Index. Adv Biochem Eng Biotechnol (2013) 130: DOI: / Ó Springer-Verlag Berlin Heidelberg 2013

Size: px
Start display at page:

Download "Index. Adv Biochem Eng Biotechnol (2013) 130: DOI: / Ó Springer-Verlag Berlin Heidelberg 2013"

Transcription

1 Adv Biochem Eng Biotechnol (2013) 130: DOI: / Ó Springer-Verlag Berlin Heidelberg 2013 Index A Acute lung injury (ALI), 105, 113 endotoxin-induced, 45 Acute respiratory distress syndrome (ARDS), 113 Adhesion, 175, 218, 278 molecules, 4, 11, 23, 135, 201, 223, 279 proteins, 223 receptors, 23 Adipocytes, 269 Adipose-derived stromal cell (ADSC), 56, 89, 93, 278 Adipose stromal cells (ASC), 56, 163, 278 Adipose tissue, 110, 267 Adult progenitor cells, 39, 43 Advanced therapy medicinal products (ATMP), 287 Alloderm (ADM), 50 Allodynia, Allogeneic hematopoietic stem cell transplantation (allo-hsct), 131, 132 Allotransplantation, 55 Alveolar bone proper-derived stem cell, 89 Amniotic fluid, 136, 267, 272 Anaphylatoxin C3a, 26 Angiogenesis, 240 Angiogenic factors, 4 Antiapoptotic factors, 4, 111, 240 Anti-inflammatory, 163 Apoptosis, 6, 31, 48, 59, 75, , 215, 242 Asthma, 40, 119 Autologous chondrocyte transplantation (ACT), 78 Azathioprine, 49 B Bifrons, 245 Bioactive factors, 163 Bioartificial liver devices (BAL), 6 Bone marrow, 26, 109, 115, 132, 163, 276 cells, harvesting, 75 mononuclear cells (BMNCs), 47 stromal cells, 78, 89, 147 stromal stem cells (BMSSCs), 92, 163 Bone morphogenic proteins (BMP), 71, 76, 79, 270 Bone regeneration, 69 Bortezomib, 244 Bronchial asthma, 119 Burns, 55 C C-reactive protein (CRP), 47 Calcium sulphate, 72 Carboxyesterase, 244 Carcinoma-associated fibroblasts (CAF), 228 Cartilage regeneration/repair, 2, 69, 78 CD44, 23, 91, 280 CD73, 91, 98, 108, 111, 137, 176, 234, 268, 280 CD90, 91, 97, 108, 111, 137, 176, 234, 268, 280 CD105 (endogline), 91, 97, 108, 111, 137, 176, 234, 268, 280 CD146, 268 CD166, 268 CD271, 268 Cell reprogramming, 44 Cell therapy, 39, 41

2 306 Index Cell transplantation, 1 Cell-based therapies (CBTs), 163 Chemokines, 5, 27, 79, 136, 163, 244 Chondroblasts, 269 Chronic obstructive pulmonary disease (COPD), 40, 46, 49, 105, 115 Clinical Trials Facilitation Group (CTFG), 295 Collagen, 4, 21, 49, 93, 96, 118, 182, 186, 221, 237 Colony-forming unit-fibroblast (CFU-F), 26, 59, 107 Composites, 72 Connective tissue injuries, 2 Cord blood, 267 Crohn s disease, 5 CX3CL1, 244 CXCR4, 23 Cyclosporine, 4, 49 Cystic fibrosis (CF), 105, 115 transmembrane conductance regulator (CFTR), 116 Cytokines, 4, 163, 214 Cytosine deaminase, 244 Cytoskeleton, 4 D Danger/stress responses, 163 Dendritic cells (DCs), 199, 201 cytoskeleton rearrangement, 199 differentiation, 199 maturation, 199 phenotype, 199 tolerogenic, 199 Dental follicle stem cells (DFSCs), 89, 94 Dental pulp stem cells (DPSCs), 89, 93 Dentine matrix protein 1 (DMP1), 92 Dentine sialophosphoprotein (DSPP), 92 Dexamethasone, 76 Dickkopf-related protein-1 (DKK-1), 74, 77, 242 DNA methyltransferase inhibitors, 8 E Endothelial cells, 227, 232 Endothelial nitric oxide synthase (enos), 48, 113 Endothelial progenitor cells (EPCs), 47 Endothelial to mesenchymal transition (EndMT), 231 Endothelin binding receptor (ETBR), 228 European Directorate for the Quality of Medicines and HealthCare (EDQM), 293 Ewing sarcomas, 30 Extracellular matrix (ECM) proteins, 97, 169, 177, 183, 213, 221 F Fat grafting, 55 Fibronectins, 4, 182, 221, 237 Fluorescence-assisted cell sorting (FACS), 58 5-Fluorocytosine (5-FC), 244 G Galectin-1, 137 Ganciclovir, 30 Gene therapy medicinal products, 289 Gingival stem cells, 89, 97 Good manufacturing practice (GMP), 295 Graft-versus-host disease (GvHD), 4, 131, 133, 275 Graft-versus-leukemia (GvL) reaction, 133 Growth factors, 74, 214 GTPase, 11 Guideline on Human Cell-Based Medicinal Products, 296 H Hematopoietic disorders, 131 Hematopoietic stem cells (HSC), 43, 132, 163, 273 transplantation (HSCT), 199 Hemoxygenase-1 (HO-1), 201 Hepatocyte growth factor (HGF), 137, 214 Histone deacetylase inhibitors, 8 Homing, 19 Human embryonic stem cells (ESCs), 7, 42 Human ipsc-derived MSCs (hipsc-mscs), 9 Human leukocyte antigens, 137, 269 HLA-II, 269 HLA-G, 137 Hurler syndrome, 27 Hydroxyapatite, 72 Hypopharyngeal carcinoma, 50 I Idiopathic pulmonary arterial hypertension (IPAH), 47, 49

