Supporting Information Table of content
|
|
|
- Shawn Dean
- 5 years ago
- Views:
Transcription
1 Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting Information Table I. Supporting Information Methods 1
2 Supporting Information Fig. S1 Fig. S1. The expression patterns of PTGR-2 and PTGR-3 mrna in tissues and cells. (A) Tissue distribution of PTGR-2 and PTGR-3 mrna from 12-wk-old mice C57BL/6 mice. (B) Expression of PTGR-2 and PTGR-3 mrna from adipose tissue of 12-wk-old lean and ob/ob mice. * P < 0.05 versus Lean. The bars indicate the means ± SE for tissue or cells from three independent replicates (n = 3). 2
3 Supporting Information Fig. S2 Fig. S2. Expression of lipid metabolism-related genes in genetically modified 3T3-L1 cells after 8 day hormonal induction. (A) Expression of adipogenic marker genes (lpl and cd36) in shrna control and PTGR-3-knockdown cells. (B) Expression of adipogenic marker genes (lpl and cd36) in vector control and PTGR-3-overexpressing cells. The bars indicate the means ± SE for cells from three independent replicates (n = 3). * P < 0.05 versus shluc. 3
4 Supporting Information Fig. S3 Fig. S3. Mass spectrum of 15-keto-PGE 2 and 13,14-dihydro-15-keto-PGE 2. (A) LC- MS/MS spectrum of standard molecule of 15-keto-PGE 2 (upper panel) and 13,14- dihydro-15-keto-pge 2 (lower panel) were identified from fragmentation of the molecular anions of 15-keto-PGE 2 (m/z 349) and 13,14-dihydro-15-keto-PGE 2 (m/z 351). (B) LC- MS/MS spectrum of PTGR-2 enzymatic reaction product. 15-keto-PGE 2 was incubated with recombinant PTGR-2 and NADPH for 30 min at 37 C. Mass spectrum of 13,14-4
5 dihydro-15-keto-pge 2 from enzymatic reaction product was identified by LC-MS/MS compared with standard molecule of 13,14-dihydro-15-keto-PGE 2. 5
6 Supporting Information Fig. S4 Fig. S4. The effect of transactivation of PGE 2 and 13,14-dihydro-15-keto-PGE 2 on ligand binding domain of PPARγ. 293 cells were transfected with expression vectors (CMX- GAL4 and CMX-GAL4-PPARγ) and UAS G 4-TK-LUC reporter plasmid for 16 hour and then incubated cells in growth medium with or without treatments (1 μm troglitazone, 10 μm PGE 2, 10 μm 13,14-dihydro-15-keto-PGE 2 and 1 μm GW9662) for 24 hour. The activity of firefly luciferase was determined and normalized to the activity of renilla luciferase. The bars indicate the means ± SE for three independent replicates (n=3). Different superscripts indicate significant difference (P 0.05). 6
7 Supporting Information Fig. S5 Fig. S5. The effect of 15-keto-PGE 2 on retinoid X receptor response element (RXRE)- driven luciferase activity. 293 cells were transfected with RXRE-LUC reporter plasmid for 16 hour and then incubated cells in growth medium with or without treatments (5 μm 9-cis retinoic acid and 10 μm 15-keto-PGE 2 ) for 24 hour. The activity of firefly luciferase was determined and normalized to the activity of renilla luciferase. The bars indicate the means ± SE for three independent replicates (n=3). * P < 0.05 versus DMSO. 7
8 Supporting Information Table I. Primer sequences for quantitative reverse transcription-pcr Gene Sequence ucp1 Sense 5 -CGTACCAAGCTGTGCGATGT-3 Anti-sense 5 -TAGAAGCCCAATGATGTTCAGT-3 ucp2 Sense 5 -CCGGGCTGGTGGTGGTC-3 Anti-sense 5 -ACACCTTTCCAGAGGCCC-3 ucp3 Sense 5 -CATCGCCAGGGAGGAAGGA-3 Anti-sense 5 -GTTGACAATGGCATTTCTTGTGA-3 pparα Sense 5 -TGCCAAGGAGTCGAGGATGT-3 Anti-sense 5 -TCGGCACCAGGAACCAA-3 pparβ/δ Sense 5 -AATGCGCTGGAGCTCGATGAC-3 Anti-sense 5 -ACTGGCTGTCAGGGTGGTTG-3 pparγ Sense 5 -CAAGAATACCAAAGTGCGATCAA-3 Anti-sense 5 -GAGCTGGGTCTTTTCAGAATAATAAG-3 atgl Sense 5 -TGTGGCCTCATTCCTCCTAC-3 Anti-sense 5 -TCGTGGATGTTGGTGGAGCT-3 hsl Sense 5 -GGCTTACTGGGCACAGATACCT-3 Anti-sense 5 -CTGAAGGCTCTGAGTTGCTCAA-3 ptgr-2 Sense 5 -CAGGGTGGAAGAGTTCAGTTT-3 Anti-sense 5 -CCAGTGTCCTCGTTCATCTTAC-3 ptgr-3 Sense 5 -GGAACTGTCAGAAGGGAAGAAA-3 Anti-sense 5 -TAACGTGGCACTTGGCTATC-3 lpl Sense 5 -GGATGGACGGTAAGAGTGATTC-3 Anti-sense 5 -ATCCAAGGGTAGCAGACAGGT-3 cd36 Sense 5 -CCCCGTGCCTCCTCCCAGAA-3 Anti-sense 5 -GGCTAGGAAACCATCCACCAGTTGC-3 fas Sense 5 -CCCTTGATGAAGAGGGATCA-3 Anti-sense 5 -GAACAAGGCGTTAGGGTTGA-3 acc Sense 5 -AACATCCCCACGCTAAACAG-3 Anti-sense 5 -CTGACAAGGTGGCGTGAAG-3 srebp-1c Sense 5 -GGAGCCATGGATTGCACATT-3 Anti-sense 5 -GCTTCCAGAGAGGAGGCCAG-3 gapdh Sense 5 -GGTGAAGGTCGGTGTGAACG-3 Anti-sense 5 -CTCGCTCCTGGAAGATGGTG-3 Abbreviations used: uncoupling protein 1, UCP1; uncoupling protein 2, UCP2; uncoupling protein 3, UCP3; peroxisome proliferator-activated receptor α, PPARα; peroxisome proliferator-activated receptor β/δ, PPARβ/δ; peroxisome proliferatoractivated receptor γ, PPARγ; adipose triglyceride lipase, ATGL; hormone sensitive lipase, HSL; sterol regulatory element-binding transcription factor-1c, SREBP-1c; acetyl- CoA carboxylase, ACC; fatty acid synthase, FAS; glycerol-3-phosphate dehydrogenase, GPDH; fatty acid translocase, CD36; lipoprotein lipase, LPL; PTGR-2, prostaglandin 8
9 reductase-2; PTGR-3 prostaglandin reductase-3; glyceraldehyde-3-phosphate dehydrogenase, GAPDH. 9
10 Supporting information methods Quantitative reverse transcription-pcr. Tissue and cellular RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed with a Transcriptor Reverse Transcriptase kit (Roche Applied Science, Indianapolis, IN, USA). Quantitative reverse transcriptase-pcr was performed using ABI PRISM 7000 sequence detector system (Applied Biosystems, Foster City, CA, USA) and KAPA SYBR FAST qpcr Kit (Kapa Biosystems, Inc., Boston, MA, USA). PCR was performed by 40 cycles of 95 C for 30 s, C for 60 s, and 72 C for 30 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was determined as the internal control gene. The sequence of primers for quantitative reverse transcription-pcr was listed in Supporting Information Table I. The mrna expression of each gene was normalized to its GAPDH mrna expression in the same sample. Threshold cycle (C t ) values were obtained and relative gene expression was calculated using the formula (1/2) Ct target genes Ct GAPDH. Retinoid X receptor activity assay. Confluent 293T cell were incubated with reporter plasmids (retinoid X receptor response element-driven luciferase and CMV-driven renilla luciferase vectors) and lipofectamine. After 16 hour of transfection, media were changed to growth media without or with chemicals (5 μm 9-cis retinoic acid and 10 μm 15-keto- PGE 2 ). Twenty-four hours after treatment, cells were harvested for determination of luciferase activity (Dual-Glo luciferase assay system, Promega). 10
Prostaglandin reductase-3 negatively modulates adipogenesis through regulation of peroxisome proliferator-activated receptor γ activity
Prostaglandin reductase-3 negatively modulates adipogenesis through regulation of peroxisome proliferator-activated receptor γ activity Yu-Hsiang Yu 1*, Yi-Cheng Chang 12*, Tseng-Hsiung Su 2, Jiun-Yi Nong
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Supporting Information
Supporting Information Chlorinated Polyfluorinated Ether Sulfonates Exhibit Higher Activity towards Peroxisome Proliferator-Activated Receptors Signaling Pathways than Perfluorooctane Sulfonate Chuan-Hai
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng
Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
INTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
Supplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK).
