FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Size: px
Start display at page:

Download "FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells"

Transcription

1 Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed by Western blotting with indicated antibodies. () 549 cells were infected with HSV as described in () and followed by RT-PCR to detect mrn levels. (C) MEFs were uninfected or infected with WSN viruses for 12 h, and mrn levels were analyzed by RT-PCR. (D, E) Mice intranasally infected with or without WSN for three days were sacrificed, and the mrn levels of in mouse lung (D), thymus, spleen and liver (E) were detected by RT-PCR. FIG S2 shrn-based knockdown of host RIG-I, TLR3, MD5, and viral NS1. (,, C) shrn-based knockdown of RIG-I (), TLR3 () and MD5 (C) was analyzed by RT-PCR to determine the interference efficiency. served as an internal control. (D) Shown are 549 cell lines stably expressing shrns targeting either luciferase (control) or NS cells were infected with pseudolentivirus particles produced in 293T cells co-transfected with psih-h1-gfp containing the target sequences and plasmids PLP1, PLP2 and pcl-vsvg. The cells were sorted by GFP expression with flow cytometry. FIG S3 lteration of expression significantly affects influenza virus replication. () 549 cells stably expressing the shrns targeting or luciferase were infected with WSN viruses (MOI =.1). The supernatants of cell 1

2 culture were examined for the viral titers by plaque assay (p.i. = 22 h). () 549 cells overexpressing and control cells were infected with WSN viruses as described in (). Viral titers in the supernatants of these cells were examined by plaque assay (p.i. = 22 h). P <.1 (Student s t test). FIG S4 Representative lung and thymus images showing pulmonary lesions and thymic atrophy after IV infection. Wild-type () and knockdown transgenic () mice were mock infected or infected intranasally with WSN for 3 days. Then mice were sacrificed, and the lungs and thymuses were collected. () and () are representative images from three independent experiments. FIG S5 Examination of the expression of ISGs, PKR and p58ipk. () The differentially expressed genes in 549 cells infected with or without WSN influenza virus were analyzed by cdn microarray in our previous study ( access number GSE32878). Shown are representative genes whose expressions were significantly changed. () 549 cells expressing shrns targeting or luciferase (control) were infected with or without WSN for 12 h, and then the mrn levels of Mx, ISG15, IFITM1, IFITM2 and were analyzed by RT-PCR. (C) -knockdown 549 cells and the control cells were uninfected or infected with WSN viruses for 12 h. The cells were harvested and cell extracts were prepared for Western blotting using indicated antibodies. The results are representative of three independent experiments. (D, E) shrn based 2

3 knockdown of (D) and ISG15 (E) under the condition of IFNβ treatment was analyzed by Western blotting using the antibodies as indicated. FIG S6 Effects of altering levels on the expression of and ISG15. () Western blot analysis of the lysates of knockdown 549 cells and the control cells treated with or without IFNβ (5 U/ml) for 12 h. () 293T cells were co-transfected with (.5 μg) and either Empty Vector (2.5 μg), Flag- () (2.5 μg), or Flag- (S46/S422) (2.5 μg) for 32 h. The cells were then harvested and analyzed by Western blotting using indicated antibodies. This result is representative of three identical experiments. (C) protein levels under the condition of WSN infection in Fig. 7G were quantitated by densitometry, and normalized to levels. In each experiment, level in MEFs is 1. (D) Western blotting was performed as described in the figure legend for Fig. 7G. More samples were loaded and a longer exposure time was used. (E) protein levels under the condition of WSN infection in Fig. 7H were quantitated by densitometry, and normalized to levels. In each experiment, level in the spleen of mice is 1. (F) Wild-type and knockdown transgenic mice intranasally infected with or without WSN viruses for 3 d were sacrificed, and the lungs were homogenized, followed by Western blotting using indicated antibodies. (G) protein levels under the condition of WSN infection in (F) were quantitated by densitometry, and normalized to levels. In each experiment, level in the lung of mice is 1. P <.1 (Student s t test). 3

4 Supplementary Figure S1 C HSV (h) HSV (h) HSV-gC WSN NP MEFs - + D WSN NP Lung - + E Thymus Spleen Liver WSN - +

5 Supplementary Figure S2 D sh-rig-i WSN- WSN+ F GFP C RIG-I sh-tlr3 TLR3 sh-md5 MD5 WSN- WSN- WSN+ WSN+ sh-ns1-1 sh-ns1-2

