Index. Adv Biochem Eng Biotechnol (2013) 130: DOI: / Ó Springer-Verlag Berlin Heidelberg 2013
|
|
- Luke Melton
- 6 years ago
- Views:
Transcription
1 Adv Biochem Eng Biotechnol (2013) 130: DOI: / Ó Springer-Verlag Berlin Heidelberg 2013 Index A Acute lung injury (ALI), 105, 113 endotoxin-induced, 45 Acute respiratory distress syndrome (ARDS), 113 Adhesion, 175, 218, 278 molecules, 4, 11, 23, 135, 201, 223, 279 proteins, 223 receptors, 23 Adipocytes, 269 Adipose-derived stromal cell (ADSC), 56, 89, 93, 278 Adipose stromal cells (ASC), 56, 163, 278 Adipose tissue, 110, 267 Adult progenitor cells, 39, 43 Advanced therapy medicinal products (ATMP), 287 Alloderm (ADM), 50 Allodynia, Allogeneic hematopoietic stem cell transplantation (allo-hsct), 131, 132 Allotransplantation, 55 Alveolar bone proper-derived stem cell, 89 Amniotic fluid, 136, 267, 272 Anaphylatoxin C3a, 26 Angiogenesis, 240 Angiogenic factors, 4 Antiapoptotic factors, 4, 111, 240 Anti-inflammatory, 163 Apoptosis, 6, 31, 48, 59, 75, , 215, 242 Asthma, 40, 119 Autologous chondrocyte transplantation (ACT), 78 Azathioprine, 49 B Bifrons, 245 Bioactive factors, 163 Bioartificial liver devices (BAL), 6 Bone marrow, 26, 109, 115, 132, 163, 276 cells, harvesting, 75 mononuclear cells (BMNCs), 47 stromal cells, 78, 89, 147 stromal stem cells (BMSSCs), 92, 163 Bone morphogenic proteins (BMP), 71, 76, 79, 270 Bone regeneration, 69 Bortezomib, 244 Bronchial asthma, 119 Burns, 55 C C-reactive protein (CRP), 47 Calcium sulphate, 72 Carboxyesterase, 244 Carcinoma-associated fibroblasts (CAF), 228 Cartilage regeneration/repair, 2, 69, 78 CD44, 23, 91, 280 CD73, 91, 98, 108, 111, 137, 176, 234, 268, 280 CD90, 91, 97, 108, 111, 137, 176, 234, 268, 280 CD105 (endogline), 91, 97, 108, 111, 137, 176, 234, 268, 280 CD146, 268 CD166, 268 CD271, 268 Cell reprogramming, 44 Cell therapy, 39, 41
2 306 Index Cell transplantation, 1 Cell-based therapies (CBTs), 163 Chemokines, 5, 27, 79, 136, 163, 244 Chondroblasts, 269 Chronic obstructive pulmonary disease (COPD), 40, 46, 49, 105, 115 Clinical Trials Facilitation Group (CTFG), 295 Collagen, 4, 21, 49, 93, 96, 118, 182, 186, 221, 237 Colony-forming unit-fibroblast (CFU-F), 26, 59, 107 Composites, 72 Connective tissue injuries, 2 Cord blood, 267 Crohn s disease, 5 CX3CL1, 244 CXCR4, 23 Cyclosporine, 4, 49 Cystic fibrosis (CF), 105, 115 transmembrane conductance regulator (CFTR), 116 Cytokines, 4, 163, 214 Cytosine deaminase, 244 Cytoskeleton, 4 D Danger/stress responses, 163 Dendritic cells (DCs), 199, 201 cytoskeleton rearrangement, 199 differentiation, 199 maturation, 199 phenotype, 199 tolerogenic, 199 Dental follicle stem cells (DFSCs), 89, 94 Dental pulp stem cells (DPSCs), 89, 93 Dentine matrix protein 1 (DMP1), 92 Dentine sialophosphoprotein (DSPP), 92 Dexamethasone, 76 Dickkopf-related protein-1 (DKK-1), 74, 77, 242 DNA methyltransferase inhibitors, 8 E Endothelial cells, 227, 232 Endothelial nitric oxide synthase (enos), 48, 113 Endothelial progenitor cells (EPCs), 47 Endothelial to mesenchymal transition (EndMT), 231 Endothelin binding receptor (ETBR), 228 European Directorate for the Quality of Medicines and HealthCare (EDQM), 293 Ewing sarcomas, 30 Extracellular matrix (ECM) proteins, 97, 169, 177, 183, 213, 221 F Fat grafting, 55 