1 SUPPLEMENTAL MATERIAL 2 SUPPLEMENTARY METHODS 3 4 5 6 7 Materials Unless stated otherwise, all solvents were from Rathburn Chemical Ltd. (Walkerburn, UK) and other chemicals from Sigma-Aldrich (Dorset,
MILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays
Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays Lu Zhang b, Lei Guo a, Leming Shi a, Weida Tong a, Yongming Sun b, Gary
For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics
Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein
Peroxisome Proliferator-Activated Receptors (PPARs) and osteoblasts and adipocytes. Welcome to the wonderful, dynamic and complex world of PPARs
PhD Training Course 2-5 July 2009 Oxford, UK Peroxisome Proliferator-Activated Receptors (PPARs) and osteoblasts and adipocytes Welcome to the wonderful, dynamic and complex world of PPARs Hans van Leeuwen
Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
/03/$15.00/0 Molecular Endocrinology 17(12): Copyright 2003 by The Endocrine Society doi: /me
0888-8809/03/$15.00/0 Molecular Endocrinology 17(12):2477 2493 Printed in U.S.A. Copyright 2003 by The Endocrine Society doi: 10.1210/me.2003-0151 The Peroxisome Proliferator-Activated Receptor / Agonist,
OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
number Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Data Sheet. Notch Pathway Reporter Kit Catalog # 60509
Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
SUPPLEMENTARY INFORMATION
Glucose is a ligand for the oxysterol receptor LXR Supplementary Figure 1 Schematic representation of pathways influencing glucose fate in the liver. Glucose induces insulin secretion, suppressing hepatic
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
Supplementary Information
Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Supplemental Figures
Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
606 J. Anim. Sci Vol. 92, E-Suppl. 2/J. Dairy Sci. Vol. 97, E-Suppl. 1
Lactation Biology I (M44) relationship between dry period length and production and reproduction in grazing Jersey and Holstein cows in Costa Rica. J. M. Sánchez *, A. Saborío-Montero, and A. Córdoba-Roldán,
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
Insulin-induced gene 1 (insig-1) mrna increases dramatically in
Insig-1 brakes lipogenesis in adipocytes and inhibits differentiation of preadipocytes Jinping Li*, Kiyosumi Takaishi*, William Cook*, Sara Kay McCorkle*, and Roger H. Unger* *Touchstone Center for Diabetes
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
Peroxisome proliferator-activated receptor delta regulates lipid droplet formation and transport in goat mammary epithelial cells
J. Dairy Sci. 101:2641 2649 https://doi.org/10.3168/jds.2017-13543 American Dairy Science Association, 2018. Peroxisome proliferator-activated receptor delta regulates lipid droplet formation and transport
Cultured 3T3L1 adipocytes dispose of excess medium glucose as lactate under abundant oxygen availability
1 SUPPLEMENTAL MATERIALS Cultured 3T3L1 adipocytes dispose of excess medium glucose as lactate under abundant oxygen availability David Sabater, Sofía Arriarán, María del Mar Romero, Silvia Agnelli, Xavier
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
LIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
Berberine activates AMPK to suppress proteolytic processing, nuclear translocation and target DNA binding of SREBP-1c in 3T3-L1 adipocytes
MOLECULAR MEDICINE REPORTS 15: 4139-4147, 2017 Berberine activates AMPK to suppress proteolytic processing, nuclear translocation and target DNA binding of SREBP-1c in 3T3-L1 adipocytes JAEWOONG JANG 1,
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids
Project Summary Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids Principal Investigators: S. Smith 1, B. Johnson 2 and M. Doumit 3 Texas A&M University 1, Texas Tech University
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers
number Done by Corrected by Doctor F. Al-Khateeb
number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source
Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR
Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR Yanqiao Zhang, 1,2 Lawrence W. Castellani, 2 Christopher J.
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Biochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer