Molecular Genetic Testing for the Diagnosis of Haematological Malignancies

Transcription

1 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Dr Anthony Bench Haemto-Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge UK

2 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Dr Anthony Bench No financial disclosure

3 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Detection and monitoring of fusion genes Detection of acquired mutations Techniques for demonstration of lymphoid clonality The future? The role of next generation sequencing methods

4 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Detection and monitoring of fusion genes Detection of acquired mutations Techniques for demonstration of lymphoid clonality The future? The role of next generation sequencing methods

5 Marker H 2 O Normal Positive Ptn 1 Ptn 2 Ptn 3 Follicular lymphoma with t(14;18); BCL2-IGH BCL MBR 3 MBR 5 mcr mcr IGH VH segments DH segments JH segments Normal BCL2-IGH positive Tube A 1353 bp 603 bp 310 bp Tube B 1353 bp 603 bp Tube C 603 bp 310 bp

6 Normal bcr1 bcr2 bcr3 Acute promyelocytic leukaemia with t(15;17); PML-RARA PML bcr3 bcr2 bcr1 RARA bcr 1 55% bcr 2 5 % bcr 3 40% (part) bp 376 bp 345 bp

7 Chronic myeloid leukaemia Detection of BCR-ABL1 t(9;22)(q34;q11.2) BCR ABL1 m-bcr M-BCR m-bcr

8 Normal e13a2 e14a2 Chronic myeloid leukaemia Detection of BCR-ABL1 e1a2 e6a2 e19a e1a e13a2 e14a2 e6a2 BCR ABL1 m-bcr M-BCR m-bcr e19a2 m-bcr E1A2 p190 M-BCR E13A2 or E14A2 p210 m-bcr E19A2 p230

9 Multiplex RT-PCR for the detection of fusion genes in leukaemia Round 1 : Two multiplex PCR tests with 5 pairs of primers Round 2 : Individual PCR identifies specific fusion transcript as CBFB- MYH11 [inv(16)/t(16;16)] Salto-Tellez et al. (2003) Copyright 2003 American Society for Investigative Pathology and Association for Molecular Pathology

10 Real time RT-PCR detection of fusion transcripts within hours RNA reverse transcription cdna Fluorescence measured

11 Chronic myeloid leukaemia Detection of BCR-ABL1 by real time RT-PCR A P C E1A2 ABL1 e1a e13a2 e14a2 E13A2/E14A2 ABL1 B P C

12 Chronic myeloid leukaemia Detection of BCR-ABL1 by real time RT-PCR e13a2 e14a2 E13A2/E14A2 ABL1 B P C E13A2/E14A2 ABL e19a2 B P C

13 Detection of MLL [KMT2A] fusions by real time PCR MLL-AF4 [KMT2A-AFF1] MLL-AF9 [KMT2A-MLLT3] MLL-ENL [KMT2A-MLLT1] Jansen et al. (2005)

14 Real time quantification of fusion transcripts within hours RNA reverse transcription cdna Fluorescence measured

15 Monitoring BCR-ABL1 levels by quantitative RT-PCR BCR-ABL1 standards BCR-ABL1 standard curve C T

16 Monitoring BCR-ABL1 levels by quantitative RT-PCR A B C T Quantity B A

17 Monitoring BCR-ABL1 levels by quantitative RT-PCR Standard curve BCR-ABL1 ABL1 Sample A BCR-ABL1 : ABL1 : Ratio : 46.0% Sample B BCR-ABL1 : 1750 ABL1 : Ratio : 3.5%