6 Supplementary Figure S3 Virus titer (1 5 PFU/ml) sh- Luciferase sh Virus titer (1 5 PFU/ml) Control pnl-

7 Supplementary Figure S4 Lung WSN(-) WSN(+) Thymus Lung WSN(-) WSN(+) Thymus

8 Supplementary Figure S5 C WSN- WSN+ WSN- WSN+ sh- PKR p58ipk MX1 ISG15 IFITM1 IFITM2 TLCD1 FEN1 OGDH PLK1 CPLX2 Up regulation 1-1 Down regulation D sh- IFNβ sh- Mx ISG15 IFITM1 IFITM2 E WSN- WSN+ sh-isg15 ISG15 IFNβ

9 Supplementary Figure S6 sh- IFNβ- IFNβ+ Empty Vector () (S46/S422) ISG15 Flag- C protein levels E protein levels G D NP F WSN- WSN WSN- WSN+ protein levels

Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome

Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome Supplementary Information Targeted disruption of influenza A virus hemagglutinin in genetically modified mice reduces viral replication and improves disease outcome Song Wang 1#, Chao Chen 1#, Zhou Yang

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

Relative activity (%) SC35M

Relative activity (%) SC35M a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection. Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4

More information

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented

More information

Article Myxoma Virus dsrna Binding Protein M029 Inhibits the Type I IFN Induced Antiviral State in a Highly Species Specific Fashion

Article Myxoma Virus dsrna Binding Protein M029 Inhibits the Type I IFN Induced Antiviral State in a Highly Species Specific Fashion Article Myxoma Virus dsrna Binding Protein M029 Inhibits the Type I IFN Induced Antiviral State in a Highly Species Specific Fashion Masmudur M. Rahman and Grant McFadden * The Biodesign Institute, Center

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28 Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Neocortex Zbtb20 / NFIA / Sox9

Neocortex Zbtb20 / NFIA / Sox9 Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

Supplementary information

Supplementary information Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared

More information

Trex1 regulates lysosomal biogenesis and interferon-independent activation of antiviral genes

Trex1 regulates lysosomal biogenesis and interferon-independent activation of antiviral genes Trex1 regulates lysosomal biogenesis and interferon-independent activation of antiviral genes Maroof Hasan 1,, James Koch 1,, Dinesh Rakheja 3, Asit K Pattnaik,, James Brugarolas 1,,7, Igor Dozmorov, Beth

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Supplementary Information

Supplementary Information Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN a ISG15 sirna Ctrl #1 #2 ISG15 conjugates IB: ISG15 Virus titer (Pfu/ml) b ISG15 sirna #2 10 7 Ctrl sirna+ifn+wt Ctrl sirna+ifn+67 10 6 ISG15 sirna+ifn+wt ISG15 sirna+ifn+67 10 5 10 4 10 3 Free ISG15 10

More information

days days and gbt-i.cd Recipient 20

days days and gbt-i.cd Recipient 20 gbt-i. GFP+ Resident memory cells: gbt-i.gfp+ Recruited memory cells: gbt-i.cd45.1+ 1 2-3 gbt-i. flu.gb sc. CD45.1+ Graft with gbt-i.gfp+ 1 Recipient 1 re- 3 36 Graft with gbt-i.gfp+ and gbt-i.cd45.1+

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

Influence of Host Cell Defence during Influenza Vaccine Production in MDCK Cells

Influence of Host Cell Defence during Influenza Vaccine Production in MDCK Cells Vaccine Technology III, 07 June 2010 Puerto Vallarta/Mexico Influence of Host Cell Defence during Influenza Vaccine Production in MDCK Cells T. Frensing 1, C. Seitz 1, B. Heynisch 2 and U. Reichl 1/2 1

More information

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation. List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

33VASTVNGATSANNHGEPPS51PADARPR58

33VASTVNGATSANNHGEPPS51PADARPR58 Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Song et al. identified FBXW7 as a new positive regulator for RIG-Itriggered type I IFN signaling pathway. The authors observed

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Follow this and additional works at: Part of the Medicine and Health Sciences Commons

Follow this and additional works at:   Part of the Medicine and Health Sciences Commons Washington University School of Medicine Digital Commons@Becker Open Access Publications 2009 Induction of IFN-beta and the innate antiviral response in myeloid cells occurs through an IPS-1-dependent

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Unité de Génétique Moléculaire des Virus Respiratoires, URA 1966 CNRS, Institut Pasteur, 25 rue du Dr. Roux, PARIS Cedex 15, France

Unité de Génétique Moléculaire des Virus Respiratoires, URA 1966 CNRS, Institut Pasteur, 25 rue du Dr. Roux, PARIS Cedex 15, France Virology 345 (2006) 73 87 www.elsevier.com/locate/yviro Recombinant influenza A viruses harboring optimized dicistronic NA segment with an extended native 5V terminal sequence: Induction of heterospecific