3 Index 307 Idiopathic pulmonary fibrosis (IPF), 105, Immune response, 163 Immune synapse, 199 Immunodeficiencies, 131 Immunomodulation, 163 Immunosuppression, 131, 163 Indoleamine-2,3-dioxygenase (IDO), 11, 32, 137, 174, 176, 201 Induced pluripotent stem cells (ips), 1, 39, 166, 267, 271 Inflammation, 27 Inflammatory bowel diseases (IBD), 1, 5 Instant blood-mediated inflammatory reaction (IBMIR), 26 Integrins, 4, 23, 222 Interferons (IFNs), 163 IFN-c, 11, 215 Interleukins (ILs), 5, 163, 237 IL-1b, 215 IL-2, 5, 150, 218, 244 IL-6, 32, 48, 74, 137, 189, 201, 205, 216, 228, 236 IL-8, 216, 228, 238 IL-10, 6, 23, 32, 114, 137, 189, 202, 216 IL-12, 5, 30, 137, 203, 215, 226, 244 Intravenous injection, 19 Irradiation, 27 Ischemia, 27 J Janus Bifrons, 245 L LacZ (B16-LacZ), 30 Laminins, 223 Leukemia, 4, 41, 131, 137, 183, 187 inhibitory factor (LIF), 137, 174, 239 Lewis lung carcinoma (LLC), 30 Lipofilling, 55 Lipopolysaccharide (LPS), 202 Liver, diseases, 1 regeneration, 6 Long-bone defects, 77 Lung cancer, 40 Lung disease, 105 chronic, 105, 115 Lung tissue, engineered, 120 Lymphocytes, 225 M Macrophages, 225 Matrix extracellular phosphoglycoprotein (MEPE), 95 Matrix metalloproteinases (MMPs), 4, 25, 213, 219 Mesenchymal stem cells (MSCs), 1, 19, 55, 89, 105 adipose tissue, 277 adult, 267, 275 anti-tumor efficacy, 30 bone marrow, 276 foetal-derived, 272 isolation/tracing, 58 licensing, 199 mediated immunosuppression, 199 multipotent stromal or mesenchymal stem cell, 163 neonatal-derived, 273 placental, 273 therapeutic applications, 267 tumor-engrafted, 30 Mesenchymal stromal cells, 1, 19, 43 clinical grade, 131 Metachromatic leukodystrophy, 27 Methotrexate, 4 Microenvironment, 209 Mitogenic factors, 4 MSC1, pro-inflammatory MSC phenotype, 163 MSC2, anti-inflammatory MSC phenotype, 163 Myeloid-derived suppressor cells (MDSCs), 213, 226 N National Competent Authorities (NCAs), 292 Nestin, 94, 96, 147, 302 Notch 1/2, 94, 199, 206, 232 O Osteoblasts, 21, 71, 91, 94, 97, 107, 136, 147, 174, 219, 269, 271 Osteocalcin, 93, 96 Osteochondral defects, 83 Osteogenic cells, 70, 73, 270, 276 Osteogenic deficiencies, 2 Osteopontin, 93, 96

