Expanded View Figures
|
|
- Pierce Baldwin
- 6 years ago
- Views:
Transcription
1 MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect on the phosphorylation of TZ on Ser89. HK293T cells were transiently transfected with H- Pals1 and Myc-LIN7 in the presence of TZ as indicated, and the cells were harvested for Western blot analysis., The PR complex components have no effects on TZ phosphorylation. H-aPK and P- PR6/ were transfected into HK293T cells, and cell lysates were harvested for Western blot analysis. Verification of PR3 sirn knockdown efficiency in 375 and T-47 cells. Samples were detected by real-time PR. The results are average SM of three independent experiments. V1 MO reports ª 2015 The uthors
2 Xian-o Lv et al PR3 dephosphorylates TZ MO reports igure V2. PR3 interacts with LTS1 and PP1. PR3 has no effect on the interaction between TZ and its kinase LTS1. HK293T cells were transfected with P-tagged TZ and L-tagged LTS1 in the presence or absence of H-PR3, and proteins were immunoprecipitated with L beads for Western blot analysis. PR3 does not affect the binding of P-TZ and its phosphatase PP1. The indicated constructs were transfected into HK293T cells, and proteins were immunoprecipitated with L beads for Western blot analysis. PR3 enhances the interaction of PP1 with endogenous LTS1. HK293T cells were transfected with L-tagged PP1 in the presence or absence of H-PR3, and proteins were immunoprecipitated with L beads for Western blot analysis., PR3 interacts with PP1 and LTS1. The indicated constructs were transfected into HK293T cells, and proteins were immunoprecipitated with L antibody. ell lysates were analyzed by Western blot as indicated. The interaction of PP1/PR3/LTS1 is regulated by cell density. H-PR3 was transfected into T-47 cells, immunoprecipitation with LTS1 antibody was performed, and the immunoprecipitated samples were used for Western blot analysis as indicated. LTS1 S909 mutant is insensitive to PR3 regulation. WT and S909 were cotransfected into LTS1/2 KO 293 cells with H-TZ. Western blot analysis was performed as indicated. ª 2015 The uthors MO reports V2
3 MO reports PR3 dephosphorylates TZ Xian-o Lv et al igure V3. Phosphorylation of PR3 at Ser144/Ser873 diminishes TZ dephosphorylation. S144 and S873 of PR3 diminish phosphorylation of TZ at Ser89. The indicated constructs were cotransfected with L-TZ into HK293T cells. Western blot analysis was performed as indicated. Immunofluorescence localization of PR3 WT, 2S mutant, and 2S mutant. MK cells stably expressing WT, 2S, or 2S of PR3 were stained with H antibody. The quantification is shown below. 2S mutant but not the WT and 2S mutant of PR3 decreases interaction between PP1 and endogenous LTS1. The indicated constructs were transfected into HK293T cells, and proteins were immunoprecipitated with L antibody. ell lysates were analyzed by Western blot. Wild type and 2S but not 2S mutant of PR3 increases the interaction between L-PP1 and endogenous LTS1. The indicated constructs were transfected into HK293T cells, and proteins were immunoprecipitated with L antibody. ell lysates were analyzed by Western blot as indicated. PR1 induces TZ dephosphorylation at Ser89. HK293T cells were transiently transfected with H-PR1 and L-TZ, and the cells were harvested for Western blot analysis. Knockdown of PR1 increases the phosphorylation of TZ and inhibits the expression of T. 293T cells were transfected with sirn targeting PR1, the phosphorylation of TZ was detected by Western blot, and the expression of T was detected using real-time PR. Knockdown of PR1 but not PR3 decreases the phosphorylation of MST1/2 at Thr183/180. T-47 cells were transfected with the indicated sirns, and cells were harvested at high density for Western blot analysis. The knockdown efficiencies were determined by real-time PR on the right. Knockdown of PR1 increases the phosphorylation of MST1/2 at Thr183/180 slightly. T-47 cells were transfected with the indicated sirns, and cells were harvested at low density for Western blot analysis. V3 MO reports ª 2015 The uthors
4 Xian-o Lv et al PR3 dephosphorylates TZ MO reports igure V4. (continued) ª 2015 The uthors MO reports V4
5 MO reports PR3 dephosphorylates TZ Xian-o Lv et al igure V4. Knockdown of PR3 reduces the function of YP/TZ. WT and 2S mutant, but not 2S mutant, of PR3 rescue the expression of target genes inhibited by PR3 knockdown. T-47 cells with stable knockdown and overexpression of WT and 2S and 2S mutants of PR3 were used as indicated. The expression of target genes was analyzed by real-time PR. The efficiency of endogenous PR3 knockdown is shown above, and the expression of exogenous H-PR3 was verified by Western blot. The results are average SM of three independent experiments. Knockdown of PR3 increases -cadherin expression and decreases N-cadherin expression at the mrn level in T-47 cells at low cell density. PR3-knockdown T-47 cells were analyzed by qpr. The results are average SM of three independent experiments. Knockdown of PR3 inhibits T-47 cell growth which can be rescued by overexpression of YP2-5S. The results are average SM of 3 independent experiments., Overexpression of TZ-4S () and YP2-5S () PR3-knockdown T-47 cell. It was verified by Western blot and real-time PR. Knocking down TZ inhibits the growth of T-47 cells overexpressing PR3. rowth curves of TZ knockdown T-47 cells overexpressing PR3 were determined. ell lysates were analyzed by Western blot to verify H-PR3 and TZ expression. The results are average SM of 3 independent experiments. WT and 2S mutant, but not 2S mutant, of PR3 rescue colony formation inhibited by PR3 knockdown. T-47 stable cell lines ( cells) were cultured in 6-well plates for 3 weeks. olonies were visualized by crystal violet staining and counted. The results are average SM of three independent experiments. **P < V5 MO reports ª 2015 The uthors
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationExpanded View Figures
Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationWilliam C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationMyelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity
Manuscript EMBO-2010-76298 Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Yuki Fujita, Shota Endo, Toshiyuki Takai and Toshihide Yamashita Corresponding author: Toshihide
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationNature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationProtein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma
Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP thus showing therapeutic potential in colorectal carcinoma Hao-Wei Teng, Man-Hsin Hung, Li-Ju Chen, Mao-Ju Chang, Feng-Shu Hsieh, Ming-Hsien Tsai,
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary Figure Legends Supplementary Figure S1. Aurora-A is essential for SAC establishment in early mitosis. (a-c) RPE cells were treated with DMSO (a), MLN8237 (b) or BI2536 (c) for Two hours.
