Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23

Size: px
Start display at page:

Download "Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23"

Transcription

1 Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity 144, 145 ACO, see Acyl-CoA oxidase Acyl-CoA carboxylase (ACC), nuclear receptor regulation of expression and food effects 28, 29 Acyl-CoA oxidase (ACO), nuclear receptor regulation of expression and food effects 31 AD, see Atopic dermatitis Adipocyte-specific triglyceride lipase (ATGL), nuclear receptor regulation of expression and food effects 30 Adiponectin, obesity-induced inflammation 99 Akt epigallocatechin gallate receptor signaling in cancer chemoprevention 159 tocotrienol effects in cancer chemoprevention 212 Allyl isothiocyanate, obesity-induced inflammation modulation 101 Angiogenesis ginger phenol effects in cancer chemoprevention 188, 189 tocotrienol inhibition in cancer chemoprevention 212 Apoptosis, cancer chemoprevention ginger phenols 187, 188 isothiocyanate induction laminin 67LR receptor in induction 164 tocotrienol induction Astaxanthin beneficial biological effects 129, 130 neuroprotection studies cell culture and viability assays 131 concentration determination in cell fractions 131 DHA hydroperoxide and 6-hydroxydopamine neurotoxicity effects cell death 133 reactive oxygen species generation 133 materials 130, 131 reactive oxygen species assay 131 structure 129, 130, 138 ATGL, see Adipocyte-specific triglyceride lipase Atopic dermatitis (AD), probiotics and prevention animal model studies cell culture studies 122, 123 overview 117, 118 primary prevention studies in humans BCAAs, see Branched-chain amino acids Bcl-2 epigallocatechin gallate receptor signaling in cancer chemoprevention 160 ginger phenol effects in cancer chemoprevention 187 isothiocyanate actions in cancer chemoprevention 175, 176 Benzyl isothiocyanate, see Isothiocyanates Bifidobacterium, see Probiotics Branched-chain amino acids (BCAAs) muscle metabolism 152 prevention of exercise-induced homeostasis disturbance

2 Cancer chemoprevention, see Epigallocatechin gallate; Ginger; Isothiocyanates; Nitric oxide synthase; Vitamin E Capsaicin, obesity-induced inflammation modulation Carnitine, sesame seed lignan effects on liver levels 12, Carnitine palmitoyl transferase-1 (CPT1) food-exercise interactions 149, 150 nuclear receptor regulation of expression and food effects 30, 31 β-carotene breakdown product analysis adenine nucleotide translocator targeting 80 formation conditions 81, 82 identification 79 mitochondria membrane potential measurements 78 preparation 77 respiration measurements 78, 79 toxicity prevention with antioxidants 83, 84 neutrophil studies degradation products 78, 79 incubation 77 overview of effects 76, 77, preparation and formation 77 sulfhydryl analysis 78, 80, 81 supplementation studies 75, 76 Carotenoids, see also specific carotenoids bioavailability and absorption breakdown products, see β-carotene functions 55, 56, marine carotenoids acetylene carotenoids and antiinflammatory activity 144, 145 antiobesity activity and structure-activity relationships antioxidant activity fucoxanthin antiobesity and antidiabetic effects 140, 141 nutrigenomics 139, 140 types and structures 137, 138 metabolism 59, 60 types and structures 55, 56 Catechins, see Epigallocatechin gallate; Flavonoids C/EBPβ, marine carotenoid effects on activity 144 Cocoa polyphenols, functional food genomics and antiobesity effects 5 COX-2, see Cyclooxygenase-2 CPT1, see Carnitine palmitoyl transferase-1 β-cryptoxanthine, peroxisome proliferatoractivated receptor expression regulation 35, 36 Curcumin inducible nitric oxide synthase suppression in cancer chemoprevention 197, 198 obesity-induced inflammation modulation 101 Cyclooxygenase-2 (COX-2), ginger phenol effects in cancer chemoprevention 185, 186 Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23 Epidermal growth factor (EGF), ginger phenol effects in cancer chemoprevention 186 EGCG, see Epigallocatechin gallate EGF, see Epidermal growth factor Epigallocatechin gallate (EGCG) bioavailability 158 cancer chemoprevention cell line and animal models 157 gene polymorphisms and risk reduction 166, 167 mechanisms of action Akt 159 Bcl extracellular signal regulated kinase 1/2 159 prospects for study 168 proteasome 158, 159 vimentin 160 overview 156, 157 inducible nitric oxide synthase suppression in cancer chemoprevention 198, 199 laminin 67LR receptor apoptosis induction role 164 cancer cell growth inhibition modulation discovery as green tea catechin receptor 161, 162 functional overview 161 signaling elongation factor 1A 165 hierarchy of signaling molecules 166 Subject Index 219