4 308 Index P Paclitaxel, 31 Patient-specific pluripotent stem cells, 7 Pax-9, 92 Pectoralis major myocutaneous flaps (PMMFs), 50 Periodontal ligament stem cells (PDLSCs), 89, 96 Periodontium, 89 Placenta stem cells, 273 Plasminogen activator inhibitor, 220 Plastic surgery, 55, 56 Platelet-derived growth factor (PDGF), 217 Pluripotent stem cells, 7 induced (ipscs), 44 Processed lipoaspirate (PLA) cells, 278 Pro-inflammatory, 163 Prostaglandins, 23, 32, 114, 137, 174, 199, 201, 239 Proteasome inhibitors, 244 Proteolytic enzymes, 219 Pro-tumorigenic effects, 30 Pulmonary hypertension (PH), 40, 47, 120 Pulmonary vascular disease, 120 R Radiation injury, 55 Radiation-induced lung injury, 48 Rap1, 11 Reactive oxygen species (ROS), 224, 227 Reconstructive surgery, 55 Regulatory framework, 287 Reprogramming, 45 Respiratory diseases, 39 Rosiglitazone, 62 S Scaffolds, 71 Scar repair, 55 Selectins, 23, 27 Serine protease plasmin, 220 Somatic cell nuclear transfer (SCNT), 7 Somatic cell therapy medicinal products, 289 Stanniocalcin-1 (STC1), 224 Stem cells, alveolar bone proper-derived, 97 amniotic fluid, 272 apical papilla (SCAP), 89, 95 banks, 76 cord blood, 274 dental pulp, 89 embryonic (ESCs), 3, 7, 39, 42, 95, 108, 166, 224, 270, 293 gingival, 97 hematopoietic (HSC), 273 human exfoliated deciduous teeth (SHEDs), 89, 95 induced pluripotent (ips), 271 multipotent, 105 periodontal ligament (PDLSCs), 89, 96 placental, 273 Stirred suspension bioreactors (SSBs), 10 STRO-1, 91 97, 111, 278, 302 Stromal derived factor-1 (SDF-1), 217 Stromal vascular fraction (SVF), 56, 59, 277 Suicide genes, 244 Surface markers, 3 T TAT (thrombin-anti-thrombin complex), 26 Tenascin-C, 223 Therapy, 19, 62 Thizolinedione (TZD), 62 Thymidine kinase, 244 Tissue engineered products (TEPs), 288, 289 Tissue engineering, 45, 55, 76, 93, 120, 270 Tissue inhibitor of metalloproteinases (TIMPs), 213, 220 Tissue scaffold, 50 Toll-like receptors, 163 Trachea, bioengineered, 51 Transcription factors, 7 Transforming growth factors (TGF), 9, 74, 79, 95, 137, 174, 201, 215, 217, 302 Transplants/transplantation, 19, 287 Treg cells, 199 Tumor, 29 microenvironment, 214 stroma, 109 Tumor-associated fibroblasts (TAF), 209, 228 Tumor-associated macrophages (TAM), 226 Tumor necrosis factor (TNF), 5, 24, 135, 176, 202, 216, 218 Tumor necrosis factor-related apoptosisinducing ligand (TRAIL), 209, 244

5 Index 309 U Ulcerative colitis, 5 Umbilical cord stem cells (UCSCs), 4, 76, 110, 133 Unrestricted somatic stem cells, 199 Urokinase plasminogen activator (upa), 220 V Vascular cell adhesion molecule (VCAM), 24, 93, 206, 268 Vascular endothelial growth factor (VEGF), 4, 47, 60, 74, 113, 216, 219, 238 W Warburg effect, 223 Wound healing, 55 X Xenografts, 3

Mesenchymal Stem Cells

Mesenchymal Stem Cells Mesenchymal Stem Cells Science and therapeutic applications Dirk Büscher (Former VP-R&D Cellerix) GRIFOLS SA May 10 th, 2010 EMA 1 Discovery and Definition of Mesenchymal Stem Cells MSC must be plastic-adherent

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

Index. Note: Page numbers of article titles are in boldface type.