18 Ratio White blood count Monitoring of BCR-ABL1 in CML Admitted not taking medication CCR Days

19 Ratio White bood count Monitoring of BCR-ABL1 in CML Imatinib intolerant Nilotinib Months

20 BCR-ABL1 kinase domain mutation Normal Patient T to G mutation c. 1075T>G TTC to GTC p.phe359val F359V

21 Ratio White bood count Monitoring of BCR-ABL1 in CML Nilotinib Dasatinib Months

22 BCR-ABL1 monitoring in CML ELN guidelines (2013) optimal response 3 month : BCR-ABL1/ABL1 10% and/or Ph+ 35% 6 month : BCR-ABL1/ABL1 <1% and/or no Ph+ 12 month : BCR-ABL1/ABL1 0.1% (i.e. MMR) Any time after that : BCR-ABL1/ABL1 0.1% (i.e. MMR) Perform PCR every 3 months until 0.1 % then every 3-6 months

23 Monitoring BCR-ABL1 levels by quantitative RT-PCR Conversion to International standard Sample A BCR-ABL1 : ABL1 : Ratio : 46.0% Ratio (IS) : % Sample B Conversion factor : 1.48 BCR-ABL1 : 1750 ABL1 : Ratio : 3.5% Ratio (IS) : 5.18 %

24 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Detection and monitoring of fusion genes Detection of acquired mutations Techniques for demonstration of lymphoid clonality The future? The role of next generation sequencing methods

25 Acquired mutations in haematological neoplasms Single point mutations BRAF V600E JAK2 V617F KIT D816V MPL W515L/K MYD88 L265P Regional or whole gene mutations ATM ASXL1 CALR exon 9 CEBPA CSF3R DNMT3A FLT3 JAK2 exon 12 KIT exon 8 MPL exon 10 NPM1 exon 12 NOTCH1 SF3B1 SRSF2 TP53 TET2

26 Detection of acquired mutations Method Sensitivity Post PCR manipulation Allele specific PCR 1-3% + Real time allele specific PCR 0.1-1% High resolution melt analysis 1-5% Pyrosequencing 5-10% ++ Fragment analysis 5% + Sequencing 10-20% +++ Allele specific PCR based assays only applicable for individual mutations

27 Detection of acquired mutations Method Sensitivity Post PCR manipulation Allele specific PCR 1-3% + Real time allele specific PCR 0.1-1% High resolution melt analysis 1-5% Pyrosequencing 5-10% ++ Fragment analysis 5% + Sequencing 10-20% +++ Allele specific PCR based assays only applicable for individual mutations

28 H 2 O POS Normal Allele specific PCR Detection of JAK2 c.1849g>t (p.v617f) Mutant allele T Wild-type allele G control mutant Baxter et al 2005

29 Real time allele specific PCR Detection of KIT c.2447a>t (p.d816v) Mutant allele R Q R Q T T Wild type allele A R Q KIT D816V Control Kristensen et al 2011

30 Probe based allele specific PCR Detection of JAK2 c.1849g>t (p.v617f) R Q R FAM Primers LNA containing probe LNA containing blocking oligo Q BHQ1 Mutant allele R Q R Q T T Wild type allele R Q R Q G G Denys et al 2010

31 Probe based allele specific PCR Detection of JAK2 c.1849g>t (p.v617f) 10 % 5 % 1 % 0.5 % V617F Control

32 Normal Positive Normal Positive Normal Positive Normal Positive Normal Positive Allele specific PCR MPL exon 10 mutations c.1544g>t p.w515l c.1543_1544tg>aa p.w515k c.1543t>g p.w515r c.1543_1544tg>gc p.w515a c.1514g>a p.s505n

33 Detection of acquired mutations Method Sensitivity Post PCR manipulation Allele specific PCR 1-3% + Real time allele specific PCR 0.1-1% High resolution melt analysis 1-5% Pyrosequencing 5-10% ++ Fragment analysis 5% + Sequencing 10-20% +++ Allele specific PCR based assays only applicable for individual mutations

34 High resolution melt analysis

35 Relative normalised fluorescence High resolution melt analysis Melting profile (mid point of melt phase) T M Melt phase Pre melt phase (ds DNA) Post melt phase ssdna Temperature ( o C) T M = 84 o C Melting profile determined by : Fragment length : Sequence