3 Epigallocatechin gallate (EGCG) (continued) myosin phosphatase targeting subunit 165, 166 metabolism 65, 66, sources 156 Equol, see Soybean isoflavones ERK1/2, see Extracellular signal regulated kinase 1/2 Exercise bone metabolism effects with soybean isoflavones 109 food factor interactions energy metabolism improvement hydration 148, 149 muscle mass 151, 152 overview 147, 148 prevention of exercise-induced homeostasis disturbance Extracellular signal regulated kinase 1/2 (ERK1/2), epigallocatechin gallate receptor signaling in cancer chemoprevention 159 FAS, see Fatty acid synthase FATPs, see Fatty acid transport proteins Fatty acid metabolism, see Lipid metabolism Fatty acid synthase (FAS), nuclear receptor regulation of expression and food effects 28, 29 Fatty acid transport proteins (FATPs), nuclear receptor regulation of expression and food effects 31, 32 Flavonoids, see also specific flavonoids antioxidant activity quercetin metabolites nerve model 90, 91 vascular system 91, 92 structure-activity relationships beneficial effects 65, 66 catechins 65 food sources 64, 65 metabolism biological activities of metabolites 71 colon 70, 71 conjugation epigallocatechin gallate 65, 66, overview 66, 67 Phase I biotransformation 67, 68 polymethoxyflavones 64 pro-oxidants 92, 93 synthesis 87 Food genomics, see also Nutrigenomics food comparison with drugs 2, 3 food safety genomics low-allergen wheat 6 neoculin sweetener 6 8 functional food genomics cocoa polyphenol and antiobesity effects 5 royal jelly and osteogenesis facilitation 5, 6 soy protein and lipid metabolism 4, 5 nutrigenomics-based evaluation of functional food 3, 4 Fucoxanthin, antiobesity and antidiabetic effects 140, 141 Functional food genomics, see Food genomics Genomics, see Food genomics; Nutrigenomics Ginger anti-inflammatory effects 185, 186 antioxidant effects 183, 184 cancer chemoprevention by phenols angiogenesis inhibition 188, 189 apoptosis 187, 188 cell growth and proliferation inhibition 187 chemosensitization 189 metastasis inhibition 188, 189 prospects for study 189, 190 tumor promotion inhibition 186 pungent phenols 183, 184 uses 183 Glyceraldehyde-3-phosphate dehydrogenase, isothiocyanate inhibition 174 Green tea, polyphenols 156, 157 HEL, see N -(Hexanonyl)lysine N -(Hexanonyl)lysine (HEL), oxidative stressinduced HMG CoA reductase, tocotrienol regulation in tumors 213 HNE, see 4-Hydroxy-2-nonenal Hormone-sensitive lipase (HSL), nuclear receptor regulation of expression and food effects 30 HSL, see Hormone-sensitive lipase 4-Hydroxy-2-nonenal (HNE), oxidative stressinduced 43, Subject Index