Fibronectins, 4, 182, 221, 237 Fluorescence-assisted cell sorting (FACS), 58 5-Fluorocytosine (5-FC), 244 G Galectin-1, 137 Ganciclovir, 30 Gene therapy medicinal products, 289 Gingival stem cells, 89, 97 Good manufacturing practice (GMP), 295 Graft-versus-host disease (GvHD), 4, 131, 133, 275 Graft-versus-leukemia (GvL) reaction, 133 Growth factors, 74, 214 GTPase, 11 Guideline on Human Cell-Based Medicinal Products, 296 H Hematopoietic disorders, 131 Hematopoietic stem cells (HSC), 43, 132, 163, 273 transplantation (HSCT), 199 Hemoxygenase-1 (HO-1), 201 Hepatocyte growth factor (HGF), 137, 214 Histone deacetylase inhibitors, 8 Homing, 19 Human embryonic stem cells (ESCs), 7, 42 Human ipsc-derived MSCs (hipsc-mscs), 9 Human leukocyte antigens, 137, 269 HLA-II, 269 HLA-G, 137 Hurler syndrome, 27 Hydroxyapatite, 72 Hypopharyngeal carcinoma, 50 I Idiopathic pulmonary arterial hypertension (IPAH), 47, 49
3 Index 307 Idiopathic pulmonary fibrosis (IPF), 105, Immune response, 163 Immune synapse, 199 Immunodeficiencies, 131 Immunomodulation, 163 Immunosuppression, 131, 163 Indoleamine-2,3-dioxygenase (IDO), 11, 32, 137, 174, 176, 201 Induced pluripotent stem cells (ips), 1, 39, 166, 267, 271 Inflammation, 27 Inflammatory bowel diseases (IBD), 1, 5 Instant blood-mediated inflammatory reaction (IBMIR), 26 Integrins, 4, 23, 222 Interferons (IFNs), 163 IFN-c, 11, 215 Interleukins (ILs), 5, 163, 237 IL-1b, 215 IL-2, 5, 150, 218, 244 IL-6, 32, 48, 74, 137, 189, 201, 205, 216, 228, 236 IL-8, 216, 228, 238 IL-10, 6, 23, 32, 114, 137, 189, 202, 216 IL-12, 5, 30, 137, 203, 215, 226, 244 Intravenous injection, 19 Irradiation, 27 Ischemia, 27 J Janus Bifrons, 245 L LacZ (B16-LacZ), 30 Laminins, 223 Leukemia, 4, 41, 131, 137, 183, 187 inhibitory factor (LIF), 137, 174, 239 Lewis lung carcinoma (LLC), 30 Lipofilling, 55 Lipopolysaccharide (LPS), 202 Liver, diseases, 1 regeneration, 6 Long-bone defects, 77 Lung cancer, 40 Lung disease, 105 chronic, 105, 115 Lung tissue, engineered, 120 Lymphocytes, 225 M Macrophages, 225 Matrix extracellular phosphoglycoprotein (MEPE), 95 Matrix metalloproteinases (MMPs), 4, 25, 213, 219 Mesenchymal stem cells (MSCs), 1, 19, 55, 89, 105 adipose tissue, 277 adult, 267, 275 anti-tumor efficacy, 30 bone marrow, 276 foetal-derived, 272 isolation/tracing, 58 licensing, 199 mediated immunosuppression, 199 multipotent stromal or mesenchymal stem cell, 163 neonatal-derived, 273 placental, 273 therapeutic applications, 267 tumor-engrafted, 30 Mesenchymal stromal cells, 1, 19, 43 clinical grade, 131 Metachromatic leukodystrophy, 27 Methotrexate, 4 Microenvironment, 209 Mitogenic factors, 4 MSC1, pro-inflammatory MSC phenotype, 163 MSC2, anti-inflammatory MSC phenotype, 163 Myeloid-derived suppressor cells (MDSCs), 213, 226 N National Competent Authorities (NCAs), 292 Nestin, 94, 96, 147, 302 Notch 1/2, 94, 199, 206, 232 O Osteoblasts, 21, 71, 91, 94, 97, 107, 136, 147, 174, 219, 269, 271 Osteocalcin, 93, 96 Osteochondral defects, 83 Osteogenic cells, 70, 73, 270, 276 Osteogenic deficiencies, 2 Osteopontin, 93, 96
