Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
|
|
- Rosaline Shields
- 5 years ago
- Views:
Transcription
1 Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity 144, 145 ACO, see Acyl-CoA oxidase Acyl-CoA carboxylase (ACC), nuclear receptor regulation of expression and food effects 28, 29 Acyl-CoA oxidase (ACO), nuclear receptor regulation of expression and food effects 31 AD, see Atopic dermatitis Adipocyte-specific triglyceride lipase (ATGL), nuclear receptor regulation of expression and food effects 30 Adiponectin, obesity-induced inflammation 99 Akt epigallocatechin gallate receptor signaling in cancer chemoprevention 159 tocotrienol effects in cancer chemoprevention 212 Allyl isothiocyanate, obesity-induced inflammation modulation 101 Angiogenesis ginger phenol effects in cancer chemoprevention 188, 189 tocotrienol inhibition in cancer chemoprevention 212 Apoptosis, cancer chemoprevention ginger phenols 187, 188 isothiocyanate induction laminin 67LR receptor in induction 164 tocotrienol induction Astaxanthin beneficial biological effects 129, 130 neuroprotection studies cell culture and viability assays 131 concentration determination in cell fractions 131 DHA hydroperoxide and 6-hydroxydopamine neurotoxicity effects cell death 133 reactive oxygen species generation 133 materials 130, 131 reactive oxygen species assay 131 structure 129, 130, 138 ATGL, see Adipocyte-specific triglyceride lipase Atopic dermatitis (AD), probiotics and prevention animal model studies cell culture studies 122, 123 overview 117, 118 primary prevention studies in humans BCAAs, see Branched-chain amino acids Bcl-2 epigallocatechin gallate receptor signaling in cancer chemoprevention 160 ginger phenol effects in cancer chemoprevention 187 isothiocyanate actions in cancer chemoprevention 175, 176 Benzyl isothiocyanate, see Isothiocyanates Bifidobacterium, see Probiotics Branched-chain amino acids (BCAAs) muscle metabolism 152 prevention of exercise-induced homeostasis disturbance
2 Cancer chemoprevention, see Epigallocatechin gallate; Ginger; Isothiocyanates; Nitric oxide synthase; Vitamin E Capsaicin, obesity-induced inflammation modulation Carnitine, sesame seed lignan effects on liver levels 12, Carnitine palmitoyl transferase-1 (CPT1) food-exercise interactions 149, 150 nuclear receptor regulation of expression and food effects 30, 31 β-carotene breakdown product analysis adenine nucleotide translocator targeting 80 formation conditions 81, 82 identification 79 mitochondria membrane potential measurements 78 preparation 77 respiration measurements 78, 79 toxicity prevention with antioxidants 83, 84 neutrophil studies degradation products 78, 79 incubation 77 overview of effects 76, 77, preparation and formation 77 sulfhydryl analysis 78, 80, 81 supplementation studies 75, 76 Carotenoids, see also specific carotenoids bioavailability and absorption breakdown products, see β-carotene functions 55, 56, marine carotenoids acetylene carotenoids and antiinflammatory activity 144, 145 antiobesity activity and structure-activity relationships antioxidant activity fucoxanthin antiobesity and antidiabetic effects 140, 141 nutrigenomics 139, 140 types and structures 137, 138 metabolism 59, 60 types and structures 55, 56 Catechins, see Epigallocatechin gallate; Flavonoids C/EBPβ, marine carotenoid effects on activity 144 Cocoa polyphenols, functional food genomics and antiobesity effects 5 COX-2, see Cyclooxygenase-2 CPT1, see Carnitine palmitoyl transferase-1 β-cryptoxanthine, peroxisome proliferatoractivated receptor expression regulation 35, 36 Curcumin inducible nitric oxide synthase suppression in cancer chemoprevention 197, 198 obesity-induced inflammation modulation 101 Cyclooxygenase-2 (COX-2), ginger phenol effects in cancer chemoprevention 185, 186 Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23 Epidermal growth factor (EGF), ginger phenol effects in cancer chemoprevention 186 EGCG, see Epigallocatechin gallate EGF, see Epidermal growth factor Epigallocatechin gallate (EGCG) bioavailability 158 cancer chemoprevention cell line and animal models 157 gene polymorphisms and risk reduction 166, 167 mechanisms of action Akt 159 Bcl extracellular signal regulated kinase 1/2 159 prospects for study 168 proteasome 158, 159 vimentin 160 overview 156, 157 inducible nitric oxide synthase suppression in cancer chemoprevention 198, 199 laminin 67LR receptor apoptosis induction role 164 cancer cell growth inhibition modulation discovery as green tea catechin receptor 161, 162 functional overview 161 signaling elongation factor 1A 165 hierarchy of signaling molecules 166 Subject Index 219