4 IL-6, see Interleukin-6 Interleukin-6 (IL-6), obesity-induced inflammation 98 Isoflavones, see Soybean isoflavones Isoprenols, peroxisome proliferator-activated receptor expression regulation 33 Isothiocyanates cancer chemoprevention apoptosis induction cellular stress induction 177, 178 mechanisms 172, 173 prospects for study 179 food sources 170, 171 metabolism types and structures 171 Keap1, ginger phenol effects in cancer chemoprevention 184 Lactobacillus, see Probiotics Laminin 67LR receptor, see Epigallocatechin gallate Lipid metabolism, see also Obesity-induced inflammation nuclear receptor genomics and foods diosgenin antagonism of LXRs 36 gene expression regulation acyl-coa carboxylase 28, 29 acyl-coa oxidase 31 adipocyte-specific triglyceride lipase 30 carnitine palmitoyl transferase-1 30, 31 fatty acid synthase 28, 29 fatty acid transport proteins 31, 32 hormone-sensitive lipase 30 lipoprotein lipase 31 overview 26, 27 stearoyl-coa desaturase-1 28, 29 sterol response element-binding protein-1 28, 29 peroxisome proliferator-activated receptor food agonists and antagonists β-cryptoxanthine 35, 36 isoprenols 33 phytic acid 34 phytol 34 receptors structures 26, 27 types 25, 26 sesame seed lignan nutrigenomic studies animals and diets 11 carnitine and lignan level evaluation in liver and serum DNA microarray analysis of liver fatty acid metabolism gene expression 12 18, 22, 23 gene regulation mechanisms 21 lignan preparations 10, 11 Lipoprotein lipase (LPL), nuclear receptor regulation of expression and food effects 31 LPL, see Lipoprotein lipase Macrophage, obesity-induced inflammation 96, 97 MAPK, see Mitogen-activated protein kinase Marine carotenoids, see Carotenoids MCP-1, see Monocyte chemoattractant protein-1 Metabolic syndrome, see Lipid metabolism; Obesity-induced inflammation Metastasis, ginger phenol effects in cancer chemoprevention 189 Mitochondria, carotenoid breakdown product studies membrane potential measurements 78 preparation 77 respiration measurements 78, 79 toxicity prevention with antioxidants 83, 84 Mitogen-activated protein kinase (MAPK), inducible nitric oxide synthase expression regulation 195 Monocyte chemoattractant protein-1 (MCP-1), obesity-induced inflammation 98, 99 NAFLD, see Nonalcoholic fatty liver disease Neoculin, sweetener use and food safety genomics 6 8 Neutrophil carotenoid breakdown product studies degradation products 78, 79 incubation 77 oxidative stress-induced posttranslational modification 46, 47 NF- B, see Nuclear factor- B Nitric oxide synthase (NOS) inducible enzyme expression regulation 195, 196 Subject Index 221

5 Nitric oxide synthase (NOS) (continued) phytochemical suppression in cancer chemoprevention nitric oxide in inflammation-associated cancer Nitrotyrosine, oxidative stress-induced Nonalcoholic fatty liver disease (NAFLD), nitrosative stress and protein modification 49 NOS, see Nitric oxide synthase Nuclear factor- B (NF- B), tocotrienol effects in cancer chemoprevention 211 Nutrigenomics, see also Lipid metabolism functional food evaluation 3, 4 marine carotenoids 139 sesame seed lignan studies animals and diets 11 carnitine and lignan level evaluation in liver and serum DNA microarray analysis of liver fatty acid metabolism gene expression 12 18, 22, 23 gene regulation mechanisms 21 lignan preparations 10, 11 Obesity-induced inflammation macrophages in adipose tissue 96, 97 mediators adiponectin 99 interleukin-6 98 modulation by functional food factors phytochemicals monocyte chemoattractant protein-1 98, 99 tumor necrosis factor- 97, 98 overview 95 OPTM, see Oxidative stress-induced Osteoporosis, soybean isoflavones and bone metabolism studies animal studies 107 equol food factors affecting production 111, 112 intestinal bacteria synthesis and isolation 110, 111 status and importance in bone health 110 exercise combination studies 109 observational and intervention studies 108, 109 osteoporosis prevention 105, 114 safety evaluation in Japan 112, 113 Oxidative stress-induced posttranslational modification (OPTM) cysteine modification 40, 41 elimination of proteins 42 N -(hexanonyl)lysine hydroxy-2-nonenal 43, 44 mechanisms 41, 42 neutrophil-dependent oxidative stress 46, 47 nitrotyrosine types 39, 40 p53, isothiocyanate actions in cancer chemoprevention 176, 177 Parkinson s disease (PD) astaxanthin antioxidant activity, see Astaxanthin oxidative stress 130, 134 PARP, see Poly(ADP ribose)-polymerase PD, see Parkinson s disease Peroxisome proliferator-activated receptors (PPARs) food agonists and antagonists β-cryptoxanthine 35, 36 isoprenols 33 phytic acid 34 phytol 34 gene expression regulation acyl-coa carboxylase 28, 29 acyl-coa oxidase 31 adipocyte-specific triglyceride lipase 30 carnitine palmitoyl transferase-1 30, 31 fatty acid synthase 28, 29 fatty acid transport proteins 31, 32 hormone-sensitive lipase 30 lipoprotein lipase 31 overview 26, 27 stearoyl-coa desaturase-1 28, 29 sterol response element-binding protein-1 28, 29 marine carotenoid effects on expression 143, 144 P-glycoprotein, ginger phenol effects 189 Phenethyl isothiocyanate, see Isothiocyanates Physical activity, see Exercise 222 Subject Index