4 308 Index P Paclitaxel, 31 Patient-specific pluripotent stem cells, 7 Pax-9, 92 Pectoralis major myocutaneous flaps (PMMFs), 50 Periodontal ligament stem cells (PDLSCs), 89, 96 Periodontium, 89 Placenta stem cells, 273 Plasminogen activator inhibitor, 220 Plastic surgery, 55, 56 Platelet-derived growth factor (PDGF), 217 Pluripotent stem cells, 7 induced (ipscs), 44 Processed lipoaspirate (PLA) cells, 278 Pro-inflammatory, 163 Prostaglandins, 23, 32, 114, 137, 174, 199, 201, 239 Proteasome inhibitors, 244 Proteolytic enzymes, 219 Pro-tumorigenic effects, 30 Pulmonary hypertension (PH), 40, 47, 120 Pulmonary vascular disease, 120 R Radiation injury, 55 Radiation-induced lung injury, 48 Rap1, 11 Reactive oxygen species (ROS), 224, 227 Reconstructive surgery, 55 Regulatory framework, 287 Reprogramming, 45 Respiratory diseases, 39 Rosiglitazone, 62 S Scaffolds, 71 Scar repair, 55 Selectins, 23, 27 Serine protease plasmin, 220 Somatic cell nuclear transfer (SCNT), 7 Somatic cell therapy medicinal products, 289 Stanniocalcin-1 (STC1), 224 Stem cells, alveolar bone proper-derived, 97 amniotic fluid, 272 apical papilla (SCAP), 89, 95 banks, 76 cord blood, 274 dental pulp, 89 embryonic (ESCs), 3, 7, 39, 42, 95, 108, 166, 224, 270, 293 gingival, 97 hematopoietic (HSC), 273 human exfoliated deciduous teeth (SHEDs), 89, 95 induced pluripotent (ips), 271 multipotent, 105 periodontal ligament (PDLSCs), 89, 96 placental, 273 Stirred suspension bioreactors (SSBs), 10 STRO-1, 91 97, 111, 278, 302 Stromal derived factor-1 (SDF-1), 217 Stromal vascular fraction (SVF), 56, 59, 277 Suicide genes, 244 Surface markers, 3 T TAT (thrombin-anti-thrombin complex), 26 Tenascin-C, 223 Therapy, 19, 62 Thizolinedione (TZD), 62 Thymidine kinase, 244 Tissue engineered products (TEPs), 288, 289 Tissue engineering, 45, 55, 76, 93, 120, 270 Tissue inhibitor of metalloproteinases (TIMPs), 213, 220 Tissue scaffold, 50 Toll-like receptors, 163 Trachea, bioengineered, 51 Transcription factors, 7 Transforming growth factors (TGF), 9, 74, 79, 95, 137, 174, 201, 215, 217, 302 Transplants/transplantation, 19, 287 Treg cells, 199 Tumor, 29 microenvironment, 214 stroma, 109 Tumor-associated fibroblasts (TAF), 209, 228 Tumor-associated macrophages (TAM), 226 Tumor necrosis factor (TNF), 5, 24, 135, 176, 202, 216, 218 Tumor necrosis factor-related apoptosisinducing ligand (TRAIL), 209, 244
5 Index 309 U Ulcerative colitis, 5 Umbilical cord stem cells (UCSCs), 4, 76, 110, 133 Unrestricted somatic stem cells, 199 Urokinase plasminogen activator (upa), 220 V Vascular cell adhesion molecule (VCAM), 24, 93, 206, 268 Vascular endothelial growth factor (VEGF), 4, 47, 60, 74, 113, 216, 219, 238 W Warburg effect, 223 Wound healing, 55 X Xenografts, 3
Mesenchymal Stem Cells
Mesenchymal Stem Cells Science and therapeutic applications Dirk Büscher (Former VP-R&D Cellerix) GRIFOLS SA May 10 th, 2010 EMA 1 Discovery and Definition of Mesenchymal Stem Cells MSC must be plastic-adherent
More informationThe Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
More informationIndex. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A Alginate, tooth-shaped, for constructs, encapsulated pulp cells in, 589 590 Antibiotic paste, triple, change in root length and width
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationTissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science
Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration
More informationSTEM CELLS. Dr Mohammad Ashfaq Konchwalla Consultant Orthopaedic Sports Surgeon