Index. Note: Page numbers of article titles are in boldface type. Index Note: Page numbers of article titles are in boldface type. A Alginate, tooth-shaped, for constructs, encapsulated pulp cells in, 589 590 Antibiotic paste, triple, change in root length and width

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science

Tissue renewal and Repair. Nisamanee Charoenchon, PhD   Department of Pathobiology, Faculty of Science Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration

More information

STEM CELLS. Dr Mohammad Ashfaq Konchwalla Consultant Orthopaedic Sports Surgeon

STEM CELLS. Dr Mohammad Ashfaq Konchwalla Consultant Orthopaedic Sports Surgeon STEM CELLS Dr Mohammad Ashfaq Konchwalla Consultant Orthopaedic Sports Surgeon www.dubaisportssurgery.com PRACTICE SAUDI GERMAN HOSPITAL, DUBAI MEDCARE HOSPITAL, DUBAI Totipotent cells are cells that can

More information

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Cell Therapy 2014 Las Vegas, NV, USA Sulaiman Al-Hashmi, PhD Sultan Qaboos University Oman What are MSCs? Stem

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Stem Cells and Sport Medicine

Stem Cells and Sport Medicine Stem Cells and Sport Medicine Rehal Abbas Bhojani, MD CAQSM Memorial Hermann Medical Group 2014 Sports Medicine Symposium of the Americas Stem cell biology Overview Potential applications of stem cells

More information

Immunological Lung Diseases

Immunological Lung Diseases Emphysema and Fibrosis Universitätsklinik für Pneumologie Prof. Thomas Geiser Head Div. of Pulmonary Medicine and Laboratory of Lung Research, MU50 thomas.geiser@insel.ch The healthy lung: The pathway

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Bases for Immunotherapy in Multiple Myeloma

Bases for Immunotherapy in Multiple Myeloma Bases for Immunotherapy in Multiple Myeloma Paola Neri, MD, PhD Associate Professor of Medicine University of Calgary, Arnie Charbonneau Cancer Institute Disclosures Paola Neri MD, PhD Grants/research

More information

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)

More information

Use of Adipose-Derived Stem Cells in Regenerative Therapy. David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas

Use of Adipose-Derived Stem Cells in Regenerative Therapy. David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas Use of Adipose-Derived Stem Cells in Regenerative Therapy David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas Use of Adipose-Derived Stem Cells in Regenerative Therapy David Euhus,

More information

Stem Cell Therapy Concept. Pleuripotent Stromal Cells 8/8/2011. Use of Adipose-Derived Stem Cells in Regenerative Therapy

Stem Cell Therapy Concept. Pleuripotent Stromal Cells 8/8/2011. Use of Adipose-Derived Stem Cells in Regenerative Therapy Use of Adipose-Derived Stem Cells in Regenerative Therapy Use of Adipose-Derived Stem Cells in Regenerative Therapy David Euhus, MD Professor of Surgery UT Southwestern Medical Center at Dallas David Euhus,

More information

Bone marrow stroma: biology and therapeutic exploitation

Bone marrow stroma: biology and therapeutic exploitation Bone marrow stroma: biology and therapeutic exploitation! Francesco Dazzi! francesco.dazzi@kcl.ac.uk Outline 1. Bone marrow stroma and the physiology of the haemopoietic niche! 2. The malignant niche:

More information

Ricardo E. Colberg, MD, RMSK. PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute

Ricardo E. Colberg, MD, RMSK. PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute Ricardo E. Colberg, MD, RMSK PM&R Sports Medicine Physician Andrews Sports Medicine and Orthopedic Center American Sports Medicine Institute Pathophysiology of chronic orthopedic injuries Definition of

More information

Characteristics of Dental Pulp Stem Cells

Characteristics of Dental Pulp Stem Cells Pharma&Biotech BioResearch Characteristics of Dental Pulp Stem Cells 15 October 2013 / Speaker: Dr. Isabella Drewelus 16 October 2013 / Speaker: Andrew Winner Lonza Walkersville, Inc., Walkersville, MD

More information

Regenerative Orthopedics

Regenerative Orthopedics Regenerative Orthopedics WHERE ARE WE NOW? W. SCOTT WAUGH, MD, CAQSM, RMSK NONOPORTHO.COM W. Scott Waugh, MD, RMSK Edmond, OK Integrative Medical Solutions and Nonop Ortho Baylor University Waco, TX University

More information

WOUND CARE UPDATE. -Commonly Used Skin Substitute Products For Wound. -Total Contact Casting. Jack W. Hutter DPM, FACFAS, C. ped.

