Supplementary information

Size: px
Start display at page:

Download "Supplementary information"

Transcription

1 Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu, Tingting Pan, Jieliang Chen, Min Wu, Xiaohui Zhou, and Zhenghong Yuan * * Corresponding author: Zhenghong Yuan, zhyuan@shaphc.org, Telephone: , Fax:

2 Supplementary Figure 1 Supplementary Figure 1. LNPCs contribute to the antiviral activity of IFN-α against HBV (a) Schematic of the transwell co-culture model with macrophages, LSECs, or HepG2 cells in the top well and HepG cells in the bottom well. A porous (0.4-μm) membrane allows transfer of exosomes but precludes direct cell contact. (b) Southern blot analysis of secreted enveloped viral DNA (top) and intracellular viral replicative DNA (bottom) from HepG cells co-cultured with THP-1-derived macrophages or LSECs at the indicated ratio in a Transwell co-culture system with or without stimulation with 1,000 U/ml IFN-α for 48 h. (c) Fluorescence confocal microscopy images of the indicated cells that were stimulated with or without 1000 U/ml IFN-α for 12 h and then stained by a rabbit 2

3 anti-stat1 antibody and an Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody (green) and DAPI. The nuclei were counter-stained with DAPI (blue). (d) Luciferase assay of ISRE promoter activity in the indicated cells that were transduced with lentiviral vectors expressing scrambled or STAT1 shrna, followed by treatement with or without 1,000 U/ml IFN-α for 36 h. (e) Luciferase assay of the indicated cells from mice that were hydrodynamically injected with CMV promoter- or liver cell type-specific promoter-driven luciferase expression plasmids (10 μg each), together with 1 μg of prl-tk (internal control) for 48 h. (f) Fluorescence confocal microscopy images of macrophages stained with a fluorescent anti-f4/80 antibody in the livers of mice that were or were not administrated BMDMs 48 h after treatment with or without liposomal clodronate for an additional 72 h. The data are the mean ± standard error of the mean (SEM) from two independent experiments (d, e). For the image panels, representative images from one (e) or two (b, c) independent experiments are presented. **p < 0.01 (Student s t-test). The numbers below panels represent relative intensities. MΦ, macrophage; RC, HBV relaxed circular DNA; SS, HBV single-stranded DNA. 3

4 Supplementary Figure 2 Supplementary Figure 2. Exosome biogenesis is required for the cell-to-cell transfer of IFN-α-induced anti-hbv activity in vitro (a) Bradford assay of the total amount of proteins (top) and immunoblot analysis of the expression of exosomal proteins CD63 and LAMP2 (bottom) in purified exosomes from the cell culture supernatants of LSECs that were treated with the indicated amounts of the exosome release inhibitors GW4869 or spiroepoxide or with control vehicle (DMSO) for 48 h. (b) Southern blot analysis of the secreted enveloped viral DNA (top) and intracellular viral replicative DNA (bottom) from HepG cells that were co-cultured with LSECs and treated with an exosome release inhibitor as in a or with an inhibitor of shedding vesicle release (imipramine, 10 μm) or of apoptotic body release (DEVD, 60 μm). The HepG cells were then exposed to 1,000 U/ml IFN-α for 48 h. 4

5 (c) Bradford assay of the total amount of protein in purified exosomes (top) and immunoblot analysis of nsmase2 and β-actin (loading control) expression in cell lysates and of CD63 and LAMP2 expression in purified exosomes (bottom) from LSECs that were transduced with scrambled or nsmase2 shrna and with or without sirna-resistant nsmase2 cdna. (d) Southern blot analysis of HBV replication and production in HepG cells co-cultured with LSECs that were transduced with lentiviral vectors as in c, followed by treatment with or without 1,000 U/ml IFN-α for 48 h. (e) Evaluation of the amount of exosomes from LSECs that were transduced with scrambled or Rab27a shrna and with or without sirna-resistant Rab27a cdna, as described in c. (f) Evaluation of HBV replication and production in HepG cells co-cultured with LSECs that were transduced with lentiviral vectors as described in e, followed by treatment with or without 1,000 U/ml IFN-α for 48 h. The data are the mean ± SEM from two (c, e) or three (a) independent experiments. For the image panels, representative images from two (c-f) or three (a, b) independent experiments are presented. *p < 0.05, **p < 0.01 (Student s t-test). 5

6 Supplementary Figure 3 Supplementary Figure 3. Exosomes are mediator of the transfer of IFN-α-induced antiviral response in vitro (a) Southern blot analysis of the secreted enveloped viral DNA (top) and intracellular viral replicative DNA (middle) from HepG cells cultured with IFN-α-treated or untreated, LSEC-derived cell culture supernatants that had been incubated with biotinylated antibodies against CD63 or a control IgG and immunodepleted using streptavidin beads. An immunoblot analysis of the CD63 immunoprecipitate for the exosomal protein LAMP2 is also included (bottom). (b) Electron microscopy of the purified exosomes from IFN-α-treated or untreated LSECs. The scale bar represents 100 nm. (c) Comparison of exosome and non-exosome markers in exosomes (5 μg/well) prepared from IFN-α-treated or untreated LSECs and in the corresponding whole-cell 6