STEM CELLS Dr Mohammad Ashfaq Konchwalla Consultant Orthopaedic Sports Surgeon www.dubaisportssurgery.com PRACTICE SAUDI GERMAN HOSPITAL, DUBAI MEDCARE HOSPITAL, DUBAI Totipotent cells are cells that can
More informationMesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future
Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Cell Therapy 2014 Las Vegas, NV, USA Sulaiman Al-Hashmi, PhD Sultan Qaboos University Oman What are MSCs? Stem
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationStem Cells and Sport Medicine
Stem Cells and Sport Medicine Rehal Abbas Bhojani, MD CAQSM Memorial Hermann Medical Group 2014 Sports Medicine Symposium of the Americas Stem cell biology Overview Potential applications of stem cells
More informationImmunological Lung Diseases
Emphysema and Fibrosis Universitätsklinik für Pneumologie Prof. Thomas Geiser Head Div. of Pulmonary Medicine and Laboratory of Lung Research, MU50 thomas.geiser@insel.ch The healthy lung: The pathway
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationBases for Immunotherapy in Multiple Myeloma
Bases for Immunotherapy in Multiple Myeloma Paola Neri, MD, PhD Associate Professor of Medicine University of Calgary, Arnie Charbonneau Cancer Institute Disclosures Paola Neri MD, PhD Grants/research
More informationCD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow
White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)
More informationUse of Adipose-Derived Stem Cells in Regenerative Therapy. David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas
Use of Adipose-Derived Stem Cells in Regenerative Therapy David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas Use of Adipose-Derived Stem Cells in Regenerative Therapy David Euhus,
More informationStem Cell Therapy Concept. Pleuripotent Stromal Cells 8/8/2011. Use of Adipose-Derived Stem Cells in Regenerative Therapy
Use of Adipose-Derived Stem Cells in Regenerative Therapy Use of Adipose-Derived Stem Cells in Regenerative Therapy David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas David Euhus,
More informationBone marrow stroma: biology and therapeutic exploitation
Bone marrow stroma: biology and therapeutic exploitation! Francesco Dazzi! francesco.dazzi@kcl.ac.uk Outline 1. Bone marrow stroma and the physiology of the haemopoietic niche! 2. The malignant niche:
More informationRicardo E. Colberg, MD, RMSK. PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute
Ricardo E. Colberg, MD, RMSK PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute Pathophysiology of chronic orthopedic injuries Definition of
More informationCharacteristics of Dental Pulp Stem Cells
Pharma&Biotech BioResearch Characteristics of Dental Pulp Stem Cells 15 October 2013 / Speaker: Dr. Isabella Drewelus 16 October 2013 / Speaker: Andrew Winner Lonza Walkersville, Inc., Walkersville, MD
More informationRegenerative Orthopedics
Regenerative Orthopedics WHERE ARE WE NOW? W. SCOTT WAUGH, MD, CAQSM, RMSK NONOPORTHO.COM W. Scott Waugh, MD, RMSK Edmond, OK Integrative Medical Solutions and Nonop Ortho Baylor University Waco, TX University
More informationWOUND CARE UPDATE. -Commonly Used Skin Substitute Products For Wound. -Total Contact Casting. Jack W. Hutter DPM, FACFAS, C. ped.