36 Relative normalised fluorescence High resolution melt analysis Melting profile Normal Mutation (mid point of melt phase) T M Melt phase Pre melt phase (ds DNA) Post melt phase ssdna Temperature ( o C) Melting profile modified by T M = 84 o C : Fragment length : Sequence

37 Normalised fluorescence minus Normal High resolution melt analysis Difference plot Normal Mutation Temperature ( o C) T M = 84 o C

38 MPL exon 10 mutations in myeloproliferative neoplasms G G T T G C G G C G G C HRM Difference Plot W515L W515R G G A A G C G G G C G C W515K C A A C G W515A C S505N Boyd et al 2010

39 High resolution melt analysis NPM1 exon 12 mutations KIT exon 8 mutations JAK2 exon 12 mutation BRAF exon 15 V600E mutation

40 Detection of acquired mutations Method Sensitivity Post PCR manipulation Allele specific PCR 1-3% + Real time allele specific PCR 0.1-1% High resolution melt analysis 1-5% Pyrosequencing 5-10% ++ Fragment analysis 5% + Sequencing 10-20% +++ Allele specific PCR based assays only applicable for individual mutations

41 Pyrosequencing Useful for the detection of acquired mutations within an exon Prior knowledge of mutation not required Able to identify small insertions/deletions or point mutations Provides information concerning the type of mutation Provides quantification data Limit of detection c. 5 %

42 Pyrosequencing Single strand template PPi add enzymes APS Sulfurylase Polymerase add specific dntp Luciferin ATP Oxyluciferin Polymerase release PPi Luciferase Apyrase dntp degraded

43 Pyrosequencing for the detection of NPM1 exon 12 mutation intron 11 exon 12 GATCTCTGGCAGTGGAGG Wild type GATCTCTGTCTGGCAGTGGAGG GATCTCTGCATGGCAGTGGAGG GATCTCTGCCTGGCAGTGGAGG Mutation A Mutation B Mutation D

44 Pyrosequencing Mills 2010 (in Erber 2010)

45 Detection of acquired mutations Method Sensitivity Post PCR manipulation Allele specific PCR 1-3% + Real time allele specific PCR 0.1-1% High resolution melt analysis 1-5% Pyrosequencing 5-10% ++ Fragment analysis 5% + Sequencing 10-20% +++ Allele specific PCR based assays only applicable for individual mutations

46 Fragment analysis Used for the detection of mutations that result from an insertion or deletion (INDEL) Accurate separation of PCR product based on size Use agarose gel electrophoresis or polyacrylamide capillary gel electrophoresis

47 Normal PCR detection of FLT3 internal tandem duplication 10 kb ITD Mutant fragment Wild type

48 PCR detection of FLT3 internal tandem duplication 10 kb ITD Dye labelled primer Primer Wild type allele Mutant allele High mutant allele burden associated with poorer prognosis in AML Murphy et al 2003

49 CALR exon 9 mutation detection 5 nt insertion c.1154_1155insttgtc (Type 2) 3 UTR 52 nt deletion c.1092_1143del (Type 1) Dye labelled primer Primer

50 CALR exon 9 mutation detection Type 1 (c.1092_1143del) Wild type allele Mutant allele

51 CALR exon 9 mutation detection Type 2 (c.1154_1155insttgtc) Wild type allele Mutant allele

52 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Detection and monitoring of fusion genes Detection of acquired mutations Techniques for demonstration of lymphoid clonality The future? The role of next generation sequencing methods

53 Normal process of lymphoid cell development Gene rearrangement during B-cell development IGH IGK IGL Gene rearrangement during T-cell development TCRD TCRG TCRB TCRA

54 IG gene rearrangements during B- cell differentiation (simplified) Pre- B-cell Immature B-cell Mature B-cell Plasma cell Pre-pre- B-cell IGL genes rearranged (Igl+ cells) Pro- B-cell IGK genes rearranged (CK deleted in Igl+ cells) IGH class switching Lymphoid precursor IGH genes rearranged

