Supplementary Figure S1
|
|
|
- Marcia Booth
- 5 years ago
- Views:
Transcription
1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao 1,2, Tao Su 1,2, Chi Leung Chan 1, Kim Chung Lee 5,6, Xiuqiong Fu 1,2, Yi Hua 7, Yu Hua 1,2, Li Ting 1,2, Anfernee Kai Wing Tse 1,2, Wang Fun Fong 1,2, Si-Yuan Pan 8, Aiping Lu 1,2, Zhi-Ling Yu 1,2 Supplementary Figure S1 Body Weight (g) A B C D nf-veh nf-schb Body Weight (g) f-veh f-schb Body Weight (g) Control Diet HFD Day Liver weight (% of body weight) Control Diet HFD Supplementary Figure S1. Body weights of mice in (A) non-fasting group (nf), (B) fasting group (f) and (C) HFD-fed group (HFD). (D) Liver weights of HFD -fed mice. nf-veh: non -fasting vehicle control group; nf-schb: non -fasting SchB -treated group; f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD-SchB: HFD-fed SchB-treated group. Shown is the mean ± SE (n=10 mice).
2 Supplementary Figure S2 A B f+veh vs. f+schb Liver f+veh vs. f+schb Plasma C D vs. Liver vs. Plasma Supplementary Figure S2. Molecular network built based on the lipid species in (A) liver and (B) plasma samples in fasting mice; and (C) liver and (D) plasma samples in HFD-fed mice. Lipid entities are represented as nodes, and the biological relationship between two nodes is represented as a line. Colored symbols represents the lipid entities occurred in our analysis, transparent entries are the entities from Ingenuity Knowledge Database. Red symb ols represent up -regulated entities, green symbols represents down-regulated entities. Solid lines between the lipid entities indicate a direct physical relationship between the entities, dotted lines indicate indirect functional relationship. f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD-SchB: HFDfed SchB-treated group
3 Supplementary Figure S3 A B C Relative mrna level * ACC Relative mrna level * SCD Relative mrna level * ELOV Supplementary Figure S3. The relative mrna expressions of (A) acetyl CoA carboxylase (ACC), (B) stearoyl-coa desaturase-1(scd) and (C) elongation of long chain fatty acids family member 6 (ELOV6) in FFA-treated MIHA cells. Shown is the mean ± SE (n=3 independent experiments), *p<0.05.
4 Supplementary Figure S4 f-veh HFD-veh nf-veh FAS Supplementary Figure S4. Hepatic protein expressions of fatty acid synthase (FAS) in fasting, non - fasting and HFD-fed mice. nf-veh: non-fasting vehicle control group; f-veh: fasting vehicle control group; HFD-veh: HFD-fed vehicle control group
5 Supplementary Figure S5 Relative mrna level CPT-1 * Relative mrna level LCAH * 0.0 f-veh f-schb 0.0 f-veh f-schb Supplementary Figure S5. Relative mrna expression of carnitine palmitoyltransferase -1 (CPT-1) and very-long-chain acyl CoA dehydrogenase (LCAH) in fasting mice. f-veh: fasting vehicle control group; f- SchB: SchB-treated fasting group. Shown is the mean ± SE (n=4 mice), *p<0.05.
6 Supplementary Figure S6 A B f+veh f+schb ACC ACC p-acc f+veh f+schb p-acc FAS f+veh f+schb FAS f+veh f+schb Supplementary S6 SchB treatment affects lipogenic gene expressions in long-term HFD-fed mice Western blotting showing the expressions of acetyl CoA carboxylase (ACC), phospho-acc (ser-563) and fatty acid synthase (FAS) in (A) HFD-fed mouse livers, (B) fasting mouse livers and (C) nonfasting mouse livers.. nf-veh: non-fasting vehicle control group; nf-schb: non-fasting SchB-treated group; f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD-SchB: HFD-fed SchB-treated group. (G) expressions of ACC, phospho- ACC (ser-563) and FAS in FFA-treated MIHA cells. FFA: FFA-treated vehicle control MIHA cells; FFA+SchB: FFA-treated SchB-treated MIHA cells.