WOUND CARE UPDATE -Commonly Used Skin Substitute Products For Wound Closure -Total Contact Casting Jack W. Hutter DPM, FACFAS, C. ped. Commonly Used Skin Substitute Products for Wound Closure why are they
More informationTHE USE OF STEM CELLS IN DENTISTRY AND DEVELOPMENTS FOR THE FUTURE BY HEIDI SWINHOE RESEARCH PAPER BASED ON PATHOLOGY LECTURES AT MEDLINK 2014
THE USE OF STEM CELLS IN DENTISTRY AND DEVELOPMENTS FOR THE FUTURE BY HEIDI SWINHOE RESEARCH PAPER BASED ON PATHOLOGY LECTURES AT MEDLINK 2014 Grade Awarded: Pass with Merit ABSTRACT Stem cells have the
More informationCharacterisation of bone marrow progenitor cells in disease
Characterisation of bone marrow progenitor cells in disease A thesis submitted for the degree of Doctor of Philosophy Imperial College London Leukocyte Biology Kate Hayley Christine Gowers 2012 ~ 1 ~ Acknowledgements
More informationStem cells. -Dr Dinesh Bhurani, MD, DM, FRCPA. Rajiv Gandhi Cancer Institute, Delhi, -Director, Department of Haematology and BMT
Stem cells -Dr Dinesh Bhurani, MD, DM, FRCPA -Director, Department of Haematology and BMT Rajiv Gandhi Cancer Institute, Delhi, Flow of presentation Update on stem cell uses Haematopoietic stem cell transplantation
More informationReview Article. Dental stem cells Vashisht N 1, Vashisht D 2
Dental stem cells Vashisht N 1, Vashisht D 2 Review Article 1 Dr Neha Vashisht MDS, Oral Medicine and Radiology Private Practitioner, Shimla 2 Dr Divy Vashisht Senior Lecturer, Prosthodontics H P Government
More informationstem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products
stem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products Stem Cell Qualified Extracellular Matrix Proteins Stem cell research requires the finest
More informationCYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.
CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins
More informationIndex. endocytosis, 92 fat cells, 99 myelofibrosis, 390 nerves, 99, 100 sinuses, 90 Bone marrow fatty involution, red and yellow marrow,
A Adherent layer cell types, 256 adipocytes, 261 endothelial cells, 259-261 function, 262, 263 interactions, 261, 262 macrophage and epitheloid cell, 256-259 Association of hematopoiesis and bone formation,209,210
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationOncolytic Virotherapy: Targeting Cancer Stem Cells
Oncolytic Virotherapy: Targeting Cancer Stem Cells Cancer Stem Cells (CSCs) or Cancer Initiating Cells (CICs) A consensus of five defining criteria has been established to affirm the existence of CICs:
More informationRSM. Indications For Use
NEXT GENERATION SOLUTIONS RSM PATRIOT-RSM Amniotic Allograft Membrane is a human placental-based tissue product. The membrane forms a protective covering over the wound while providing the key components
More informationLaura Smart 9/22/2011
Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury
More informationrenoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
More informationStem Cells : A Review
Stem Cells : A Review Abhijeet Alok 1, Indra Deo Singh 2, Shivani Singh 3, Mallika Kishore 4 1- Senior Lecturer, Department of Oral Medicine and Radiology, Sarjug Dental College and Mata R Devi Dental
More informationJournal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
More informationIndex. neurosurgery.theclinics.com. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A A Complimentary Trial of an Immunotherapy Vaccine Against Tumor-specific EGFRvIII (ACTIVATE), 90 91 Active immunotherapy, 5 8, 96. See
More informationCell Therapy: The Future Of Medicine?
