Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Transcription

1 Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi Sozen, Manikandan Subramanian, Mohammad N. Islam, Christina C. Rymond, Jasper Du, Jaime Hook, George Kuriakose, Jahar Bhattacharya, and Ira Tabas

2 Cell count (x per μl) Treg cells (per right lung) Day Day 7 Mac-associated : free AC Foxp + (% CD + ) Histological score Figure S A PBS DT B PBS DT C.6.. Total WBC Neutrophils Lymphocytes Monocytes. PBS DT PBS DT Day Day 7 D PBS DT E PBS Anti-CD IgG Anti-CD F G..8 #.6. #. WT Rag -/- Rag -/- Treg cells: WT Rag -/- Rag -/- Treg cells: - - +

3 Figure S. Treg cell depletion prevents resolution of injury in LPS-induced ALI. (A) Foxp- human DTR mice were treated with intranasal LPS on day and then injected with PBS or DT on day. Whole blood was collected from mice on day, and complete blood counts were obtained (n = 6 mice per group, no statistically significant differences). Data displayed represent one of independent experiments and are means ± SEM. (B-C) Mice were treated with intranasal LPS on day and then given DT injections (or PBS) on days,, and. (B) H&E-stained lung sections at day and 7 (Scale bar: µm). (C) Quantification of lung injury score (n = - mice per group; P <., -tailed Student's t test). Data are represented as means ± SEM. (D) Representative images from the in situ efferocytosis assay in Figure. Sections of paraffin-embedded whole lung tissue were de-paraffinized and then immunostained using the TUNEL assay to identify apoptotic cells and with Mac- to identify macrophages. Apoptotic cells were then scored as either associated (arrows) with macrophages or free (arrowheads), followed by quantification of the associated:free ratio as a measure of efferocytosis. Top panels: Images corresponding to the data in Figure E. Bottom panels: Images corresponding to data in Figure F. Scale bar: µm; images taken at X. (E) Mice were treated with anti-cd antibody or IgG control two days before and one day after administration of intranasal LPS. Four days after LPS treatment, the percent of Foxp + T cells in the lung was assayed (n = - mice per group; P <., -tailed Student's t test). Data are represented as means ± SEM. (F) WT or Rag -/- mice were first given LPS and then x 6 WT Tregs or PBS intranasally on day. On day, the number of CD + CD + Foxp + T cells in the right lung was quantified (n = -6 mice per group; groups with different symbols are statistically different from each other, with P value at least less than. using one way ANOVA with Tukey s multiple comparisons). Data are represented as means ± SEM. (G) Sections from the left lungs of mice described in F were assayed for TUNEL + apoptotic cells (AC) that were either associated with Mac- + macrophages (Mac) or not associated with macrophages ("free") (n = - mice per group; groups with different symbols are statistically different from each other, with P value at least <. by twoway ANOVA, Sidak s multiple comparisons). Data are represented as means ± SEM. See also Figure.

4 mrna expression in Macs co-cultured with Treg cells (relative to vehicle-treateded Macs) Phagocytosis (%) Ilb Il6 Tnfa Nos Arg Retnla CD Mrc mrna expression in day Macs (relative to day 8 Macs) Ilb Il6 Tnfa Nos Arg Retnla Figure S Mrc A B Spleen Treg cells PBS DT Foxp C D Figure S. Characterization of macrophages. (A) Macrophages were isolated at day from the peritoneum of zymosan-treated Foxp-human DTR mice treated with PBS or DT, as in Figure. The cells were then assayed ex vivo for the uptake of µm polystyrene beads (n = - mice per group; P <., -tailed Student's t test). Data displayed represent means ± SEM. (B) Spleens were harvested from mice, and a single cell suspension of splenocytes was generated. Treg cells were then isolated as described in the STAR Methods section. Shown are representative CD- FoxP flow cytometry contour plots of splenocytes and enriched Treg cells that were gated on single cells and then CD + cells. (C) WT bone marrow-derived macrophages (Mac) were incubated with or without Treg cells for 8 hours and then assayed for the indicated mrnas by qrt-pcr. Dotted line represents the average value obtained in the group without Treg cells for each gene of interest (n = wells in triplicate; P <., -tailed Student's t test). Data displayed represent one of independent experiments and are means ± SEM. (D) Peritoneal macrophages were isolated from mice either 8 days or days after i.p. injection of. mg zymosan. Relative expression of the indicated mrnas was quantified by qrt-pcr. Dotted line represents the average value obtained in the day 8 group for each gene of interest (n = mice per group; P <., -tailed Student's t test). Data displayed represent one of independent experiments and are means ± SEM. See also Figure.