WOUND CARE UPDATE. -Commonly Used Skin Substitute Products For Wound. -Total Contact Casting. Jack W. Hutter DPM, FACFAS, C. ped. WOUND CARE UPDATE -Commonly Used Skin Substitute Products For Wound Closure -Total Contact Casting Jack W. Hutter DPM, FACFAS, C. ped. Commonly Used Skin Substitute Products for Wound Closure why are they

More information

THE USE OF STEM CELLS IN DENTISTRY AND DEVELOPMENTS FOR THE FUTURE BY HEIDI SWINHOE RESEARCH PAPER BASED ON PATHOLOGY LECTURES AT MEDLINK 2014

THE USE OF STEM CELLS IN DENTISTRY AND DEVELOPMENTS FOR THE FUTURE BY HEIDI SWINHOE RESEARCH PAPER BASED ON PATHOLOGY LECTURES AT MEDLINK 2014 THE USE OF STEM CELLS IN DENTISTRY AND DEVELOPMENTS FOR THE FUTURE BY HEIDI SWINHOE RESEARCH PAPER BASED ON PATHOLOGY LECTURES AT MEDLINK 2014 Grade Awarded: Pass with Merit ABSTRACT Stem cells have the

More information

Characterisation of bone marrow progenitor cells in disease

Characterisation of bone marrow progenitor cells in disease Characterisation of bone marrow progenitor cells in disease A thesis submitted for the degree of Doctor of Philosophy Imperial College London Leukocyte Biology Kate Hayley Christine Gowers 2012 ~ 1 ~ Acknowledgements

More information

Stem cells. -Dr Dinesh Bhurani, MD, DM, FRCPA. Rajiv Gandhi Cancer Institute, Delhi, -Director, Department of Haematology and BMT

Stem cells. -Dr Dinesh Bhurani, MD, DM, FRCPA. Rajiv Gandhi Cancer Institute, Delhi, -Director, Department of Haematology and BMT Stem cells -Dr Dinesh Bhurani, MD, DM, FRCPA -Director, Department of Haematology and BMT Rajiv Gandhi Cancer Institute, Delhi, Flow of presentation Update on stem cell uses Haematopoietic stem cell transplantation

More information

Review Article. Dental stem cells Vashisht N 1, Vashisht D 2

Review Article. Dental stem cells Vashisht N 1, Vashisht D 2 Dental stem cells Vashisht N 1, Vashisht D 2 Review Article 1 Dr Neha Vashisht MDS, Oral Medicine and Radiology Private Practitioner, Shimla 2 Dr Divy Vashisht Senior Lecturer, Prosthodontics H P Government

More information

stem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products

stem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products stem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products Stem Cell Qualified Extracellular Matrix Proteins Stem cell research requires the finest

More information

CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.

CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins

More information

Index. endocytosis, 92 fat cells, 99 myelofibrosis, 390 nerves, 99, 100 sinuses, 90 Bone marrow fatty involution, red and yellow marrow,

Index. endocytosis, 92 fat cells, 99 myelofibrosis, 390 nerves, 99, 100 sinuses, 90 Bone marrow fatty involution, red and yellow marrow, A Adherent layer cell types, 256 adipocytes, 261 endothelial cells, 259-261 function, 262, 263 interactions, 261, 262 macrophage and epitheloid cell, 256-259 Association of hematopoiesis and bone formation,209,210

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Oncolytic Virotherapy: Targeting Cancer Stem Cells

Oncolytic Virotherapy: Targeting Cancer Stem Cells Oncolytic Virotherapy: Targeting Cancer Stem Cells Cancer Stem Cells (CSCs) or Cancer Initiating Cells (CICs) A consensus of five defining criteria has been established to affirm the existence of CICs:

More information

RSM. Indications For Use

RSM. Indications For Use NEXT GENERATION SOLUTIONS RSM PATRIOT-RSM Amniotic Allograft Membrane is a human placental-based tissue product. The membrane forms a protective covering over the wound while providing the key components

More information

Laura Smart 9/22/2011

Laura Smart 9/22/2011 Laura Smart 9/22/2011 Fibrosis is a wound healing response in which damaged regions are encapsulated by an extracellular matrix or scar. Fibrosis develops in almost all patients with chronic liver injury

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

Stem Cells : A Review

Stem Cells : A Review Stem Cells : A Review Abhijeet Alok 1, Indra Deo Singh 2, Shivani Singh 3, Mallika Kishore 4 1- Senior Lecturer, Department of Oral Medicine and Radiology, Sarjug Dental College and Mata R Devi Dental

More information

Journal Club WS 2012/13 Stefanie Nickl

Journal Club WS 2012/13 Stefanie Nickl Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,

More information

Index. neurosurgery.theclinics.com. Note: Page numbers of article titles are in boldface type.

Index. neurosurgery.theclinics.com. Note: Page numbers of article titles are in boldface type. Index Note: Page numbers of article titles are in boldface type. A A Complimentary Trial of an Immunotherapy Vaccine Against Tumor-specific EGFRvIII (ACTIVATE), 90 91 Active immunotherapy, 5 8, 96. See

More information

Cell Therapy: The Future Of Medicine?