7 lysates (15 μg/well, intracell) by immunoblot analysis using a range of antibodies, as indicated. (d) Analysis of density of exosomes prepared from IFN-α-treated or untreated LSECs by probing for exosomal proteins (LAMP2 and β-actin) in fractions from a sucrose gradient ultracentrifugation. (e) Northern blot analysis of viral RNAs (top) and Southern blot analysis of the intracellular viral replicative DNA (middle) and secreted enveloped viral DNA (bottom) from HepG cells that were treated with an increasing concentration of exosomes (μg/ml) from IFN-α-stimulated LSECs for 48 h. (f) Antiviral activity of the cell culture supernatants of IFN-α-treated LSECs and the indicated pellets and final supernatant (top and middle) from the sequential centrifugation of equivalent cell culture supernatants of IFN-α-treated LSECs at 300 g for 10 min, 2,000 g for 10 min, 10,000 g for 30 min, and 100,000 g for 70 min. An immunoblot analysis of aliquots for the exosomal protein LAMP2 is also included (bottom). Representative images from two (a, d, f) or three (b, c, e) independent experiments are presented. 3.5 kb, HBV pregenomic RNA; 2.4 kb, HBV pre-s1/s RNA; 2.1 kb, HBV pre-s2/s RNA; RC, HBV relaxed circular DNA; SS, HBV single-stranded DNA. 7

8 Supplementary Figure 4 Supplementary Figure 4. Effects of exosomes from LNPCs on HCV replication (a, b) Immunoblot analysis of expression of viral proteins NS3, NS5A and core (a) and qrt-pcr analysis of viral RNA levels (b) in Huh7 HCV subgenomic replicon cells that were treated with 5 μg/ml exosomes from IFN-α-treated or untreated macrophages and LSECs for 48 h. (c, d) Luciferase assay of the cell culture supernatants (c) and immunoblot analysis of expression of viral proteins NS3 and core in cell lysates (d) from Huh7.5 cells that were infected with a cell culture infectious virus (HCVcc) expressing a secreted Gaussia luciferase reporter, followed by treatment with exosomes, as described in a, b. (e, f) The cell apoptosis (e) and cell viability (f) of the Huh7 cells treated with exosomes, as described in a, b, were determined by measuring the PARP-1 cleavage and by the CCK-8 cell viability assay, respectively. The data are the mean ± SEM from two independent experiments (b, c, f). For the 8

9 image panels, representative images from two independent experiments are presented (a, d, e). **p < 0.01 (Student s t-test). 9

10 Supplementary Figure 5. Supplementary Figure 5. IFN-α treatment changes the cargo contents of exosomes (a) Immunoblot analysis of APOBEC3G, PKR, and MyD88 expression in whole-cell lysates (top, 15 μg/well) and purified exosomes (bottom, 5 μg/well) from LSECs that were exposed to 1,000 U/ml IFN-α for 48 h. (b) qrt-pcr analysis of the indicated mrnas and mirnas in purified exosomes from LSECs that were exposed to 1,000 U/ml IFN-α for 48 h. The results are presented as fold change (2 -ΔΔCt ) relative to the results for the exosomes from unexposed cells. (c) Immunoblot analysis the indicated proteins and Northern blot analysis of the 10

11 indicated RNAs in fractions from a sucrose gradient ultracentrifugation of IFN-α-treated or untreated, LSEC-derived exosome preparations. (d, e) qrt-pcr analysis of the indicated mrnas and mirnas in LSECs (d) and macrophages (e) that were exposed to 1,000 U/ml IFN-α for 12 or 36 h. The results are presented as the fold change (2 -ΔΔCt ) relative to the results for the unexposed cells. (f) Immunoblot analysis of the expression of APOBEC3G (top) and PCR analysis of HBV DNA at a denaturation temperature of 94 C or 88 C (bottom) in HepG cells that were incubated with increasing amounts of exosomes from IFN-α-stimulated LSECs for 24 h. (g) Immunoblot analysis of the translation products of the indicated exosomal mrnas in HepG cells that were transfected with increasing amounts of exosomal RNA from IFN-α-stimulated LSECs for 24 h. (h) Luciferase activity of the indicated mirna seed-site reporters in HepG cells that were transfected with 0.2 μg each of the reporter plasmids and 20 ng prl-tk for 12 h and then incubated with increasing concentrations of exosomes from IFN-α-stimulated LSECs for an additional 48 h. The data are the mean ± SEM from two independent experiments (b, d, e, h). For the image panels, representative images from two independent experiments are presented (a, c, f, g). *p < 0.05, **p < 0.01 (Student s t-test). 11