5 CD + (%CD + ) Bcl mrna Efferocytosis (%) Binding (%) Il mrna Efferocytosis (%) Figure S A n.s. B C D E F n.s. WT Il -/- PBS WT Il -/- Treg Treg cells cells WT Mac Ilrb -/- Mac Treg cells - + Veh + ril- (ng/ml) Figure S. Treg cell IL- is dispensable for induction of Il and Bcl in macrophages, and IL- enhances efferocytosis by human macrophages. (A) The percent of CD + T cells were assayed in the peritoneal lavage fluid of the mice in Figure A (n.s., not significant). Data are represented as means ± SEM. (B) Bone marrow-derived macrophages (Mac) from WT or Ilrb -/- mice were incubated with or without splenic Treg cells from WT mice and then assayed for efferocytosis in vitro as in Figure C (n = wells; P <. vs. all other groups, two-way ANOVA, Sidak s multiple comparisons test). Data are represented as means ± SEM. (C-D) Bone marrow-derived macrophages from WT mice were cultured with Treg cells from WT or Il -/- mice or vehicle control (PBS). Macrophages were then assayed for Il and Bcl mrna (n = -7 wells; P <. vs. PBS, one-way ANOVA, Sidak s multiple comparisons test). In these experiments, the Treg cells were removed prior to mrna assay, and this was confirmed by the finding that Cd mrna was undetectable by RT-qPCR (average Actb C was 8; as a positive control, a preparation of T cells had an average Cd C of with Actb C = 9). Data are represented as means ± SEM. (E) Bone marrow-derived macrophages were pre-treated for 8 h with the indicated concentrations of ril- and then assayed for apoptotic cell binding ( o C) (n = wells; P <. vs. Veh, one-way ANOVA, Tukey s post-hoc analysis). Data are represented as means ± SEM. (F) Human monocyte-derived macrophages were incubated with recombinant human IL- (rhil-, ng/ml) or vehicle control and then assayed for efferocytosis (n = wells; P <., -tailed Student's t test). Data are represented as means ± SEM. See also Figure PBS WT Il -/- Treg Treg cells cells Veh rhil-

6 TUNEL+ cells/section Fasting glucose (mg/dl) Lesion area (μm ) Lesional Mac (%) Body weight (g) Total cholesterol (mg/dl) Triglycerides (mg/dl) A B C Complex Veh ILC ILC Veh Complex Veh ILC ILC Veh Antibody IgG IgG nab nab Antibody IgG IgG nab nab Antibody IgG IgG nab nab Figure S Complex Veh ILC ILC Veh D E F Complex Veh ILC ILC Veh Antibody IgG IgG nab nab Complex Veh ILC ILC Veh Antibody IgG IgG nab nab Complex Veh ILC ILC Veh Antibody IgG IgG nab nab G H Vehicle + IgG ILC + IgG Vehicle + IL- nab ILC + IL- nab Complex Veh ILC ILC Veh Antibody IgG IgG nab nab Figure S. Treg cell expansion in WD-fed Ldlr -/- mice does not affect metabolic endpoints or lesional macrophage content. The mice described in Figure were assayed for the following endpoints after the - week treatment with Veh vs. IL-C and IgG vs. anti-il- nab: (A) body weight, (B) plasma cholesterol, (C) plasma triglycerides, (D) fasting blood glucose, (E) lesion area, and (F-G) content of macrophages (Mac) and total TUNEL + cells (free and macrophage-associated) in aortic root lesions (n=7- per group; there was no significant difference among any of the groups except the Veh/anti-IL- nab in F, one-way ANOVA, Sidak s multiple comparisons test.) All data (A-G) are represented as means ± SEM. (H) Illustrative images from in situ efferocytosis experiments in Figure D. Aortic root frozen sections were stained with TUNEL to identify apoptotic cells and with F/8 to identify macrophages. Apoptotic cells were then scored as either associated with macrophages (arrows) or free (arrowheads) as in Figure S in order to generate an associated:free ratio as a measure of efferocytosis. Scale bar: µm. See also Figure.