Cell Therapy: The Future Of Medicine? Cell Therapy: The Future Of Medicine? Nada Alaaeddine, Director of Regenerative and dinflammation Lab Associate professor Faculty de Medicine, USJ Why stem cells? A Mother Cell different from all other

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Role of Inflammation in Pulmonary Hypertension

Role of Inflammation in Pulmonary Hypertension Role of Inflammation in Pulmonary Hypertension K. R. Stenmark University of Colorado Denver, USA Prominent Fibroproliferative Changes are Observed in the Lung Vasculature of Infants With Pulmonary Arterial

More information

Angiogenesis and Anti-Angiogenesis in Hematological Malignancies

Angiogenesis and Anti-Angiogenesis in Hematological Malignancies Angiogenesis and Anti-Angiogenesis in Hematological Malignancies Domenico Ribatti Angiogenesis and Anti-Angiogenesis in Hematological Malignancies 1 3 Domenico Ribatti Department of Basic Medical Sciences

More information

Tumor Associated Macrophages as a Novel Target for Cancer Therapy

Tumor Associated Macrophages as a Novel Target for Cancer Therapy Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Darwinian selection and Newtonian physics wrapped up in systems biology

Darwinian selection and Newtonian physics wrapped up in systems biology Darwinian selection and Newtonian physics wrapped up in systems biology Concept published in 1957* by Macfarland Burnet (1960 Nobel Laureate for the theory of induced immune tolerance, leading to solid

More information

EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES

EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN

More information

ASH 2011 aktualijos: MSC TPŠL gydyme. Mindaugas Stoškus VULSK HOTC MRMS

ASH 2011 aktualijos: MSC TPŠL gydyme. Mindaugas Stoškus VULSK HOTC MRMS ASH 2011 aktualijos: MSC TPŠL gydyme Mindaugas Stoškus VULSK HOTC MRMS #3042. Yukiyasu Ozawa et al. Mesenchymal Stem Cells As a Treatment for Steroid-Resistant Acute Graft Versus Host Disease (agvhd);

More information

Seeds and soil theory by Stephen Paget at the end of the XIX century.

Seeds and soil theory by Stephen Paget at the end of the XIX century. Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete

More information

Bone Marrow Stroma in Myelodysplastic Syndromes

Bone Marrow Stroma in Myelodysplastic Syndromes Bone Marrow Stroma in Myelodysplastic Syndromes Universidad de Salamanca Prof Mª M Consuelo del Cañizo Hematology Dept. University Hospital, Salamanca SPAIN Bone marrow stroma in MDS Introduction Mesenchymal

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Contribution of Interstitial Valve Cells to Aortic Valve Calcification

Contribution of Interstitial Valve Cells to Aortic Valve Calcification UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,

More information

Journal Club Semmler Lorenz

Journal Club Semmler Lorenz Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to

More information

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?

More information

Equine Regenerative Medicine. Regenerative Medicine IRAP and PRP in the Equine Athlete. Stem Cells. Stem Cells. Veterinary Medical Devices

Equine Regenerative Medicine. Regenerative Medicine IRAP and PRP in the Equine Athlete. Stem Cells. Stem Cells. Veterinary Medical Devices Equine Regenerative Medicine Regenerative Medicine IRAP and PRP in the Equine Athlete Victoria Maxwell, DVM, MBA 2018 Potomac Regional Veterinary Conference Hyatt Regency Inner Harbor Baltimore, Maryland

More information

Index Note: Page numbers of article titles are in boldface type.

Index Note: Page numbers of article titles are in boldface type. Neurosurg Clin N Am 18 (2007) 191 198 Index Note: Page numbers of article titles are in boldface type. A AC133 antigen, in brain tumor cancer cells, 32 35 Activity-based restoration therapy, for spinal

More information

Healing and Repair. Dr. Nabila Hamdi MD, PhD

Healing and Repair. Dr. Nabila Hamdi MD, PhD Healing and Repair Dr. Nabila Hamdi MD, PhD 1 ILOs Know the classification of human cells according to their ability for proliferation. Understand the mechanism of cellular regeneration. Identify the types

More information

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual

More information

Accelerate Your Research with Conversant Bio

Accelerate Your Research with Conversant Bio Accelerate Your Research with Conversant Bio 400+ Participating MDs 50+ Partner sites for tissue procurement Continuous expansion of sourcing capabilities Closely monitored chain of custody Full regulatory

More information

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr. BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:

More information

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress 3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative

More information

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

More information

Healing & Repair. Tissue Regeneration

Healing & Repair. Tissue Regeneration Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)