6 Phytic acid, peroxisome proliferator-activated receptor expression regulation 34 Phytol, peroxisome proliferator-activated receptor expression regulation 34 Poly(ADP ribose)-polymerase (PARP), tocotrienol effects in cancer chemoprevention 210 PPARs, see Peroxisome proliferator-activated receptors Probiotics, atopic dermatitis prevention animal model studies cell culture studies 122, 123 overview 117, 118 primary prevention studies in humans Proteasome, epigallocatechin gallate receptor signaling in cancer chemoprevention 158, 159 Proteomics, see Oxidative stress-induced Quercetin, antioxidant activity of metabolites nerve model 90, 91 vascular system 91, 92 Reactive oxygen species, see Astaxanthin; Oxidative stress-induced posttranslational modification Royal jelly, functional food genomics and osteogenesis facilitation 5, 6 SCD1, see Stearoyl-CoA desaturase-1 Sesame seed lignans nutrigenomics studies animals and diets 11 carnitine and lignan level evaluation in liver and serum 12, DNA microarray analysis of liver fatty acid metabolism gene expression 12 18, 22, 23 gene regulation mechanisms 21 lignan preparations 10, 11 types Soy protein, functional food genomics and lipid metabolism 4, 5 Soybean isoflavones bone metabolism studies animal studies 107 equol food factors affecting production 111, 112 intestinal bacteria synthesis and isolation 110, 111 status and importance in bone health 110 exercise combination studies 109 observational and intervention studies 108, 109 osteoporosis prevention 105, 114 overview of benefits 104, 105 safety evaluation in Japan 112, 113 types and metabolites 105, 106 SREBP1, see Sterol response element-binding protein-1 Stearoyl-CoA desaturase-1 (SCD1), nuclear receptor regulation of expression and food effects 28, 29 Sterol response element-binding protein-1 (SREBP1), nuclear receptor regulation of expression and food effects 28, 29 Tangeritin, metabolism 68, 69 TNF-, see Tumor necrosis factor- Tocotrienols, see Vitamin E TRAIL, ginger phenol effects in cancer chemoprevention 187 Tumor necrosis factor- (TNF- ), obesityinduced inflammation 97, 98 UCP1, see Uncoupling protein-1 Uncoupling protein-1 (UCP1), marine carotenoid effects on expression 140, 145 Vimentin, epigallocatechin gallate receptor signaling in cancer chemoprevention 160 Vitamin Cm prevention of exercise-induced homeostasis disturbance 153 Vitamin E prevention of exercise-induced homeostasis disturbance 153 tocotrienols in cancer chemoprevention adverse effects 214 angiogenesis inhibition 212 antitumor activity in vivo apoptosis induction bioavailability 205 cell proliferation inhibition 206 clinical trials 213, 214 gene expression regulation 212, 213 mitogenesis regulation Subject Index 223