3 Epigallocatechin gallate (EGCG) (continued) myosin phosphatase targeting subunit 165, 166 metabolism 65, 66, sources 156 Equol, see Soybean isoflavones ERK1/2, see Extracellular signal regulated kinase 1/2 Exercise bone metabolism effects with soybean isoflavones 109 food factor interactions energy metabolism improvement hydration 148, 149 muscle mass 151, 152 overview 147, 148 prevention of exercise-induced homeostasis disturbance Extracellular signal regulated kinase 1/2 (ERK1/2), epigallocatechin gallate receptor signaling in cancer chemoprevention 159 FAS, see Fatty acid synthase FATPs, see Fatty acid transport proteins Fatty acid metabolism, see Lipid metabolism Fatty acid synthase (FAS), nuclear receptor regulation of expression and food effects 28, 29 Fatty acid transport proteins (FATPs), nuclear receptor regulation of expression and food effects 31, 32 Flavonoids, see also specific flavonoids antioxidant activity quercetin metabolites nerve model 90, 91 vascular system 91, 92 structure-activity relationships beneficial effects 65, 66 catechins 65 food sources 64, 65 metabolism biological activities of metabolites 71 colon 70, 71 conjugation epigallocatechin gallate 65, 66, overview 66, 67 Phase I biotransformation 67, 68 polymethoxyflavones 64 pro-oxidants 92, 93 synthesis 87 Food genomics, see also Nutrigenomics food comparison with drugs 2, 3 food safety genomics low-allergen wheat 6 neoculin sweetener 6 8 functional food genomics cocoa polyphenol and antiobesity effects 5 royal jelly and osteogenesis facilitation 5, 6 soy protein and lipid metabolism 4, 5 nutrigenomics-based evaluation of functional food 3, 4 Fucoxanthin, antiobesity and antidiabetic effects 140, 141 Functional food genomics, see Food genomics Genomics, see Food genomics; Nutrigenomics Ginger anti-inflammatory effects 185, 186 antioxidant effects 183, 184 cancer chemoprevention by phenols angiogenesis inhibition 188, 189 apoptosis 187, 188 cell growth and proliferation inhibition 187 chemosensitization 189 metastasis inhibition 188, 189 prospects for study 189, 190 tumor promotion inhibition 186 pungent phenols 183, 184 uses 183 Glyceraldehyde-3-phosphate dehydrogenase, isothiocyanate inhibition 174 Green tea, polyphenols 156, 157 HEL, see N -(Hexanonyl)lysine N -(Hexanonyl)lysine (HEL), oxidative stressinduced HMG CoA reductase, tocotrienol regulation in tumors 213 HNE, see 4-Hydroxy-2-nonenal Hormone-sensitive lipase (HSL), nuclear receptor regulation of expression and food effects 30 HSL, see Hormone-sensitive lipase 4-Hydroxy-2-nonenal (HNE), oxidative stressinduced 43, Subject Index
4 IL-6, see Interleukin-6 Interleukin-6 (IL-6), obesity-induced inflammation 98 Isoflavones, see Soybean isoflavones Isoprenols, peroxisome proliferator-activated receptor expression regulation 33 Isothiocyanates cancer chemoprevention apoptosis induction cellular stress induction 177, 178 mechanisms 172, 173 prospects for study 179 food sources 170, 171 metabolism types and structures 171 Keap1, ginger phenol effects in cancer chemoprevention 184 Lactobacillus, see Probiotics Laminin 67LR receptor, see Epigallocatechin gallate Lipid metabolism, see also Obesity-induced inflammation nuclear receptor genomics and foods diosgenin antagonism of LXRs 36 gene expression regulation acyl-coa carboxylase 28, 29 acyl-coa oxidase 31 adipocyte-specific triglyceride lipase 30 carnitine palmitoyl transferase-1 30, 31 fatty acid synthase 28, 29 fatty acid transport proteins 31, 32 hormone-sensitive lipase 30 lipoprotein lipase 31 overview 26, 27 stearoyl-coa desaturase-1 28, 29 sterol response element-binding protein-1 28, 29 peroxisome