Cell Therapy: The Future Of Medicine? Nada Alaaeddine, Director of Regenerative and dinflammation Lab Associate professor Faculty de Medicine, USJ Why stem cells? A Mother Cell different from all other
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationRole of Inflammation in Pulmonary Hypertension
Role of Inflammation in Pulmonary Hypertension K. R. Stenmark University of Colorado Denver, USA Prominent Fibroproliferative Changes are Observed in the Lung Vasculature of Infants With Pulmonary Arterial
More informationAngiogenesis and Anti-Angiogenesis in Hematological Malignancies
Angiogenesis and Anti-Angiogenesis in Hematological Malignancies Domenico Ribatti Angiogenesis and Anti-Angiogenesis in Hematological Malignancies 1 3 Domenico Ribatti Department of Basic Medical Sciences
More informationTumor Associated Macrophages as a Novel Target for Cancer Therapy
Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationDarwinian selection and Newtonian physics wrapped up in systems biology
Darwinian selection and Newtonian physics wrapped up in systems biology Concept published in 1957* by Macfarland Burnet (1960 Nobel Laureate for the theory of induced immune tolerance, leading to solid
More informationEARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES
EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN
More informationASH 2011 aktualijos: MSC TPŠL gydyme. Mindaugas Stoškus VULSK HOTC MRMS
ASH 2011 aktualijos: MSC TPŠL gydyme Mindaugas Stoškus VULSK HOTC MRMS #3042. Yukiyasu Ozawa et al. Mesenchymal Stem Cells As a Treatment for Steroid-Resistant Acute Graft Versus Host Disease (agvhd);
More informationSeeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
More informationBone Marrow Stroma in Myelodysplastic Syndromes
Bone Marrow Stroma in Myelodysplastic Syndromes Universidad de Salamanca Prof Mª M Consuelo del Cañizo Hematology Dept. University Hospital, Salamanca SPAIN Bone marrow stroma in MDS Introduction Mesenchymal
More informationNeoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
More informationContribution of Interstitial Valve Cells to Aortic Valve Calcification
UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,
More informationJournal Club Semmler Lorenz
Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to
More informationCytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression
Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?
More informationEquine Regenerative Medicine. Regenerative Medicine IRAP and PRP in the Equine Athlete. Stem Cells. Stem Cells. Veterinary Medical Devices
Equine Regenerative Medicine Regenerative Medicine IRAP and PRP in the Equine Athlete Victoria Maxwell, DVM, MBA 2018 Potomac Regional Veterinary Conference Hyatt Regency Inner Harbor Baltimore, Maryland
More informationIndex Note: Page numbers of article titles are in boldface type.
