + cells Marker Expression* I-Ab + H2-D b + H2-K b + D8 ++ D86 ++ D4 ± D11c ± D3 D4 D8α Gr D11b +++ D26 (MMR) ++ *Expression was evaluated by mean fluorescence shift:,.99 ; ±, 1 1 ; +, 11 1 ; ++, 11 1, ; +++, 1,1. Shime et al of 12