More information

What are stem cells? A stem cell can differentiate into any one of 220 different specialised cells in the body STEM CELLS

What are stem cells? A stem cell can differentiate into any one of 220 different specialised cells in the body STEM CELLS What are stem cells? Stem cells are often called MASTER CELLS, and form the foundation for your entire body as building blocks for the blood, immune system, tissue and organs. They can REPLICATE or REGENERATE

More information

BMTCN Review Course Basic Concepts and Indications for Transplantation How the Experts Treat Hematologic Malignancies Las Vegas, NV, March 10, 2016

BMTCN Review Course Basic Concepts and Indications for Transplantation How the Experts Treat Hematologic Malignancies Las Vegas, NV, March 10, 2016 BMTCN Review Course Basic Concepts and Indications for Transplantation How the Experts Treat Hematologic Malignancies Las Vegas, NV, March 10, 2016 David Rice, PhD, RN, NP Director, Professional Practice

More information

Use of Placental Tissue for Orthopedic Injuries: Potentials and Pitfalls. Daniel Kuebler, PhD Franciscan University of Steubenville

Use of Placental Tissue for Orthopedic Injuries: Potentials and Pitfalls. Daniel Kuebler, PhD Franciscan University of Steubenville Use of Placental Tissue for Orthopedic Injuries: Potentials and Pitfalls Daniel Kuebler, PhD Franciscan University of Steubenville Benjamin D. Smith & Daniel A. Grande. The current state of scaffolds for

More information

INFLAMMATION & REPAIR

INFLAMMATION & REPAIR INFLAMMATION & REPAIR Lecture 7 Chemical Mediators of Inflammation Winter 2013 Chelsea Martin Special thanks to Drs. Hanna and Forzan Course Outline i. Inflammation: Introduction and generalities (lecture

More information

Mesenchymal Stem Cells: Immunology and Therapeutic Benefits

Mesenchymal Stem Cells: Immunology and Therapeutic Benefits Mesenchymal Stem Cells: Immunology and Therapeutic Benefits 3 Najib El Haddad Transplantation Research Center, Brigham & Women s Hospital, Harvard Medical School USA 1. Introduction Bone marrow is a complex

More information

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet

More information

Isolation and Characterization of Multipotent Postnatal Stem Cells from the Alveolar Bone and Gingival Cervical Margin

Isolation and Characterization of Multipotent Postnatal Stem Cells from the Alveolar Bone and Gingival Cervical Margin Klinik für Zahnerhaltungskunde und Paradontologie im Universitätsklinikum Schleswig-Holstein-Campus Kiel an der Christian-Albrechts-Universität Kiel Deutschland Isolation and Characterization of Multipotent

More information

Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases

Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases 54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

Peggers Super Summaries Basic Sciences Bone

Peggers Super Summaries Basic Sciences Bone Bone Overview & Turnover BONES Function o Support o Protection o Assisting movement o Storage of minerals o Production of red blood cells from marrow Types o Cancellous o Compact with Haversian systems

More information

YUJI YAMAGUCHI Department of Geriatric and Environmental Dermatology, Nagoya City University Graduate School of Medical Sciences

YUJI YAMAGUCHI Department of Geriatric and Environmental Dermatology, Nagoya City University Graduate School of Medical Sciences Nagoya Med. J., 149 Current status of regenerative medicine through the treatment for intractable skin wounds YUJI YAMAGUCHI Department of Geriatric and Environmental Dermatology, Nagoya City University

More information

DNA vaccine, peripheral T-cell tolerance modulation 185

DNA vaccine, peripheral T-cell tolerance modulation 185 Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory

More information

BMTCN Review Course Basic Concepts and Indications for Transplantation. David Rice, PhD, RN, NP

BMTCN Review Course Basic Concepts and Indications for Transplantation. David Rice, PhD, RN, NP BMTCN Review Course Basic Concepts and Indications for Transplantation March 16, 2017 David Rice, PhD, RN, NP Director, Professional Practice and Education No disclosures Objectives Describe basic concepts

More information

Lymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017

Lymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017 Lymphoid architecture & Leukocyte recirculation Thursday Jan 26th, 2017 Topics The life of immune cells Where are they born? Where are they educated? Where do they function? How do they get there? The

More information

Inflammation in the clinic

Inflammation in the clinic Inflammation in the clinic Stephen T. Holgate MRC Clinical Professor of Immunopharmacology ILSI Europe Workshop, Seville, May 14-15 2012 The immune system acts in four general ways to ensure host defence