12 Supplementary Figure 6. Supplementary Figure 6. Differentially expressed exosomal molecules are responsible for the exosome-mediated antiviral activity of IFN-α (a) Immunoblot analysis of APOBEC3G expression in exosomes (top) and whole-cell lysates (bottom) from LSECs that were transduced with lentiviral vectors to induce the expression of scrambled or APOBEC3G shrna. (b) Southern blot analysis of the secreted enveloped viral DNA (top) and intracellular viral replicative DNA (bottom) from HepG cells that were incubated with 5 μg/ml IFN-α-stimulated, LSEC-derived exosomes with or without APOBEC3G knockdown for 48 h. (c, d) Southern blot analysis of HBV replication and production in HepG cells that were treated with 10 μg/ml cycloheximide for 2 h (c) or transfected with the indicated mirna inhibitors at 50 nm, either alone or in combination, for 12 h (d) 12

13 before incubation with exosomes (5 μg/ml) from IFN-α-stimulated or unstimulated LSECs for an additional 24 h (c) or 48 h (d). (e) Immunoblot analysis of the intended proteins in HepG2 cells that were transfected with 4 μg of individual expression vectors for the indicated mrnas and 2 of μg phbv1.3 using an anti-myc antibody. The arrowheads indicate the position of the intended proteins. For the image panels, representative images from two (a, e) or three (b-d) independent experiments are presented. 13

14 Supplementary Figure 7. Supplementary Figure 7. IFN-α induces the cell-to-cell transfer of antiviral molecules (a) Fluorescence confocal microscopy images of HepG cells that were incubated with 5 μg/ml PKH67- or SYTO RNASelect-labeled exosomes from IFN-α-stimulated or unstimulated LSECs or with the same volume of PKH67- or SYTO RNASelect-labeled PBS, which served as a negative control, for 2 h. (b) Fluorescence confocal microscopy images of HepG cells that were treated with 5 μg/ml PKH67- or SYTO RNASelect labeled exosomes (pre-incubated with 2 μg/ml Annexin V or BSA for 2 h) from IFN-α-stimulated LSECs for 2 h. (c) Southern blot analysis of the secreted enveloped viral DNA (top) and intracellular 14

15 viral replicative DNA (bottom) from HepG cells that were treated with exosomes (5 μg/ml; pre-incubated with 2 μg/ml annexin V or BSA for 2 h) from IFN-α-stimulated or unstimulated LSECs for 48 h. (d) Immunoblot analysis of the expression of APOBEC3G in HepG cells (cultured alone or co-cultured with LSECs) and LSECs that were incubated with or without 1,000 U/ml IFN-α for 48 h in the presence or absence of 10 μm GW4869 or 2 μg/ml annexin V. (e) qrt-pcr analysis of the expression of the indicated mrnas in HepG cells and LSECs treated as described in d. The results are presented as the fold change (2 -ΔΔCt ) relative to the results for the HepG cells that were cultured alone. (f) The luciferase activity of the mirna-638 seed-site reporter in HepG cells and LSECs that were transfected with these reporters for 12 h and then treated as described in d. (g) Immunoblot analysis of APOBEC3G expression detected by an anti-gfp antibody in the purified exosomes and corresponding cell lysates of BMDMs that were transduced with a lentivirus expressing EGFP-APOBEC3G alone or in combination with a lentivirus expressing scrambled or nsmase2 shrna, followed by stimulation with or without 1,000 U of mouse IFN-α for 48 h. The data are the mean ± SEM from two independent experiments (e, f). For the image panels, representative images from two independent experiments are presented (a-d). *p < 0.05, **p < 0.01 (Student s t-test). 15

16 Supplementary Figure 8 Supplementary Figure 8. Inhibiting exosome release by Rab27a shrna weakens the antiviral activity of endogenously produced IFN-α in vivo (a, b) Determination of ALT levels (a) in the serum and MHV-A59 titers (b) in the liver and brain tissues from mice that were hydrodynamically injected with a mouse Rab27a shrna expression construct for 24 h before an injection with 5 pfu of MHV-A59 alone or in combination with IFN-α/ -neutralizing antibodies or control antibodies for an additional 48 h. (c) Bradford assay of the total amount of protein in purified exosomes (top) and immunoblot analysis of nsmase2 and β-actin expression in the tissue lysates and of LAMP2 expression in the purified exosomes (bottom) from the livers of mice that were infected with a lentivirus expressing either scrambled or mouse Rab27a shrna 16