7 Treg cells (total # lavaged) Treg cells (per right lung) Treg cells (per spleen) Bead phagocytosis (%) Necrotic cell uptake (%) Il mrna in Mac Il mrna in Mac Il mrna Efferocytosis (%) IgG A.. B.... nab IL- Figure S CD/CD8 IL- C Treg cells Mac only Mac + Treg cells D E.. Mac scrrna Il sirna DT Treg cells PBS WT Il -/- Treg Treg cells cells # n.s WT Il -/-.... Mac scrrna Il sirna F n.s. PBS WT Il -/-. Treg Treg cells cells DT Treg cells # n.s DT - - WT IL- -/- Treg cells # # # WT IL- -/-

8 Figure S. Experiments related to the role of Treg cell-derived IL- in the macrophage-il-- efferocytosis pathway. (A) CD + CD + Foxp + Treg cells were isolated from spleens of wild type mice and incubated with the indicated stimuli overnight. mrna was isolated from cells and assayed for Il by qrt-pcr. Data are represented as means ± SEM. (B) Macrophages were incubated with or without Treg cells in the presence of anti-il- neutralizing antibody (nab) or control IgG. The macrophages were then assayed for efferocytosis. Data displayed represent one of independent experiments and are means ± SEM. For panels A and B, n = wells per group; P <. vs. all other group by two-way ANOVA and Sidak s multiple comparisons test. (C) Bone marrow-derived macrophages (Mac) were treated with scrambled sirna or Il sirna, co-cultured with splenic Treg cells for hours, and then assayed for Il and Il mrna (n = - wells; P <., two-way ANOVA, Sidak s multiple comparisons test). Data are represented as means ± SEM. (D) Bone marrow-derived macrophages were incubated with either WT or Il -/- Treg cells and then assayed for the uptake of -μm polystyrene beads or heat-induced necrotic Jurkat cells (n = wells per group; P <., one-way ANOVA, Tukey s multiple comparisons test). Note that there was no detectable uptake of live Jurkat cells by macrophages either in the absence or presence of Treg cells. Data displayed represent one of independent experiments and are means ± SEM. (E) Naïve Foxp-human DTR mice were injected with PBS or µg/kg DT at day and µg/kg DT on the morning of day. On the afternoon of day, x splenic Treg cells from WT or Il -/- mice were isolated and delivered i.p. to the indicated mice. After 8 hours, the mice were injected i.p. with PKHred-labeled apoptotic neutrophils, and min later lavage fluid was analyzed by flow cytometry for the number of Treg cells present in the exudate (n = mice per group; groups with different symbols are statistically different from each other, with p value at least <. using two-way ANOVA, Sidak s multiple comparisons). Data are represented as means ± SEM. (F) Foxp-human DTR mice were treated with intranasal LPS on day and then injected with DT or PBS on day one. x 6 WT or Il -/- Treg cells or PBS were delivered intranasally to mice on the afternoon of day one. The number of CD + CD + Foxp + T cells in lung and spleen at day were quantified (n = - mice per group; groups with different symbols are statistically different from each other, with p value at least less than. using one way ANOVA with Tukey s multiple comparisons). Data are represented as means ± SEM. See also Figure 6.

9 Il mrna in Mac (relative to day ) Il mrna in Mac (relative to day ) Il mrna in Treg cells (relative to day ) IL- (pg/ml of concentrated exudate) Il mrna in Treg cells (relative to day ) IL- (pg/ml of concentrated exudate) Macrophages (F/8 + ) Treg cells (CD + CD + Foxp + ) Efferocytosis (%) A.% 66.% Figure S6 WT Treg cells Il -/- Treg cells B Day macrophages Day 8 macrophages C Day Day D. Day Day. E F Day Day Day Day Day Day. G Day Day Day Day Day Day H.

10 Figure S6. IL- and IL- levels rise with increasing Treg cell numbers during peritonitis. (A) Peritoneal macrophages were isolated either from naïve WT mice (resident macrophages Day ) or from WT mice 8 days after i.p. injection with. mg zymosan (recruited macrophages Day 8). The macrophages were co-cultured with vehicle, WT Treg cells or Il -/- Treg cells for 8 hours and then, after washing away the T cells, assayed for percent efferocytosis. The percentage values shown above the st and rd asterisks indicate the relative increase in efferocytosis rate between vehicle and WT Treg cell groups (n= mice per group, P <. by two-way ANOVA, Sidak s multiple comparisons). Data displayed represent one of independent experiments and are means ± SEM. (B) Exudate macrophage and T regulatory (Treg) cell numbers. (C-H) Exudates were concentrated and subjected to ELISA for IL- or IL- (C, E). The cellular fraction was plated and allowed to adhere for. hours. The non-adherent fraction was collected, and Treg cells were isolated. cdna was generated from both the Treg cell and macrophage (Mac) populations, and levels of Il and Il mrna were determined by RT-qPCR (D, F, G, H). (n = mice per group, assayed in triplicate, P <. by two-tailed Student s T test). Data are represented as means ± SEM. See also Figure 6.