proliferator-activated receptor food agonists and antagonists β-cryptoxanthine 35, 36 isoprenols 33 phytic acid 34 phytol 34 receptors structures 26, 27 types 25, 26 sesame seed lignan nutrigenomic studies animals and diets 11 carnitine and lignan level evaluation in liver and serum DNA microarray analysis of liver fatty acid metabolism gene expression 12 18, 22, 23 gene regulation mechanisms 21 lignan preparations 10, 11 Lipoprotein lipase (LPL), nuclear receptor regulation of expression and food effects 31 LPL, see Lipoprotein lipase Macrophage, obesity-induced inflammation 96, 97 MAPK, see Mitogen-activated protein kinase Marine carotenoids, see Carotenoids MCP-1, see Monocyte chemoattractant protein-1 Metabolic syndrome, see Lipid metabolism; Obesity-induced inflammation Metastasis, ginger phenol effects in cancer chemoprevention 189 Mitochondria, carotenoid breakdown product studies membrane potential measurements 78 preparation 77 respiration measurements 78, 79 toxicity prevention with antioxidants 83, 84 Mitogen-activated protein kinase (MAPK), inducible nitric oxide synthase expression regulation 195 Monocyte chemoattractant protein-1 (MCP-1), obesity-induced inflammation 98, 99 NAFLD, see Nonalcoholic fatty liver disease Neoculin, sweetener use and food safety genomics 6 8 Neutrophil carotenoid breakdown product studies degradation products 78, 79 incubation 77 oxidative stress-induced posttranslational modification 46, 47 NF- B, see Nuclear factor- B Nitric oxide synthase (NOS) inducible enzyme expression regulation 195, 196 Subject Index 221
5 Nitric oxide synthase (NOS) (continued) phytochemical suppression in cancer chemoprevention nitric oxide in inflammation-associated cancer Nitrotyrosine, oxidative stress-induced Nonalcoholic fatty liver disease (NAFLD), nitrosative stress and protein modification 49 NOS, see Nitric oxide synthase Nuclear factor- B (NF- B), tocotrienol effects in cancer chemoprevention 211 Nutrigenomics, see also Lipid metabolism functional food evaluation 3, 4 marine carotenoids 139 sesame seed lignan studies animals and diets 11 carnitine and lignan level evaluation in liver and serum DNA microarray analysis of liver fatty acid metabolism gene expression 12 18, 22, 23 gene regulation mechanisms 21 lignan preparations 10, 11 Obesity-induced inflammation macrophages in adipose tissue 96, 97 mediators adiponectin 99 interleukin-6 98 modulation by functional food factors phytochemicals monocyte chemoattractant protein-1 98, 99 tumor necrosis factor- 97, 98 overview 95 OPTM, see Oxidative stress-induced Osteoporosis, soybean isoflavones and bone metabolism studies animal studies 107 equol food factors affecting production 111, 112 intestinal bacteria synthesis and isolation 110, 111 status and importance in bone health 110 exercise combination studies 109 observational and intervention studies 108, 109 osteoporosis prevention 105, 114 safety evaluation in Japan 112, 113 Oxidative stress-induced posttranslational modification (OPTM) cysteine modification 40, 41 elimination of proteins 42 N -(hexanonyl)lysine hydroxy-2-nonenal 43, 44 mechanisms 41, 42 neutrophil-dependent oxidative stress 46, 47 nitrotyrosine types 39, 40 p53, isothiocyanate actions in cancer chemoprevention 176, 177 Parkinson s disease (PD) astaxanthin antioxidant activity, see Astaxanthin oxidative stress 130, 134 PARP, see Poly(ADP ribose)-polymerase PD, see Parkinson s disease Peroxisome proliferator-activated receptors (PPARs) food agonists and antagonists β-cryptoxanthine 35, 36 isoprenols 33 phytic acid 34 phytol 34 gene expression regulation acyl-coa carboxylase 28, 29 acyl-coa oxidase 31 adipocyte-specific triglyceride lipase 30 carnitine palmitoyl transferase-1 30, 31 fatty acid synthase 28, 29 fatty acid transport proteins 31, 32 hormone-sensitive lipase 30 lipoprotein lipase 31 overview 26, 27 stearoyl-coa desaturase-1 28, 29 sterol response element-binding protein-1 28, 29 marine carotenoid effects on expression 143, 144 P-glycoprotein, ginger phenol effects 189 Phenethyl isothiocyanate, see Isothiocyanates Physical activity, see Exercise 222 Subject Index
