Expanded View Figures
|
|
- Mildred Warren
- 5 years ago
- Views:
Transcription
1 Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and Ish2 mrn with primers I9 and R4 (left), and Ish3 mrn with primers SH31 and HR1 (right) in SW620 cells. Western blots with an antibody specifically against residues of I in the indicated cells. mpty arrowheads point to unknown bands. lag-tagged I isoforms were cotransfected with H-tagged PTN into 293T cells, followed by co-ip with M2 beads. Western blots were performed for the indicated proteins. rrows point to the indicated lag-tagged I isoforms. igure V2. I regulates PTN oxidation. Western blots for recombinant PTN prepared under non-reducing or reducing condition. ox indicates oxidized protein. The recombinant PTN protein (50 ng) was preincubated with or without 2 mm H 2 O 2 for 10 min, followed by incubation with recombinant I (50 ng) in the presence of 200 lm NH at 4 for 1 h. The mixtures were prepared under non-reducing or reducing condition and blotted for the indicated proteins. ox indicates oxidized protein and re indicates the reduced band of PTN. The recombinant PTN protein (50 ng) was incubated with recombinant I or its deleted mutant INH (50 ng) in the presence of 200 lm NHat4 for 1 h. The mixtures were prepared under non-reducing or reducing condition and blotted for the indicated proteins. ox indicates oxidized protein and re indicates the reduced band of PTN. Western blots for the indicated proteins of shn- or shi-infected SW620 cells., ell lysates from shn- or shi-infected HT29 () or U145 () cells were prepared under reducing or non-reducing condition and analyzed by Western blots for the indicated proteins. Phosphorylated kt and GSK-3b in U145 cells were quantified and normalized to total kt and GSK-3b, respectively. ox indicates oxidized protein and re indicates reduced PTN. G ell lysates from P3 (left) and LNaP (right) cells with or without I knockdown were analyzed by Western blots for the indicated proteins. Phosphorylated kt and GSK-3b were quantified and normalized to total kt and GSK-3b, respectively. H, I shn- and shi#1-infected SW620 cells were treated with 50 lm H 2 O 2 for the indicated times (H) or with a gradient of H 2 O 2 (I) and subjected to Western blots for the indicated proteins under non-reducing condition. ox indicates oxidized protein and re indicates reduced PTN. J luorescence intensity of staining of shn- or shi-infected SW620 cells was analyzed by flow cytometry (left), and quantified data were shown (right). ata represent means and s.d of three independent experiments. Two-sided unpaired t-test. K SW620 cells were treated with or without 100 lm H 2 O 2 for 30 min and subjected ro immunofluorescence staining of I with re-staining of PI. Scale bar representing 20 lm. L lag-ptn-expressing SW620 cells treated with or without 100 lm H 2 O 2 were subjected to co-ip with anti-lag antibody and analyzed by Western blots for the indicated proteins. M SW620 cells were treated with 100 lm H 2 O 2 for the indicated times in the absence or presence of N (10 mm) pretreatment. Lysates were prepared under reducing or non-reducing condition and analyzed by Western blots for the indicated proteins. ox indicates oxidized protein and re indicates reduced PTN. N V-, lag-tagged PTN-WT-, and PTN-71S-expressing cells were subjected to co-ip with anti-lag antibody and analyzed by Western blots for the indicated proteins. O V-, lag-tagged PTN-WT-, and PTN-71S-transfected P3 cells were treated with 100 lm H 2 O 2 for 30 min. Lysates were prepared under reducing or nonreducing condition and analyzed by Western blots for the indicated proteins. ox indicates oxidized protein and re indicates reduced PTN. * indicates a nonspecific band. ª 2015 The uthors MO reports V1
2 MO reports Role of I in MT of cancers Shao-Ming Shen et al G H J I K L M N O igure V2. V2 MO reports ª 2015 The uthors
3 Shao-Ming Shen et al Role of I in MT of cancers MO reports igure V3. I regulates WNT/b-catenin signaling target genes. The folds of relative mrn levels of the indicated genes against shn-infected cells were quantified by quantitative real-time PR in shi#1-infected HT29 cells. Western blots for xin2 and b-actin of shn- or shi-infected SW620 cells. V, I, or Ish3 was transfected into shn- or shi-infected SW620 cells. The folds of relative mrn levels of the indicated genes against V-transfected shn cells were quantified by quantitative real-time PR. Quantitative real-time PR for mrn levels of the indicated genes in shn- or shi-infected SW620 cells with or without b-catenin knockdown. ata information: In (,, ), data represent means and s.d of three independent experiments. Twosided unpaired t-test. ª 2015 The uthors MO reports V3