17 (10 6 viruses/mice) by intranasal inhalation for 72 h. (d) qpcr analysis of adenovirus genome copies in the lung tissues from mice that were infected with a lentivirus expressing either the scrambled or mouse Rab27a shrna (10 6 viruses/mice) by intranasal inhalation for 24 h, followed by an intravenous injection with IFN-α/ -neutralizing antibodies or control antibodies and an intranasal infection with 10 9 pfu of MHV-A59 for an additional 72 h. The data are the mean ± SEM from two independent experiments (a-d). **p < 0.01 (Student s t-test). For the image panels, representative images from two independent experiments are presented (c). 17

18 Supplementary Figure 9 Supplementary Figure 9. The mechanistic model of exosome-mediated antiviral activity of IFN-α IFN-α induces the transfer of antiviral molecules from LNPCs to HBV-replicating hepatocytes via exosomes, which bypasses the viral inhibition of IFN-induced antiviral gene expression and results in the inhibition of HBV replication. 18

19 Supplementary Table 1. Differentially expressed mrnas and mirna in the exosomes from IFN-α-stimulated and unstimulated LSECs by microarray Table is too large to be displayed with the supplementary material and can be downloaded as an excel spreadsheet. 19

20 Supplementary Table mrnas and 3 mirnas selected for the confirmation of microarray data and antiviral activity analysis Gene symbol Gene title Genbank or mirbase accession no. Fold change P-value IFI6 Interferon alpha-inducible protein 6 NM_ ALDH3A2 TNFAIP8L2 Homo sapiens aldehyde dehydrogenase 3 family, member A2 Homo sapiens tumor necrosis factor, alpha-induced protein 8-like 2 NM_ NM_ CALHM1 Homo sapiens calcium homeostasis modulator 1 NM_ AGBL4 Homo sapiens ATP/GTP binding protein-like 4 NM_ TRAF4 Homo sapiens TNF receptor-associated factor 4 NM_ FABP5 Homo sapiens fatty acid binding protein 5 NM_ DDIT3 Homo sapiens DNA-damage-inducible transcript 3 NM_ USP20 Homo sapiens ubiquitin specific peptidase 20 NM_ IFITM1 Homo sapiens interferon induced transmembrane protein 1 NM_ GTPBP2 Homo sapiens GTP binding protein 2 NM_ hsa-mir-638 MI hsa-mir-4284 MI hsa-mir-1260 MI

21 Supplementary Table 3. Antibodies used in this study Antibody name Catalogue number Origin anti-nsmase2 sc anti-eea1 sc anti-lamp2 sc SantaCruz anti-pkr sc-707 anti-myc sc-40 anti-cd63 sc-5275 or CBL553 SantaCruz or Millipore anti-apobec3g sc or AP SantaCruz or Proteintech anti-tsg AP anti-rab27a AP anti-alix AP anti-ifi AP anti-tnfaip8l AP Proteintech anti-ddit AP anti-ifitm AP anti-alb AP anti-cytochrome C 4280S anti-stat Cell Signaling anti-phospho-stat1 (Tyr701) 9167 Technology anti-hsp anti-grp S anti-β-actin A2228 anti-myd88 SAB anti-tubulin T5168 Sigma-Aldrich anti-gfp G6539 anti-f4/80 ab6640 Abcam 21

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in Dynamic Interaction of Stress Granule, and Mediates Multiple Functions in Hepatitis C Virus Infection Véronique Pène, Qisheng Li#, Catherine Sodroski, Ching-Sheng Hsu, T. Jake Liang# Liver Diseases Branch,

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.

More information

Supplementary Information

Supplementary Information Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Nature Medicine: doi: /nm.4322

Nature Medicine: doi: /nm.4322 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1 % of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

SUPPORTING MATREALS. Methods and Materials

SUPPORTING MATREALS. Methods and Materials SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Nature Immunology: doi: /ni.3866

Nature Immunology: doi: /ni.3866 Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime

More information

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Exosomes mediate Zika virus transmission through SMPD3 neutral Sphingomyelinase in cortical neurons

Exosomes mediate Zika virus transmission through SMPD3 neutral Sphingomyelinase in cortical neurons Emerging Microbes & Infections ISSN: (Print) 2222-1751 (Online) Journal homepage: https://www.tandfonline.com/loi/temi2 Exosomes mediate Zika virus transmission through SMPD3 neutral Sphingomyelinase in

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Song et al. identified FBXW7 as a new positive regulator for RIG-Itriggered type I IFN signaling pathway. The authors observed

More information

An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration

An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration Sabrina M. Lehmann, Christina Krüger, Boyoun Park, Katja Derkow, Karen Rosenberger, Jan Baumgart, Thorsten

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing

More information

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplementary Figure 1 (Mu)

Supplementary Figure 1 (Mu) Supplementary Figure 1 (Mu) SBP (mmhg) 2 18 16 p

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1 The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information