6 Phytic acid, peroxisome proliferator-activated receptor expression regulation 34 Phytol, peroxisome proliferator-activated receptor expression regulation 34 Poly(ADP ribose)-polymerase (PARP), tocotrienol effects in cancer chemoprevention 210 PPARs, see Peroxisome proliferator-activated receptors Probiotics, atopic dermatitis prevention animal model studies cell culture studies 122, 123 overview 117, 118 primary prevention studies in humans Proteasome, epigallocatechin gallate receptor signaling in cancer chemoprevention 158, 159 Proteomics, see Oxidative stress-induced Quercetin, antioxidant activity of metabolites nerve model 90, 91 vascular system 91, 92 Reactive oxygen species, see Astaxanthin; Oxidative stress-induced posttranslational modification Royal jelly, functional food genomics and osteogenesis facilitation 5, 6 SCD1, see Stearoyl-CoA desaturase-1 Sesame seed lignans nutrigenomics studies animals and diets 11 carnitine and lignan level evaluation in liver and serum 12, DNA microarray analysis of liver fatty acid metabolism gene expression 12 18, 22, 23 gene regulation mechanisms 21 lignan preparations 10, 11 types Soy protein, functional food genomics and lipid metabolism 4, 5 Soybean isoflavones bone metabolism studies animal studies 107 equol food factors affecting production 111, 112 intestinal bacteria synthesis and isolation 110, 111 status and importance in bone health 110 exercise combination studies 109 observational and intervention studies 108, 109 osteoporosis prevention 105, 114 overview of benefits 104, 105 safety evaluation in Japan 112, 113 types and metabolites 105, 106 SREBP1, see Sterol response element-binding protein-1 Stearoyl-CoA desaturase-1 (SCD1), nuclear receptor regulation of expression and food effects 28, 29 Sterol response element-binding protein-1 (SREBP1), nuclear receptor regulation of expression and food effects 28, 29 Tangeritin, metabolism 68, 69 TNF-, see Tumor necrosis factor- Tocotrienols, see Vitamin E TRAIL, ginger phenol effects in cancer chemoprevention 187 Tumor necrosis factor- (TNF- ), obesityinduced inflammation 97, 98 UCP1, see Uncoupling protein-1 Uncoupling protein-1 (UCP1), marine carotenoid effects on expression 140, 145 Vimentin, epigallocatechin gallate receptor signaling in cancer chemoprevention 160 Vitamin Cm prevention of exercise-induced homeostasis disturbance 153 Vitamin E prevention of exercise-induced homeostasis disturbance 153 tocotrienols in cancer chemoprevention adverse effects 214 angiogenesis inhibition 212 antitumor activity in vivo apoptosis induction bioavailability 205 cell proliferation inhibition 206 clinical trials 213, 214 gene expression regulation 212, 213 mitogenesis regulation Subject Index 223
7 Vitamin E (Continued) prospects for study 214, 215 tumor HMG CoA reductase regulation 213 types 204, 205 Wheat, food safety genomics of low-allergen wheat 6 Zingerone, obesity-induced inflammation modulation Subject Index
Cornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
More informationDietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationSubject Index. rationale for supplementation in cancer patients 260, 273 surgical cancer patient supplementation
Acute-phase response, cytokine mediation in cachexia 157, 158 ß 2 -Adrenergic agonist, effects on rat tumor models 264 Alcohol breast cancer studies 107, 108, 111, 112, 116 ß-carotene interactions 53 lung
More informationSynthesis of Fatty Acids and Triacylglycerol
Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationOVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationFlavonoids and Inflammation
Flavonoids and Inflammation David Heber MD,PHD Professor of Medicine and Public Health Director, UCLA Center for Human Nutrition David Geffen School of Medicine, UCLA Phytonutrient Classes Carotenoids
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationFatty acid breakdown
Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of
More informationFatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
More informationFatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationPOMEGRANATE DERIVED PRODUCTS FOR CANCER CHEMOPREVENTION.