7 (Cont d) Supplementary Figure S6 C nf+veh nf+schb ACC G ACC nf+veh nf+schb p-acc p-acc nf+veh nf+schb FAS FAS Non-specific band nf+veh nf+schb FFA-treated MIHA Supplementary S6 SchB treatment affects lipogenic gene expressions in long-term HFD-fed mice Western blotting showing the expressions of acetyl CoA carboxylase (ACC), phospho-acc (ser-563) and fatty acid synthase (FAS) in (A) HFD-fed mouse livers, (B) fasting mouse livers and (C) non-fasting mouse livers.. nf-veh: non-fasting vehicle control group; nf-schb: non-fasting SchB-treated group; f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD- SchB: HFD-fed SchB-treated group. (G) expressions of ACC, phospho-acc (ser-563) and FAS in FFAtreated MIHA cells. FFA: FFA-treated vehicle control MIHA cells; FFA+SchB: FFA-treated SchB-treated MIHA cells.
8 Supplementary Figure S7 A B msrebp1 (68kDa) 100kDa HFD+ veh HFD+ SchB psrebp1 (125kDa) msrepb1 (68kDa) TBP C E 100kDa ng/ml TNFα msrebp1 (68kDa) ng/ml TNFα msrebp1 (68kDa) TBP Supplementary S7 SchB treatment affects SREBP-1 expressions in long-term HFD-fed mice Western blotting showing (A) expression of mature sterol regulatory element binding protein-1 (msrebp- 1), (B) ratio of precursor to mature SREBP-1 and (I) tumor necrosis factor (TNF-α) in HFD-fed mouse livers. (C) Protein expression of mature SREBP-1 (msrebp-1) in FFA-treated MIHA cells. FFA: FFAtreated vehicle control MIHA cells; FFA+SchB: FFA-treated SchB-treated MIHA cells. Protein expressions of (E, G) msrebp-1 and (F) FAS upon TNF-α challenges, and (H) protein expressions of TNF-α in FFAtreated MIHA cells. FFA: FFA-treated vehicle control MIHA cells; FFA+SchB: FFA-treated SchB-treated MIHA cells
9 F 100kDa ng/ml TNFα FAS Non-specific bands (Cont d) Supplementary Figure S ng/ml TNFα G Control FFA FFA+antiTNF H msrebp1 (68kDa) Control FFA FFA+antiTNF 25kDa TNFα TBP I 25kDa TNFα Supplementary S7 SchB treatment affects SREBP-1 expressions in long-term HFD-fed mice Western blotting showing (A) expression of mature sterol regulatory element binding protein-1 (msrebp-1), (B) ratio of precursor to mature SREBP-1 and (I) tumor necrosis factor (TNF-α) in HFD-fed mouse livers. (C) Protein expression of mature SREBP-1 (msrebp-1) in FFA-treated MIHA cells. FFA: FFA-treated vehicle control MIHA cells; FFA+SchB: FFA-treated SchB-treated MIHA cells. Protein expressions of (E, G) msrebp-1 and (F) FAS upon TNF-α challenges, and (H) protein expressions of TNF-α in FFA-treated MIHA cells. FFA: FFA-treated vehicle control MIHA cells; FFA+SchB: FFA-treated SchB-treated MIHA cells
10 Supplementary Figure S8 D nf+veh f+veh f+schb E nf+veh f+veh f+schb ATGL Non-specific band ATGL nf+veh f+veh f+schb nf+veh f+veh f+schb HSL HSL nf+veh f+veh f+schb nf+veh f+veh f+schb p-hsl(563) Non-specific band p-hsl(563) Non-specific band nf+veh f+veh f+schb nf+veh f+veh f+schb Non-specific band EA 24 h SA 24 h Supplementary S8 SchB treatment induces transient lipolysis in fasting mice Western blotting showing the expressions of adipose triglyceride lipase (ATGL), hormone sensitive lipase (HSL), phospho-hsl (Ser-563) in adipocytes isolated from the bilateral superficial subcutaneous adipose tissue (SA), prominent bilateral intra-abdominal visceral depots attached to the epididymides (EA) and the perirenal fat (RA) (D-E) 24 h after fasting, (F) 2 h after fasting, (G) 6 h after fasting and (H) 12 h after fasting. nf-veh: non-fasting vehicle control group; nf-schb: non-fasting SchB-treated group; f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD- SchB: HFD-fed SchB-treated group.