More information

Dr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION

Dr. Yi-chi M. Kong August 8, 2001 Benjamini. Ch. 19, Pgs Page 1 of 10 TRANSPLANTATION Benjamini. Ch. 19, Pgs 379-399 Page 1 of 10 TRANSPLANTATION I. KINDS OF GRAFTS II. RELATIONSHIPS BETWEEN DONOR AND RECIPIENT Benjamini. Ch. 19, Pgs 379-399 Page 2 of 10 II.GRAFT REJECTION IS IMMUNOLOGIC

More information

Lymphoid System: cells of the immune system. Answer Sheet

Lymphoid System: cells of the immune system. Answer Sheet Lymphoid System: cells of the immune system Answer Sheet Q1 Which areas of the lymph node have most CD3 staining? A1 Most CD3 staining is present in the paracortex (T cell areas). This is towards the outside

More information

Hematopoetic Stem Cell Therapies in TURKIYE

Hematopoetic Stem Cell Therapies in TURKIYE Hematopoetic Stem Cell Therapies in TURKIYE World Location of transplant centers participating in CIBMTR (2010) Dr. Mustafa ÇETİN Mustafa CETIN, M.D. Erciyes University Medical Faculty Kayseri-TURKIYE

More information

Cell-Derived Inflammatory Mediators

Cell-Derived Inflammatory Mediators Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,

More information

PRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer

PRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer PRP Basic Science Peter J. Moley, MD Hospital for Special Surgery October 5, 2011 Questions that this talk aims to answer 1. What is PRP? 2. What blood components are NOT in PRP? 3. What are the active

More information

The future of HSCT. John Barrett, MD, NHBLI, NIH Bethesda MD

The future of HSCT. John Barrett, MD, NHBLI, NIH Bethesda MD The future of HSCT John Barrett, MD, NHBLI, NIH Bethesda MD Transplants today Current approaches to improve SCT outcome Optimize stem cell dose and source BMT? PBSCT? Adjusting post transplant I/S to minimize

More information

Theoretical basis of bone replacement

Theoretical basis of bone replacement THE BIOLOGY OF BONE REGENERATION Theoretical basis of bone replacement Department of Oral- and Maxillofacial Surgery Semmelweis University, Budapest Role of bone tissue Maintance of calcium and phosphate

More information

CERSI MTG BALTIMORE,MD MAY 8,2013 ARNOLD I CAPLAN

CERSI MTG BALTIMORE,MD MAY 8,2013 ARNOLD I CAPLAN CERSI MTG BALTIMORE,MD MAY 8,2013 ARNOLD I CAPLAN The Science of MSCs & REGENERATIVE MEDICINE : CELL-BASED THERAPY = the NEW MEDICINE. ARNOLD I. CAPLAN, PhD Baltimore, MD May 8, 2013 Case Western Reserve

More information

Immune Reconstitution Following Hematopoietic Cell Transplant

Immune Reconstitution Following Hematopoietic Cell Transplant Immune Reconstitution Following Hematopoietic Cell Transplant Patrick J. Kiel, PharmD, BCPS, BCOP Clinical Pharmacy Specialist Indiana University Simon Cancer Center Conflicts of Interest Speaker Bureau

More information

In the last decade of the 20 th century, special emphasis was put on an emerging field of science: Tissue engineering,which combines the state of the

In the last decade of the 20 th century, special emphasis was put on an emerging field of science: Tissue engineering,which combines the state of the In the last decade of the 20 th century, special emphasis was put on an emerging field of science: Tissue engineering,which combines the state of the art materials science with concepts from the life sciences.

More information

Can the lung be repaired in emphysema?

Can the lung be repaired in emphysema? Can the lung be repaired in emphysema? Irina Petrache, MD National Jewish Health and University of Colorado Denver, CO Funding: Disclosures: Scientific founder Allinaire- no conflict with the contents

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Tumor Microenvironment and Immune Suppression

Tumor Microenvironment and Immune Suppression Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Allergy and Immunology Review Corner: Chapter 19 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 19: Tolerance, Autoimmunity, and Autoinflammation Prepared

More information

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as

More information

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation

Hematopoietic Stem Cells, Stem Cell Processing, and Transplantation Hematopoietic Stem Cells, Stem Cell Processing, and Joseph (Yossi) Schwartz, M irector, Hemotherapy and Stem Cell Processing Facility Bone Marrow Can Cure: Leukemia Lymphoma Multiple Myeloma Genetic iseases:

More information

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin

Innate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive

More information

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic

More information

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:

More information

Mechanisms of hepatic fibrogenesis in chronic liver disease

Mechanisms of hepatic fibrogenesis in chronic liver disease Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)

More information