Neurosurg Clin N Am 18 (2007) 191 198 Index Note: Page numbers of article titles are in boldface type. A AC133 antigen, in brain tumor cancer cells, 32 35 Activity-based restoration therapy, for spinal
More informationHealing and Repair. Dr. Nabila Hamdi MD, PhD
Healing and Repair Dr. Nabila Hamdi MD, PhD 1 ILOs Know the classification of human cells according to their ability for proliferation. Understand the mechanism of cellular regeneration. Identify the types
More informationMeeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
More informationAccelerate Your Research with Conversant Bio
Accelerate Your Research with Conversant Bio 400+ Participating MDs 50+ Partner sites for tissue procurement Continuous expansion of sourcing capabilities Closely monitored chain of custody Full regulatory
More informationBL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:
More informationRole of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress
3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationHealing & Repair. Tissue Regeneration
Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)
More informationWhat are stem cells? A stem cell can differentiate into any one of 220 different specialised cells in the body STEM CELLS
What are stem cells? Stem cells are often called MASTER CELLS, and form the foundation for your entire body as building blocks for the blood, immune system, tissue and organs. They can REPLICATE or REGENERATE
More informationBMTCN Review Course Basic Concepts and Indications for Transplantation How the Experts Treat Hematologic Malignancies Las Vegas, NV, March 10, 2016
BMTCN Review Course Basic Concepts and Indications for Transplantation How the Experts Treat Hematologic Malignancies Las Vegas, NV, March 10, 2016 David Rice, PhD, RN, NP Director, Professional Practice
More informationUse of Placental Tissue for Orthopedic Injuries: Potentials and Pitfalls. Daniel Kuebler, PhD Franciscan University of Steubenville
Use of Placental Tissue for Orthopedic Injuries: Potentials and Pitfalls Daniel Kuebler, PhD Franciscan University of Steubenville Benjamin D. Smith & Daniel A. Grande. The current state of scaffolds for
More informationINFLAMMATION & REPAIR
INFLAMMATION & REPAIR Lecture 7 Chemical Mediators of Inflammation Winter 2013 Chelsea Martin Special thanks to Drs. Hanna and Forzan Course Outline i. Inflammation: Introduction and generalities (lecture
More informationMesenchymal Stem Cells: Immunology and Therapeutic Benefits
Mesenchymal Stem Cells: Immunology and Therapeutic Benefits 3 Najib El Haddad Transplantation Research Center, Brigham & Women s Hospital, Harvard Medical School USA 1. Introduction Bone marrow is a complex
More informationHematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne
Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet
More informationIsolation and Characterization of Multipotent Postnatal Stem Cells from the Alveolar Bone and Gingival Cervical Margin
Klinik für Zahnerhaltungskunde und Paradontologie im Universitätsklinikum Schleswig-Holstein-Campus Kiel an der Christian-Albrechts-Universität Kiel Deutschland Isolation and Characterization of Multipotent
More informationInterleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases
54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationPeggers Super Summaries Basic Sciences Bone
Bone Overview & Turnover BONES Function o Support o Protection o Assisting movement o Storage of minerals o Production of red blood cells from marrow Types o Cancellous o Compact with Haversian systems
More informationYUJI YAMAGUCHI Department of Geriatric and Environmental Dermatology, Nagoya City University Graduate School of Medical Sciences
Nagoya Med. J., 149 Current status of regenerative medicine through the treatment for intractable skin wounds YUJI YAMAGUCHI Department of Geriatric and Environmental Dermatology, Nagoya City University
More informationDNA vaccine, peripheral T-cell tolerance modulation 185
Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory
More informationBMTCN Review Course Basic Concepts and Indications for Transplantation. David Rice, PhD, RN, NP
BMTCN Review Course Basic Concepts and Indications for Transplantation March 16, 2017 David Rice, PhD, RN, NP Director, Professional Practice and Education No disclosures Objectives Describe basic concepts
More informationLymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017
Lymphoid architecture & Leukocyte recirculation Thursday Jan 26th, 2017 Topics The life of immune cells Where are they born? Where are they educated? Where do they function? How do they get there? The