11 (Cont d) Supplementary Figure S8 F G ATGL ATGL 100kDa HSL HSL 100kDa 100kDa p-hsl(563) Non-specific band p-hsl(563) Non-specific band Fasting 2 h Fasting 6 h Supplementary S8 SchB treatment induces transient lipolysis in fasting mice Western blotting showing the expressions of adipose triglyceride lipase (ATGL), hormone sensitive lipase (HSL), phospho-hsl (Ser-563) in adipocytes isolated from the bilateral superficial subcutaneous adipose tissue (SA), prominent bilateral intra-abdominal visceral depots attached to the epididymides (EA) and the perirenal fat (RA) (D-E) 24 h after fasting, (F) 2 h after fasting, (G) 6 h after fasting and (H) 12 h after fasting. nf-veh: non-fasting vehicle control group; nf-schb: non-fasting SchB-treated group; f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD- SchB: HFD-fed SchB-treated group.
12 (Cont d) Supplementary Figure S8 H ATGL 100kDa HSL Non-specific band 100kDa p-hsl(563) Fasting 12 h Supplementary S8 SchB treatment induces transient lipolysis in fasting mice Western blotting showing the expressions of adipose triglyceride lipase (ATGL), hormone sensitive lipase (HSL), phospho-hsl (Ser-563) in adipocytes isolated from the bilateral superficial subcutaneous adipose tissue (SA), prominent bilateral intra-abdominal visceral depots attached to the epididymides (EA) and the perirenal fat (RA) (D-E) 24 h after fasting, (F) 2 h after fasting, (G) 6 h after fasting and (H) 12 h after fasting. nf-veh: non-fasting vehicle control group; nf-schb: non-fasting SchB-treated group; f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group; HFD-veh: HFD-fed vehicle control group; HFD- SchB: HFD-fed SchB-treated group.
13 Supplementary Figure S9 D f-veh f-schb LDLR f-veh f-schb Liver E 24h 48h 36h veh SchB veh SchB veh SchB LDLR 24h 48h 36h veh SchB veh SchB veh SchB FFA-treated MIHA Supplementary S9 SchB treatment affects the plasma cholesterol levels in fasting mice Expressions of LDL receptor in (D) and in (E) FFA-treated MIHA cells. f-veh: fasting vehicle control group; f-schb: fasting SchB-treated group.
14
15
16
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
number Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis
Review Article Endocrinol Metab 2017;32:6-10 https://doi.org/10.3803/enm.2017.32.1.6 pissn 2093-596X eissn 2093-5978 The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Young-Ah Moon Department of
Biochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
Synthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
Cornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
LIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Synthesis of Fatty Acids and Triacylglycerol
Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation
Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
NCBA Ground Beef Diet/Health Study
NCBA Ground Beef Diet/Health Study Stephen B. Smith Department of Animal Science Rosemary L. Walzem Department of Poultry Science Texas A&M University Assumptions: Corn-fed beef is healthier than pasture-fed
Regulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
Fatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
The role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
Lipid Metabolism * OpenStax
OpenStax-CNX module: m46462 1 Lipid Metabolism * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able
Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies
Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:
Leen Alsahele. Razan Al-zoubi ... Faisal
25 Leen Alsahele Razan Al-zoubi... Faisal last time we started talking about regulation of fatty acid synthesis and degradation *regulation of fatty acid synthesis by: 1- regulation of acetyl CoA carboxylase
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
MILK BIOSYNTHESIS PART 3: FAT
MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl
Fatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Lipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.
Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis
Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance
Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
GROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM. Caroline Améen
GROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM Caroline Améen Department of Physiology and Wallenberg Laboratory for Cardiovascular Research Sahlgrenska Academy
Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity
Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity F4/80 MCP-1 (After: Xu et al, 2003 JCI vol.112) F4/80+ Cells are
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
ANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
The art of tracing dietary fat in humans. Leanne Hodson
The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:
Department of Medical Biochemistry. Semmelweis University. Dr. Beáta Törőcsik. Lipid metabolism
Department of Medical Biochemistry Semmelweis University Dr. Beáta Törőcsik Lipid metabolism 2017. 10. 13. 2017. 10. 19. 2017. 10. 20. 2017. 10. 26. : not to learn * : structures to learn Harper s Biochemistry
Supplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
Biochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
BIOL2171 ANU TCA CYCLE
TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa
Synthesis and degradation of fatty acids Martina Srbová
Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
NIH Public Access Author Manuscript J Nutr Biochem. Author manuscript; available in PMC 2015 January 01.
NIH Public Access Author Manuscript Published in final edited form as: J Nutr Biochem. 2014 January ; 25(1): 1 18. doi:10.1016/j.jnutbio.2013.09.001. Novel insights of dietary polyphenols and obesity Shu
Regulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
THE EFFECT OF PHARMACOLOGICAL AND DIETARY MODULATORS OF LIPID METABOLISM ON GENE EXPRESSION IN A PORCINE MODEL
THE EFFECT OF PHARMACOLOGICAL AND DIETARY MODULATORS OF LIPID METABOLISM ON GENE EXPRESSION IN A PORCINE MODEL Except where reference is made to the work of others, the work described in this dissertation
Emerging roles of SIRT1 in fatty liver diseases
852 Review Ivyspring International Publisher International Journal of Biological Sciences 2017; 13(7): 852-867. doi: 10.7150/ijbs.19370 Emerging roles of SIRT1 in fatty liver diseases Ren-Bo Ding, Jiaolin
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids
beef marbling Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Bradley J. Johnson Introduction Currently, feedlot producers tend to overfeed pens of cattle to
Fatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116
Fatty acid synthesis Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai 116 Harper s biochemistry 24 th ed, Pg 218 Fatty acid Synthesis Known as
Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F
Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time
Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids
Project Summary Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids Principal Investigators: S. Smith 1, B. Johnson 2 and M. Doumit 3 Texas A&M University 1, Texas Tech University
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
Chapter 2. The Physiology of Fat
Chapter 2 The Physiology of Fat Obesity, generalized and localized collections of adiposity, has become endemic in the United States. It is estimated that 25-40% of US adult females and 20-25% of adult
Inflammatory stress exacerbates ectopic lipid deposition in C57BL/6J mice
Mei et al. Lipids in Health and Disease, : http://www.lipidworld.com/content/// RESEARCH Open Access Inflammatory stress exacerbates ectopic lipid deposition in C7BL/6J mice Mei Mei,, Lei Zhao, Qing Li,
Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
SteatoNet- Modelling steatosis identifies candidate systemic flux distribution
SteatoNet- Modelling steatosis identifies candidate systemic flux distribution deregulations Adviti Naik 1,2, Damjana Rozman 3, Aleš Belič 2* 1 Faculty of Computer Sciences and Informatics, University
Niacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
Production Management: New Lessons from Biology. James E. Metherall, Ph.D., M.B.A. Associate Professor of Human Genetics University of Utah
Production Management: New Lessons from Biology James E. Metherall, Ph.D., M.B.A. Associate Professor of Human Genetics University of Utah Major Points 1) Metabolic Regulation is an Extremely Complex Operations
BCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,