Life Extension Magazine May 2010 Pomegranate POMEGRANATE DERIVED PRODUCTS FOR CANCER CHEMOPREVENTION. Because treatment options for advanced metastasized cancers remain inadequate, developing effective
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationMechanistic Toxicology
SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi
More informationNIH Public Access Author Manuscript J Nutr Biochem. Author manuscript; available in PMC 2015 January 01.
NIH Public Access Author Manuscript Published in final edited form as: J Nutr Biochem. 2014 January ; 25(1): 1 18. doi:10.1016/j.jnutbio.2013.09.001. Novel insights of dietary polyphenols and obesity Shu
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationPost-translational modifications of proteins in gene regulation under hypoxic conditions
203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and
More informationMAXSUN INDUSTRIES. Max Quality, Max Availability, Max Value & Max Satisfaction. Organic Wheat Grass, Organic Barley Grass, Organic Alfalfa Grass
Organic Wheat Grass, Organic Barley Grass, Organic Alfalfa Grass Our powders are certified organic, non-gmo, high quality grass powders. Organic products have fewer pesticides; pesticide accumulation in
More informationLehninger 5 th ed. Chapter 17
Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More informationIntegration Of Metabolism
Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal
More informationFlavonoid structures. Other dietary polyphenols with biological activity
Flavonoid structures Polyphenol Bioactivity: Antioxidants? Prof Kevin D Croft University of Western Australia Riemersma RA et al QJM 1; 9:77-8 ther dietary polyphenols with biological activity Phenolic
More informationrenoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationLeen Alsahele. Razan Al-zoubi ... Faisal
25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More informationRoles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationPublished on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
More informationPoints 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle:
BCH 4054 February 22, 2002 HOUR TEST 2 NAME_ Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: CO 2 + 3ATP + 2NADPH 1/3 glyceraldehyde-3-p + 3ADP + 2NADP + Give the structures
More informationC-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
More informationBiosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids
Biosynthesis of Triacylglycerides (TG) in liver Mobilization of stored fat and oxidation of fatty acids Activation of hormone sensitive lipase This enzyme is activated when phosphorylated (3,5 cyclic AMPdependent
More informationSummary & conclusion
Summary & conclusion Cancer is the prime cause of death in developed countries and the second major cause of death in developing world. The early diagnosis is very crucial for the effective treatment of
More informationOXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE OXYGEN SPECIES
JBC Papers in Press. Published on February 19, 2008 as Manuscript R800006200 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.r800006200 OXIDIZED LIPIDS FORMED NON-ENZYMATICALLY BY REACTIVE
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationnumber Done by Corrected by Doctor
number 19 Done by حسام ابو عوض Corrected by وسيم ابو عبيدة Doctor د.نايف 1 P a g e GAGs and Glycoproteins: GAGs: long, unbranched heteropolysaccharides, made from زunits repeating disaccharide [Acidic
More informationIntegrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
More informationInternational Journal of Chemistry and Pharmaceutical Sciences
International Journal of Chemistry and Pharmaceutical Sciences Journal Home Page: www.pharmaresearchlibrary.com/ijcps Review Article Open Access Astashine Silver Capsules: An Excellent Choice as Anti-Diabetic
More informationBBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester
BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationLipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies
Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:
More informationTala Saleh. Razi Kittaneh ... Nayef Karadsheh
Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty
More informationEnergy metabolism - the overview
Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism
More informationReactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh
Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationLecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation
Lecture 36 Lipid Metabolism 1 Fatty Acid Oxidation Ketone Bodies Key Concepts Overview of lipid metabolism Reactions of fatty acid oxidation Energy yield from fatty acid oxidation Formation of ketone bodies
More informationThin layer absorption chromatography can achieve very good separation of small lipid samples
Abbreviations Preface Acknowledgements Lipids: definition, isolation, separation and detection p. 1 Introduction p. 1 Definitions p. 1 Structural chemistry and nomenclature p. 1 Extraction of lipids from
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationMITOCHONDRIA LECTURES OVERVIEW
1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The
More informationDietary phytochemicals for breast cancer prevention and therapy. Maria O Connell School of Pharmacy
Dietary phytochemicals for breast cancer prevention and therapy Maria O Connell School of Pharmacy Homeostasis Resolution Inflammation Cancer Homeostasis Natural products Inflammation Cancer Phytochemicals
More informationDietary Lipid Metabolism
Dietary Lipid Metabolism Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy OVERVIEW Lipids are a heterogeneous group.
More informationMouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
More informationThe Orphan Nuclear Receptors: Unrecognized Targets of Botanical Medicines?
The Orphan Nuclear Receptors: Unrecognized Targets of Botanical Medicines? Kevin Spelman, PhD, MCPP These notes are designed as a primer for the lecture and do not necessarily represent lecture content.
More informationMILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
More informationglucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate
Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More informationBIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.
BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In
More informationVadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012
Vadim Ivanov, M.D., Ph.D. Micronutrients in controlling INFLAMMATION Webinar June 12, 2012 1. What is Inflammation? 2. Acute and Chronic Inflammation 3. Role of Chronic Inflammation in Modern Human Diseases
More informationEmerging roles of SIRT1 in fatty liver diseases
852 Review Ivyspring International Publisher International Journal of Biological Sciences 2017; 13(7): 852-867. doi: 10.7150/ijbs.19370 Emerging roles of SIRT1 in fatty liver diseases Ren-Bo Ding, Jiaolin
More informationImplications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss
GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction
More informationI Antonio Cilla Tatay PhD Postdoctoral researcher
ANTICARCINOGENIC EFFECT OF PHYTOSTEROLS AND/OR BETA-CRYPTOXANTHIN IN COLON CANCER CELLS I Antonio Cilla Tatay PhD Postdoctoral researcher E-mail: antonio.cilla@uv.es Nutrition and Food Science Area. Faculty
More informationMetabolic integration and Regulation
Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview
More informationSynthesis and degradation of fatty acids Martina Srbová
Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationSupplements That Best Support Your Exercise Routine
Supplements That Best Support Your Exercise Routine We are closing in on a new year, a time when many people embark on resolutions which include changes to lifestyle such as diet and exercise. If you want
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationBIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
More informationIntegrative approaches to Parkinson s Disease
Integrative approaches to Parkinson s Disease Brian Harris Kopell, M.D. C0-Director, Center for Neuromodulation Associate Professor Departments of Neurosurgery, Neurology, Psychiatry and Neuroscience An
More informationAnabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides
Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides
More informationnumber Done by Corrected by Doctor Faisal Al-Khatib
number 22 Done by Baraa Ayed Corrected by Yaseen Fatayer Doctor Faisal Al-Khatib 1 P a g e Today we are going to cover these concepts: Oxidation of odd number fatty acids Oxidation of very long fatty acids
More informationIntegration of Metabolism 1. made by: Noor M. ALnairat. Sheet No. 18
Integration of Metabolism 1 made by: Noor M. ALnairat Sheet No. 18 Data :24/11/2016 SLIDE 2: Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP,
More informationOutline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018
Fitting Nutrition into Your Genes, Ph.D., R.D. Human Nutrition The Ohio State University Outline I. History (abridged) of the Study of Genetics and Nutrition II. The Skinny on Fats & Genes III. How Dietary
More informationCancer and nutrition. ...another difficulty lies in the application of laboratory/animal model studies to human cancer prevention
1 Cancer and nutrition Part 1: Dietary factors in possible cancer prevention a major cause of death in Canada & other developing countries after CVD Part 2: Dietary changes to moderate the effects of therapy
More informationLipid Metabolism * OpenStax
OpenStax-CNX module: m46462 1 Lipid Metabolism * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able
More informationMid Term Test- Template Questions
Mid Term Test- Template Questions Name : ID : Time: Date: Total points: 100 Instructions: 1. Only 20 questions from Section I and II, 10 questions from Section III will be counted for grading. 2. Try to
More informationMETABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
More informationLister V. Nutritional Immunology
Targeted Medical Foods, LLC Japan Division 2980 Beverly Glen Circle, Suite 301 Phone (310) 320-2900 : Los Angeles, California 90077 info@medicalfood.org Lister V Nutritional Immunology The concept that
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More information