7 Vitamin E (Continued) prospects for study 214, 215 tumor HMG CoA reductase regulation 213 types 204, 205 Wheat, food safety genomics of low-allergen wheat 6 Zingerone, obesity-induced inflammation modulation Subject Index

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic

More information

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013 Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile

More information

Subject Index. rationale for supplementation in cancer patients 260, 273 surgical cancer patient supplementation

Subject Index. rationale for supplementation in cancer patients 260, 273 surgical cancer patient supplementation Acute-phase response, cytokine mediation in cachexia 157, 158 ß 2 -Adrenergic agonist, effects on rat tumor models 264 Alcohol breast cancer studies 107, 108, 111, 112, 116 ß-carotene interactions 53 lung

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty

More information

Fatty acids synthesis

Fatty acids synthesis Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Lipid Metabolism. Catabolism Overview

Lipid Metabolism. Catabolism Overview Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Flavonoids and Inflammation

Flavonoids and Inflammation Flavonoids and Inflammation David Heber MD,PHD Professor of Medicine and Public Health Director, UCLA Center for Human Nutrition David Geffen School of Medicine, UCLA Phytonutrient Classes Carotenoids

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Fatty acid breakdown

Fatty acid breakdown Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Metabolism of acylglycerols and sphingolipids. Martina Srbová Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

POMEGRANATE DERIVED PRODUCTS FOR CANCER CHEMOPREVENTION.

POMEGRANATE DERIVED PRODUCTS FOR CANCER CHEMOPREVENTION. Life Extension Magazine May 2010 Pomegranate POMEGRANATE DERIVED PRODUCTS FOR CANCER CHEMOPREVENTION. Because treatment options for advanced metastasized cancers remain inadequate, developing effective

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Mechanistic Toxicology

Mechanistic Toxicology SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi

More information

NIH Public Access Author Manuscript J Nutr Biochem. Author manuscript; available in PMC 2015 January 01.

NIH Public Access Author Manuscript J Nutr Biochem. Author manuscript; available in PMC 2015 January 01. NIH Public Access Author Manuscript Published in final edited form as: J Nutr Biochem. 2014 January ; 25(1): 1 18. doi:10.1016/j.jnutbio.2013.09.001. Novel insights of dietary polyphenols and obesity Shu

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

Post-translational modifications of proteins in gene regulation under hypoxic conditions

Post-translational modifications of proteins in gene regulation under hypoxic conditions 203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and

More information

MAXSUN INDUSTRIES. Max Quality, Max Availability, Max Value & Max Satisfaction. Organic Wheat Grass, Organic Barley Grass, Organic Alfalfa Grass

MAXSUN INDUSTRIES. Max Quality, Max Availability, Max Value & Max Satisfaction. Organic Wheat Grass, Organic Barley Grass, Organic Alfalfa Grass Organic Wheat Grass, Organic Barley Grass, Organic Alfalfa Grass Our powders are certified organic, non-gmo, high quality grass powders. Organic products have fewer pesticides; pesticide accumulation in

More information

Lehninger 5 th ed. Chapter 17

Lehninger 5 th ed. Chapter 17 Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals

More information

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal 24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of

More information

Integration Of Metabolism

Integration Of Metabolism Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal

More information

Flavonoid structures. Other dietary polyphenols with biological activity

Flavonoid structures. Other dietary polyphenols with biological activity Flavonoid structures Polyphenol Bioactivity: Antioxidants? Prof Kevin D Croft University of Western Australia Riemersma RA et al QJM 1; 9:77-8 ther dietary polyphenols with biological activity Phenolic

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Leen Alsahele. Razan Al-zoubi ... Faisal

Leen Alsahele. Razan Al-zoubi ... Faisal 25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram

More information

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.

More information

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle:

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: BCH 4054 February 22, 2002 HOUR TEST 2 NAME_ Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: CO 2 + 3ATP + 2NADPH 1/3 glyceraldehyde-3-p + 3ADP + 2NADP + Give the structures

More information

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is ' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various

More information

Biosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids

Biosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids Biosynthesis of Triacylglycerides (TG) in liver Mobilization of stored fat and oxidation of fatty acids Activation of hormone sensitive lipase This enzyme is activated when phosphorylated (3,5 cyclic AMPdependent

More information

Summary & conclusion

Summary & conclusion Summary & conclusion Cancer is the prime cause of death in developed countries and the second major cause of death in developing world. The early diagnosis is very crucial for the effective treatment of

More information

OXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE OXYGEN SPECIES

OXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE OXYGEN SPECIES JBC Papers in Press. Published on February 19, 2008 as Manuscript R800006200 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.r800006200 OXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 19 Done by حسام ابو عوض Corrected by وسيم ابو عبيدة Doctor د.نايف 1 P a g e GAGs and Glycoproteins: GAGs: long, unbranched heteropolysaccharides, made from زunits repeating disaccharide [Acidic

More information

Integrative Metabolism: Significance

Integrative Metabolism: Significance Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

More information

International Journal of Chemistry and Pharmaceutical Sciences

International Journal of Chemistry and Pharmaceutical Sciences International Journal of Chemistry and Pharmaceutical Sciences Journal Home Page: www.pharmaresearchlibrary.com/ijcps Review Article Open Access Astashine Silver Capsules: An Excellent Choice as Anti-Diabetic

More information

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS

More information

Cholesterol and its transport. Alice Skoumalová

Cholesterol and its transport. Alice Skoumalová Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones

More information

AMPK. Tomáš Kučera.

AMPK. Tomáš Kučera. AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol

More information

Summary of fatty acid synthesis

Summary of fatty acid synthesis Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty

More information

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:

More information

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty

More information

Energy metabolism - the overview

Energy metabolism - the overview Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism

More information

Reactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh

Reactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%

More information

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic

More information

Lecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation

Lecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation Lecture 36 Lipid Metabolism 1 Fatty Acid Oxidation Ketone Bodies Key Concepts Overview of lipid metabolism Reactions of fatty acid oxidation Energy yield from fatty acid oxidation Formation of ketone bodies

More information

Thin layer absorption chromatography can achieve very good separation of small lipid samples

Thin layer absorption chromatography can achieve very good separation of small lipid samples Abbreviations Preface Acknowledgements Lipids: definition, isolation, separation and detection p. 1 Introduction p. 1 Definitions p. 1 Structural chemistry and nomenclature p. 1 Extraction of lipids from

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

MITOCHONDRIA LECTURES OVERVIEW

MITOCHONDRIA LECTURES OVERVIEW 1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The

More information

Dietary phytochemicals for breast cancer prevention and therapy. Maria O Connell School of Pharmacy

Dietary phytochemicals for breast cancer prevention and therapy. Maria O Connell School of Pharmacy Dietary phytochemicals for breast cancer prevention and therapy Maria O Connell School of Pharmacy Homeostasis Resolution Inflammation Cancer Homeostasis Natural products Inflammation Cancer Phytochemicals

More information

Dietary Lipid Metabolism

Dietary Lipid Metabolism Dietary Lipid Metabolism Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy OVERVIEW Lipids are a heterogeneous group.

More information

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb) Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

More information

The Orphan Nuclear Receptors: Unrecognized Targets of Botanical Medicines?

The Orphan Nuclear Receptors: Unrecognized Targets of Botanical Medicines? The Orphan Nuclear Receptors: Unrecognized Targets of Botanical Medicines? Kevin Spelman, PhD, MCPP These notes are designed as a primer for the lecture and do not necessarily represent lecture content.