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationSupplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
More informationSupporting Information
Supporting Information ou et al..73/pnas.08791112 dd Thymidine Release & transfection dd Thymidine Release dd MG132 Fix and IF -14 h 0 h 8 h 24 h 34 h 36 h siontrol simps1-1 simps1-1 simps1-1 simps1-2
More informationeffects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
More informationAppendix. Table of Contents
Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationInhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
More informationThe clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationSUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationDifferential roles of ERRFI1 in EGFR and AKT pathway regulation affect cancer proliferation
rticle Differential roles of ERRFI1 in EGFR and KT pathway regulation affect cancer proliferation Junmei airns 1 Liewei Wang 1,*, rooke L Fridley 2,3, Gregory D Jenkins 2, Yongxian Zhuang 1, Jia Yu 1 &
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationCA Tel.: ; Fax: ; ucsd.edu.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 10, pp. 6300 6311, March 7, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. The Phosphatase PHLPP
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More information(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
More informationTITLE: Pim Protein Kinase-Levels Correlate with Prostate Tumor Growth and Chemo Resistance-Potential Mechanisms
AD Award Number: W81XWH-05-1-0126 TITLE: Pim Protein Kinase-Levels Correlate with Prostate Tumor Growth and Chemo Resistance-Potential Mechanisms PRINCIPAL INVESTIGATOR: Andrew Kraft, M.D. CONTRACTING
More informationSupplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
More informationFAM83H and casein kinase I regulate the organization of. the keratin cytoskeleton and formation of desmosomes
FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes Takahisa Kuga, Mitsuho Sasaki, Toshinari Mikami, Yasuo Miake, Jun Adachi, Maiko Shimizu, Youhei
More informationGankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells
Research article Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells Jiang-Hong Man, Bing Liang, Yue-Xi Gu, Tao Zhou, Ai-Ling Li,
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationHipk2 and PP1c Cooperate to Maintain Dvl Protein Levels Required for Wnt Signal Transduction
Cell Reports Article Hipk2 and PP1c Cooperate to Maintain Dvl Protein Levels Required for Wnt Signal Transduction Nobuyuki Shimizu, 1 Shizuka Ishitani, 1 Atsushi Sato, 2 Hiroshi Shibuya, 2 and Tohru Ishitani
More informationIncorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationSupplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationA post-translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
rticle post-translational modification switch controls coactivator function of histone methyltransferases G9a and GLP oralie Poulard, anielle ittencourt, ai-ying Wu Michael R Stallcup *, Yixin Hu, aniel
More informationProblem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.10/nature10195 NCBI gene: Tagged Subunit(s: HA-Vpx; FLAG-Cul4 HA-DCAF1 FLAG-Cul4 HA-FLAG-Vpx Mock Vpx (SIVmac 100 (a ; 0.159 (b ; 0.05 DCAF1 DDB1 DDA1 Cul4A 1; 0.024591
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationPhosphorylation regulates the Star-PAP-PIPKI interaction and directs specificity toward mrna targets
Published online 2 July 2015 Nucleic Acids Research, 2015, Vol. 43, No. 14 7005 7020 doi: 10.1093/nar/gkv676 Phosphorylation regulates the Star-PAP-PIPKI interaction and directs specificity toward mrna
More informationTable S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationFig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
More informationsupplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
More informationPhosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J.
UvA-DARE (Digital Academic Repository) Phosphoinositides and lipid kinases in oxidative stress signalling and cancer Keune, W.J. Link to publication Citation for published version (APA): Keune, W. J. H.
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationNMDAR-dependent Argonaute 2 phosphorylation regulates mirna activity and dendritic spine plasticity
Article NMDAR-dependent Argonaute 2 phosphorylation regulates mirna activity and dendritic spine plasticity Dipen Rajgor 1, Thomas M Sanderson 2, Mascia Amici 2, Graham L Collingridge 2,3,4 & Jonathan
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More information