More information

Multifunctional Adaptive NS1 Mutations Are Selected upon Human Influenza Virus Evolution in the Mouse

Multifunctional Adaptive NS1 Mutations Are Selected upon Human Influenza Virus Evolution in the Mouse Multifunctional Adaptive NS1 Mutations Are Selected upon Human Influenza Virus Evolution in the Mouse Nicole E. Forbes 1,2, Jihui Ping 1,2, Samar K. Dankar 1,2, Jian-Jun Jia 1,2, Mohammed Selman 1,2, Liya

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils

More information

Species-Specific Inhibition of RIG-I Ubiquitination and IFN Induction by the Influenza A Virus NS1 Protein

Species-Specific Inhibition of RIG-I Ubiquitination and IFN Induction by the Influenza A Virus NS1 Protein Species-Specific Inhibition of RIG-I Ubiquitination and IFN Induction by the Influenza A Virus NS1 Protein Ricardo Rajsbaum 1,2, Randy A. Albrecht 1,2, May K. Wang 3, Natalya P. Maharaj 3, Gijs A. Versteeg

More information

Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication

Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication Manuscript EMBO-2010-74756 Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication Tsai-Ling Liao, Chung-Yi Wu, Wen-Chi Su, King-Song Jeng and Michael Lai Corresponding

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Andrea Hillesheim, Carolin Nordhoff, Yvonne Boergeling, Stephan Ludwig and Viktor Wixler *

Andrea Hillesheim, Carolin Nordhoff, Yvonne Boergeling, Stephan Ludwig and Viktor Wixler * Hillesheim et al. Cell Communication and Signaling 2014, 12:29 RESEARCH Open Access β-catenin promotes the type I IFN synthesis and the IFN-dependent signaling response but is suppressed by influenza A

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors VIROLOGY Engineering Viral Genomes: Retrovirus Vectors Viral vectors Retrovirus replicative cycle Most mammalian retroviruses use trna PRO, trna Lys3, trna Lys1,2 The partially unfolded trna is annealed

More information

Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1

Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1 Gamma-interferon-inducible, lysosome/endosome-localized thiolreductase, GILT, has anti-retroviral activity and its expression is counteracted by HIV-1 The Harvard community has made this article openly

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.10/nature10195 NCBI gene: Tagged Subunit(s: HA-Vpx; FLAG-Cul4 HA-DCAF1 FLAG-Cul4 HA-FLAG-Vpx Mock Vpx (SIVmac 100 (a ; 0.159 (b ; 0.05 DCAF1 DDB1 DDA1 Cul4A 1; 0.024591

More information

Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito

Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito Supplementary Information for: Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito Supplementary Methods Supplementary

More information

Prevention and treatment of swine-origin influenza virus with interferon: an in vivo and ex vivo study

Prevention and treatment of swine-origin influenza virus with interferon: an in vivo and ex vivo study RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Prevention and treatment of swine-origin influenza virus with interferon: an in vivo and ex vivo study JM Nicholls *, RWY Chan, E Fish K e y M e s s

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12391 Table 1. Binding of A(H7N9) viruses to individual glycan structures. # Structure a Anhui1 Shanghai1 1 Neu5Acα nb nb 2 Neu5Acα ++ nb 3 Neu5Acβ nb nb 4 Neu5Acα2-3(6-O-Su)Galβ1-4GlcNAcβ

More information

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

supplementary information

supplementary information DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

10th International Rotavirus Symposium Bangkok, Thailand

10th International Rotavirus Symposium Bangkok, Thailand Rotavirus Host Range Restriction and Innate Immunity: Mechanisms of Vaccine Attenuation Harry Greenberg MD Stanford University 10th International Rotavirus Symposium Bangkok, Thailand 09/19/12 B dsrna

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as

More information

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,

More information

on October 4, 2018 by guest

on October 4, 2018 by guest JVI Accepts, published online ahead of print on 22 December 2010 J. Virol. doi:10.1128/jvi.01531-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Differential Localization and Function of PB1-F2 Derived from Different Strains of Influenza A Virus

Differential Localization and Function of PB1-F2 Derived from Different Strains of Influenza A Virus JOURNAL OF VIROLOGY, Oct. 2010, p. 10051 10062 Vol. 84, No. 19 0022-538X/10/$12.00 doi:10.1128/jvi.00592-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. Differential Localization

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 ZV 50 nm Relative to Protein Levels () C Relative to Protein Levels () 6 4 2 0 10 8 6 4 2 0 Treatment Time (6 h) ZV Concentration (25 µm) ZV Concentration (25 µm) Supplementary Figure

More information