More information

MILK BIOSYNTHESIS PART 3: FAT

MILK BIOSYNTHESIS PART 3: FAT MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl

More information

glucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate

glucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets

More information

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc. BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In

More information

Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012

Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012 Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012 1. What is Inflammation? 2. Acute and Chronic Inflammation 3. Role of Chronic Inflammation in Modern Human Diseases

More information

Emerging roles of SIRT1 in fatty liver diseases

Emerging roles of SIRT1 in fatty liver diseases 852 Review Ivyspring International Publisher International Journal of Biological Sciences 2017; 13(7): 852-867. doi: 10.7150/ijbs.19370 Emerging roles of SIRT1 in fatty liver diseases Ren-Bo Ding, Jiaolin

More information

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction

More information

I Antonio Cilla Tatay PhD Postdoctoral researcher

I Antonio Cilla Tatay PhD Postdoctoral researcher ANTICARCINOGENIC EFFECT OF PHYTOSTEROLS AND/OR BETA-CRYPTOXANTHIN IN COLON CANCER CELLS I Antonio Cilla Tatay PhD Postdoctoral researcher E-mail: antonio.cilla@uv.es Nutrition and Food Science Area. Faculty

More information

Metabolic integration and Regulation

Metabolic integration and Regulation Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview

More information

Synthesis and degradation of fatty acids Martina Srbová

Synthesis and degradation of fatty acids Martina Srbová Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids

More information

Antihyperlipidemic Drugs

Antihyperlipidemic Drugs Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

Supplements That Best Support Your Exercise Routine

Supplements That Best Support Your Exercise Routine Supplements That Best Support Your Exercise Routine We are closing in on a new year, a time when many people embark on resolutions which include changes to lifestyle such as diet and exercise. If you want

More information

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the

More information

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

More information

Integrative approaches to Parkinson s Disease

Integrative approaches to Parkinson s Disease Integrative approaches to Parkinson s Disease Brian Harris Kopell, M.D. C0-Director, Center for Neuromodulation Associate Professor Departments of Neurosurgery, Neurology, Psychiatry and Neuroscience An

More information

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides

More information

number Done by Corrected by Doctor Faisal Al-Khatib

number Done by Corrected by Doctor Faisal Al-Khatib number 22 Done by Baraa Ayed Corrected by Yaseen Fatayer Doctor Faisal Al-Khatib 1 P a g e Today we are going to cover these concepts: Oxidation of odd number fatty acids Oxidation of very long fatty acids

More information

Integration of Metabolism 1. made by: Noor M. ALnairat. Sheet No. 18

Integration of Metabolism 1. made by: Noor M. ALnairat. Sheet No. 18 Integration of Metabolism 1 made by: Noor M. ALnairat Sheet No. 18 Data :24/11/2016 SLIDE 2: Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP,

More information

Outline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018

Outline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018 Fitting Nutrition into Your Genes, Ph.D., R.D. Human Nutrition The Ohio State University Outline I. History (abridged) of the Study of Genetics and Nutrition II. The Skinny on Fats & Genes III. How Dietary

More information

Cancer and nutrition. ...another difficulty lies in the application of laboratory/animal model studies to human cancer prevention

Cancer and nutrition. ...another difficulty lies in the application of laboratory/animal model studies to human cancer prevention 1 Cancer and nutrition Part 1: Dietary factors in possible cancer prevention a major cause of death in Canada & other developing countries after CVD Part 2: Dietary changes to moderate the effects of therapy

More information

Lipid Metabolism * OpenStax

Lipid Metabolism * OpenStax OpenStax-CNX module: m46462 1 Lipid Metabolism * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able

More information

Mid Term Test- Template Questions

Mid Term Test- Template Questions Mid Term Test- Template Questions Name : ID : Time: Date: Total points: 100 Instructions: 1. Only 20 questions from Section I and II, 10 questions from Section III will be counted for grading. 2. Try to

More information

METABOLISM of ADIPOSE TISSUE

METABOLISM of ADIPOSE TISSUE METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation

More information

Lister V. Nutritional Immunology

Lister V. Nutritional Immunology Targeted Medical Foods, LLC Japan Division 2980 Beverly Glen Circle, Suite 301 Phone (310) 320-2900 : Los Angeles, California 90077 info@medicalfood.org Lister V Nutritional Immunology The concept that

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information