11 pstat/total STAT Vav mrna Figure S7 A. B ril Stattic Scrambled sirna Vav sirna C actin apoptotic cell IL Treg Treg cell IL- Il IL- IL-R Macrophages STAT Vav Vav Vav RAC GTP RAC GDP Figure S7. Validation data for the STAT inhibitor, Stattic, and for Vav sirna and summary scheme of how Treg cells stimulate efferocytosis in macrophages. (A) Bone marrow-derived macrophages were treated with IL- with and without 6 μm Stattic and then analyzed for pstat and total STAT by flow cytometry (n = wells; P <., one-way ANOVA, Sidak s multiple comparisons test). Data are represented as means ± SEM. (B) Bone marrow-derived macrophages were treated with scrambled or VavsiRNA and then incubated with ril- or vehicle control, followed by assay of Vav mrna (n = wells; P <., -tailed Student's t test). Data are represented as means ± SEM. (C) Scheme of how Treg cells stimulate efferocytosis in macrophages. Treg cell-secreted IL- stimulates macrophages to produce IL-, which signals in an autocrine-paracrine manner through STAT to induce the expression of Vav. Vav then acts as a GEF to enhance Rac GTP loading, which has been shown previously to enhance actinmediated apoptotic cell engulfment. See also Figure 7.

12 TABLE S REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Mouse: Actb Forward CACTGTCGAGTCGCGTCC Mouse: Actb Reverse TCATCCATGGCGAACTGGTG Mouse: Bcl Forward GCTGTCTCCCCCGAAAGATG Mouse: Bcl Reverse AGGCAGGTGTAGATGTTGTGG Mouse: Tnfa Forward CTTCTGTCTACTGAACTTCGGG Mouse: Tnfa Reverse CAGGCTTGTCACTCGAATTTTG Mouse: Ilb Forward GCAACTGTTCCTGAACTCAACT Mouse: Ilb Reverse ATCTTTTGGGGTCCGTCAACT Mouse: Il6 Forward TAGTCCTTCCTACCCCAATTTCC Mouse: Il6 Reverse TTGGTCCTTAGCCACTCCTTC Mouse: Il Forward CATGGGTCTTGGGAAGAGAA Mouse: Il Reverse AACTGGCCACAGTTTTCAGG Mouse: Il Forward TGCCAAGATCTGTGTCTCTCC Mouse: Il Reverse GCCATGCAATATCCTCTGGG Mouse: Nos Forward GTTCTCAGCCCAACAATACAAGA Mouse: Nos Reverse GTGGACGGGTCGATGTCAC PrimerBank PrimerBank (Wang et al., 6) (Wang et al., 6) (Guo et al., 6) (Guo et al., 6) PrimerBank PrimerBank (Guo et al., 6) (Guo et al., 6) pga.mgh.harvard.ed u/primerbank pga.mgh.harvard.ed u/primerbank pga.mgh.harvard.ed u/primerbank pga.mgh.harvard.ed u/primerbank

13 Mouse: Arg Forward CTCCAAGCCAAAGTCCTTAGAG Mouse: Arg Reverse AGGAGCTGTCATTAGGGACA Mouse: Mrc Forward CTCTGTTCAGCTATTGGACGC Mouse: Mrc Reverse TGGCACTCCCAAACATAATTTGA Mouse: Retnla Forward CCAATCCAGCTAACTATCCCTCC Mouse: Retnla Reverse ACCCAGTAGCAGTCATCCCA Mouse: Vav Forward TTAACAACCTGCTTCCCCAGG Mouse: Vav Reverse ACAAAGGAACTGGGACATCTG (Guo et al., 6) (Guo et al., 6) (Guo et al., 6) (Guo et al., 6) (Nomura et al., 6) (Nomura et al., 6) Guo, J., Shi, T., Cui, X., Rong, Y., Zhou, T., Zhang, Z., Liu, Y., Shen, Y., and Chen, W. (6). Effects of silica exposure on the cardiac and renal inflammatory and fibrotic response and the antagonistic role of interleukin- beta in C7BL/6 mice. Arch Toxicol 9, 7-8. Nomura, M., Liu, J., Rovira, II, Gonzalez-Hurtado, E., Lee, J., Wolfgang, M.J., and Finkel, T. (6). Fatty acid oxidation in macrophage polarization. Nat Immunol 7, 6-7. Wang, X., Zheng, Z., Caviglia, J.M., Corey, K.E., Herfel, T.M., Cai, B., Masia, R., Chung, R.T., Lefkowitch, J.H., Schwabe, R.F., et al. (6). Hepatocyte TAZ/WWTR promotes inflammation and fibrosis in nonalcoholic steatohepatitis. Cell Metab,