More informationInflammation in the clinic
Inflammation in the clinic Stephen T. Holgate MRC Clinical Professor of Immunopharmacology ILSI Europe Workshop, Seville, May 14-15 2012 The immune system acts in four general ways to ensure host defence
More informationDr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION
Benjamini. Ch. 19, Pgs 379-399 Page 1 of 10 TRANSPLANTATION I. KINDS OF GRAFTS II. RELATIONSHIPS BETWEEN DONOR AND RECIPIENT Benjamini. Ch. 19, Pgs 379-399 Page 2 of 10 II.GRAFT REJECTION IS IMMUNOLOGIC
More informationLymphoid System: cells of the immune system. Answer Sheet
Lymphoid System: cells of the immune system Answer Sheet Q1 Which areas of the lymph node have most CD3 staining? A1 Most CD3 staining is present in the paracortex (T cell areas). This is towards the outside
More informationHematopoetic Stem Cell Therapies in TURKIYE
Hematopoetic Stem Cell Therapies in TURKIYE World Location of transplant centers participating in CIBMTR (2010) Dr. Mustafa ÇETİN Mustafa CETIN, M.D. Erciyes University Medical Faculty Kayseri-TURKIYE
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationPRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer
PRP Basic Science Peter J. Moley, MD Hospital for Special Surgery October 5, 2011 Questions that this talk aims to answer 1. What is PRP? 2. What blood components are NOT in PRP? 3. What are the active
More informationThe future of HSCT. John Barrett, MD, NHBLI, NIH Bethesda MD
The future of HSCT John Barrett, MD, NHBLI, NIH Bethesda MD Transplants today Current approaches to improve SCT outcome Optimize stem cell dose and source BMT? PBSCT? Adjusting post transplant I/S to minimize
More informationTheoretical basis of bone replacement
THE BIOLOGY OF BONE REGENERATION Theoretical basis of bone replacement Department of Oral- and Maxillofacial Surgery Semmelweis University, Budapest Role of bone tissue Maintance of calcium and phosphate
More informationCERSI MTG BALTIMORE,MD MAY 8,2013 ARNOLD I CAPLAN
CERSI MTG BALTIMORE,MD MAY 8,2013 ARNOLD I CAPLAN The Science of MSCs & REGENERATIVE MEDICINE : CELL-BASED THERAPY = the NEW MEDICINE. ARNOLD I. CAPLAN, PhD Baltimore, MD May 8, 2013 Case Western Reserve
More informationImmune Reconstitution Following Hematopoietic Cell Transplant
Immune Reconstitution Following Hematopoietic Cell Transplant Patrick J. Kiel, PharmD, BCPS, BCOP Clinical Pharmacy Specialist Indiana University Simon Cancer Center Conflicts of Interest Speaker Bureau
More informationIn the last decade of the 20 th century, special emphasis was put on an emerging field of science: Tissue engineering,which combines the state of the
In the last decade of the 20 th century, special emphasis was put on an emerging field of science: Tissue engineering,which combines the state of the art materials science with concepts from the life sciences.
More informationCan the lung be repaired in emphysema?
Can the lung be repaired in emphysema? Irina Petrache, MD National Jewish Health and University of Colorado Denver, CO Funding: Disclosures: Scientific founder Allinaire- no conflict with the contents
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationTumor Microenvironment and Immune Suppression
Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation
More informationBiomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest
More informationAllergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 19: Tolerance, Autoimmunity, and Autoinflammation Prepared
More informationROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret
ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as
More informationACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
More informationHematopoietic Stem Cells, Stem Cell Processing, and Transplantation
Hematopoietic Stem Cells, Stem Cell Processing, and Joseph (Yossi) Schwartz, M irector, Hemotherapy and Stem Cell Processing Facility Bone Marrow Can Cure: Leukemia Lymphoma Multiple Myeloma Genetic iseases:
More informationInnate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin
Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive
More informationCell therapeutics for the Insulin-Dependent Diabetes Mellitus
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic
More informationPhD THESIS Epigenetic mechanisms involved in stem cell differentiation
Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:
More informationMechanisms of hepatic fibrogenesis in chronic liver disease
Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)
More information