55 TCR gene rearrangements during T- cell differentiation (simplified) Common thymocyte Mature thymocyte T-lymphocyte Immature thymocyte Prothymocyte TCRA genes rearranged (TCRab cells) TCRB genes rearranged Lymphoid precursor TCRG genes rearranged TCRD genes rearranged TCRD genes deleted (TCRab cells)

56 Secondary rearrangements Junctional fragments Trimming of ends Addition of nucleotides by TdT Somatic hypermutation of IGH locus Biallelic rearrangement TCRD lies within TCRA hence is deleted in TCRab cells

57 Demonstration of lymphoid clonality by PCR based assays Polyclonal (reactive) lymphoid cells Each cell carries a different rearrangement Clonal lymphoid cells Each cell carries the same rearrangement Clonality malignancy Pseudoclonality (false positive) Immunodeficiency Viral infections Elderly Small amount of DNA False negative Somatic hypermutation prevents primer binding Rare V domain usage

58 Detection of clonal IGH gene rearrangement (BIOMED2) Van Dongen et al 2003

59 Detection of clonal IGH gene rearrangement IGH FR1 Size range bp Polyclonal Clonal IGH FR3 Size range bp Polyclonal Clonal

60 Detection of clonal TCRG gene rearrangement (BIOMED2) Van Dongen et al 2003

61 Detection of clonal TCR gene rearrangement (BIOMED2) TCRG (Tube A) Size range bp Polyclonal Clonal TCRB (Tube B) Size range bp Polyclonal Clonal

62 Detection of clonal IGH gene rearrangement Extra information for CLL patients Productive IGHV3-23 rearrangement with 94% similarity to germline

63 IGHV mutation status in CLL Mutated <98% similarity Unmutated >98% similarity Hamblin et al 1999

64 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Detection and monitoring of fusion genes Detection of acquired mutations Techniques for demonstration of lymphoid clonality The future? The role of next generation sequencing methods

65 The role of next generation sequencing methods Whole genome sequencing 3000 Mb Whole exome sequencing 2% of genome Disease specific gene panels

66 Acquired mutations in haematological neoplasms Single point mutations BRAF V600E JAK2 V617F KIT D816V MPL W515L/K MYD88 L265P Regional or whole gene mutations ATM ASXL1 CALR exon 9 CEBPA CSF3R DNMT3A FLT3 JAK2 exon 12 KIT exon 8 MPL exon 10 NPM1 exon 12 NOTCH1 SF3B1 SRSF2 TET2 TP53

67 The role of next generation sequencing methods Library preparation Multiplex PCR Hybridisation / extension Bait hybridisation Individual Molecule Amplification Emulsion PCR Solid phase amplification

68 The role of next generation sequencing methods Sequencing Approaches Pyrosequencing detection of released H + Reversible terminators Sequencing by ligation

69 The role of next generation sequencing methods Commercially available myeloid hot spot panels Illumina extension / ligation SureSeq (OGT) bait hybridisation Thermofisher multiplex PCR

70 Next generation sequencing NPM1 exon 12 Coverage 759 reads Allele frequency 24% c.863_864instcgg Type Qm p.trp288fs

71 The role of next generation sequencing methods Karyogene Multiple baits and bespoke bioinformatics for: Mutation detection Fusion gene detection Copy number variation Copy number neutral loss of heterozygosity Tandem duplications / indels McKerrell et al 2016

72 The role of next generation sequencing methods Karyogene McKerrell et al 2016

73 The role of next generation sequencing methods Karyogene Detection of copy number changes del 5q; del 7q; del 9q; amplification 9p McKerrell et al 2016

74 The role of next generation sequencing methods Karyogene Detection of MLL [KMT2A] tandem duplication McKerrell et al 2016

75 The role of next generation sequencing methods Karyogene

76 Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Thank you for your attentıon