4 MO reports Role of I in MT of cancers Shao-Ming Shen et al igure V4. I silence induces MT in cancer cells and correlation between I and -cadherin in colon cancer tissues., The morphology (left, scale bar, 100 lm) and Western blots for the indicated proteins (right) of HT29 cells () and U145 cells (). Representative IH images of two cases of colon cancer samples stained with I or -cadherin. Right panels show the enlarged picture of the boxed area. Pearson correlation between the IRS scores of I and -cadherin. Two-sided unpaired t-test. ox plots of -cadherin expression in colon cancer tissues from 74 subjects with low and high I expression. Horizontal lines represent the median; the bottom and top of the boxes represent the 25 th and 75 th percentiles, respectively; and the vertical bars represent the range of data. ny outliers are marked with a circle. ata was analyzed using Mann Whitney U-test. Western blots for the indicated proteins of shn- or shi-infected SW620 cells. V4 MO reports ª 2015 The uthors
5 Shao-Ming Shen et al Role of I in MT of cancers MO reports G H I J K L igure V5. ata in xenografts and cancer patients. Representative image of tumors developed in a mouse that received subcutaneous injection of shn- and shi#1-infected SW620 cells. Tumor growth curves after subcutaneous injection of shn- or shi#1-infected SW620 cells. ata represent means and s.d of five mice in each group. Western blots for the indicated proteins in subcutaneous growth derived from shn- or shi#1-infected SW620 cells. Representative images of colon tumors derived from the subcutaneous engraftments of shn- or shi#1-infected SW620 cells. olon tumors derived from the subcutaneous engraftments were sectioned and stained with hematoxylin and eosin (H&). Scale bar represents 100 lm., G Ten general metastasis-related genes as described in the text were evaluated in I knockdown () or overexpressing (G) SW620 cells. ata represent means and s.d of three independent experiments. Two-sided unpaired t-test. H Representative images show the formation of tumors by splenic injection of shn-, shi#1-, and shi#2-infected HT29 cells in the mouse. I Representative IH images of two cases of colon cancer samples. Scale bar, 100 lm. J The numbers of cases with I low and I high expression in our cohort. K, L Kaplan Meier estimates of overall survival of subjects with high and low I expressions in TG reast Invasive arcinoma (K) and TG Lung Squamous ell arcinoma (L). ª 2015 The uthors MO reports V5
Expanded View Figures
MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect
More informationExpanded View Figures
Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationAIF inhibits tumor metastasis by protecting PTEN from oxidation
Article AIF inhibits tumor metastasis by protecting PTEN from oxidation Shao-Ming Shen 1,, Meng Guo 1,, Zhong Xiong 1, Yun Yu 1, Xu-Yun Zhao 2, Fei-Fei Zhang 1 & Guo-Qiang Chen 1,3,* Abstract Apoptosis-inducing
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationPID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB
SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationSupplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationGFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationFigure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More informationSupplemental Table 1 Molecular Profile of the SCLC Cell Line Panel
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationBRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationSupporting Information
Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary
More informationSUPPLEMENTARY INFORMATION
SUPPLNTRY INFORTION OI:.8/ncb7 Torrano, Valcarcel et al. Supplementary Figure Log mrn RT Log mrn H9 p=.767 p=.8 p=.96 p=.98 p=. p=.789 p=.7 p=.67 Log mrn NOR Log mrn NRIP Log mrn PG H H9 KT H NRIP NOR
More informationSUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationExpanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationWilliam C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
More information