Receptor-mediated activation of ceramidase activity initiates the pleiotropic actions of adiponectin

Transcription

1 correction notice Nat. Med. 7, () Receptor-mediated activation of ceramidase activity initiates the pleiotropic actions of adiponectin William L Holland, Russell A Miller, Zhao V Wang, Kai Sun, Brian M Barth, Hai H Bui, Kathryn E Davis, Benjamin T Bikman, Nils Halberg, Joseph M Rutkowski, Mark R Wade, Vincent M Tenorio, Ming-Shang Kuo, Joseph T Brozinick, Bei B Zhang, Morris J Birnbaum, Scott A Summers & Philipp E Scherer In the version of this supplementary file initially posted online, the Supplementary Methods were not included. The Supplementary Methods are now provided as of 8 July.

2 Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: The Pleiotropic Actions of Adiponectin are Initiated via Receptor-Mediated Activation of Ceramidase Activity Philipp Scherer Supplementary Item & Number (add rows as necessary) Supplementary Figure Supplementary Figure Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Table Supplementary Methods Title or Caption Adiponectin-decreases ceramide accumulation and improves hepatic insulin sensitivity in ob/ob mice. Adenoviral induction of LKB ablation does not alter LKB expression in cardiac or skeletal muscle, but alters sphingolipid metaboic gene expression in liver. Effect of Caspase 8 dimerization or adiponectin overexpression on sphingolipid levels and heart weight Adiponectin preserves functional b cell mass in PANIC ATTAC mice. Adiponectin prevents ceramide overaccumulation and activates ceramidase activity in Ins- b cells independently of AMPK activation. Adiponectin receptor double knockout MEFs are more susceptible to lipid induced cell death and overaccumulate ceramide in caveolar fractions and non-caveolar fractions. Primers for AdipoR and AdipoR constructs and site directed mutagenesis.

3 The Pleiotropic Actions of Adiponectin are Initiated via Receptor Mediated Activation of Ceramidase Activity William L. Holland, Russell A. Miller, Zhao V. Wang, Kai Sun, Brian M. Barth, Hai H. Bui, Kathryn E. Davis, Benjamin T. Bikman, Nils Halberg, Joseph M. Rutkowski, Mark R. Wade, Vincent M. Tenorio, Ming Shang Kuo, Joseph T. Brozinick, Bei B. Zhang, Morris J. Birnbaum, Scott A. Summers and Philipp hl E. Scherer Ceram mide (ng/ml/mg) Glucose disposal (mg/kg g/min) Blood glucose (m mg/dl) 5 a c Ceramide species Supplementary Information Ceram mide (ng per mg wt) ucose kg/min) Hepatic gl utput (mg/ o 5 4 Basal Before bolus After bolus Basal Clamped 6 e 5 f Minutes after insulin (ng/ml) Insulin b d lean obese 6 Time (min) after Before After bolus bolus Clamped Basal Before After bolus bolus Clamped Supplemental Figure. Adiponectin-decreases ceramide accumulation and improves hepatic insulin sensitivity in ob/ob mice. (a) Hepatic concentrations of individual ceramide species were quantified from liver of week old leptin deficient (ob/ob) mice (n=6/group) after a 6-minute treatment with full length adiponectin ( mg/kg, IV). (b) Livers were harvested from week-old leptin deficient (ob/ob) mice (n=4/group),, or 6-minute after treatment with full length adiponectin ( mg/kg, IV) and hepatic ceramide concentrations were quantified. (c-f) Hyperinsulinemic-euglycemic clamps were performed on week-old male ob/ob mice (n=5/group). After initiating hyperinsulinemia ( mu/kg/min), variable infusion of dextrose (5%, iv, Figure B) was used to maintain euglycemia. 3 H-Glucose was infused for 9 minutes prior to insulin delivery and coinfused throughout the 5-hour clamped period. Glucose disposal (c) and hepatic glucose output (d) were calculated from serum samples obtained in triplicate during the basal state (-, -, minutes before insulin), during hyperinsulinemic steady-state (9,, minutes after insulin), and during a final hyperinsulinemic steady-state period after a bolus injection of adiponectin (, mg/kg, IV, minutes post-insulin; 8, 9, minutes after insulin). After initiating hyperinsulinemia, whole blood glucose (e) was determined every minutes by glucometer from a tail nick in ob/ob mice which received a bolus of adiponectin (adn, mg/kg, IV, minutes post insulin) or. (f) Plasma was collected before insulin infusion (- minutes), during the initial clamped steady-state before bolus injections ( minutes), or after bolus injections at the end of the clamped steady-state ( minutes). Insulin concentrations were determined by ELISA. denotes p<.8 compared to minute time-point. denotes p<. compared to basal

4 Hepatic DAG (pmol per mg wt) 5 4 a Lean Lep ob/ob 4 Hepatic DAG (pmol pe er mg wt) b c Chow HFD HFD + Relative mrna expression (Compared to GFP control) d GFP CRE Ceramide synthesis Ceramide metabolism Supplemental Figure. Adenoviral induction of LKB ablation does not alter LKB expression in cardiac or skeletal muscle, but alters sphingolipid metaboic gene expression in liver. (a b) Diacylglycerol levels were quantified from liver of ob/ob mice (a) and dietinduced obese (DIO) mice (b) 6 minutes after administration of recombinant adiponectin ( mg/kg, IV). n=8 per group. denotes significant difference from lean control (p<.5). (c d) LKB(fl/fl) mice were infected with adenovirus encoding either GFP or Cre recombinase 6 days prior to experiments (n=8/group). (c) Liver, heart, or skeletal muscle proteins were resolved by SDS PAGE and western blots probing against LKB and tubulin were performed. (d) RT PCR on β actin, key sphingolipid synthetic enzymes [serine palmitoyltransferase subunits (SPT & SPT), dihydroceramide synthase isoforms (Cers & Cers4), dihydroceramide synthase (Des)], and key ceramide metabolism enzymes [acid ceramidase (AC), glucosylceramide synthase (GCS), ceramide kinase (CK), AdipoR, and AdipoR. Relative expression of genes was determined by comparison with β actin. denotes p<.5 compared to GFP infected treated control group.

5 9 8 a b Ceramid de (p pmol per mg wt) 6 Se erum SP (ng /ml) 6 4 WT HEART ATTAC Tg/+ +/+ rt weight/bo ody weight ratio (mg gl/g) 6 4 c Tg/+ +/+ Hea Age (weeks) Supplemental Figure 3. Effect of Caspase 8 dimerization or adiponectin overexpression on sphingolipid levels and heart weight. (a) Following treatment with AP87 (5 μg/kg, 4 hours), left ventricles were rapidly dissected from wildtype (wt) and HEART ATTAC transgenic mice for quantification of total ceramide (n=8 per group). (b) SP was measured by tandem mass spectrometry from serum of week old mice overexpressing adiponectin (Tg/+) or with wildtype levels of adiponectin (+/+) (N=6/group). (c) Heart weights and body weights were recorded and the ratio of heart weight to body weight was calculated from,, and week old mice overexpressing adiponectin (Tg/+), or from wildtype mice (N=6/group). denotes significant difference from wt mice of the same age (p<.).

6 +/+ +/Tg a / WT PANIC WT PANICTg/Tg 6 4 Tg/+ 4 d 3 +/+ / Serum In S nsulin (ng g/ml) Minutes after Arginine.5.5 Basal Post Glucose f +/+ 5 c / 5 / +/+ 5 / +/+ Blood G Glucose (m mg/dl) Serum Insulin ((ng/ml).5 3 Age (weeks) 4 e / +/+ Ad Mean IIslet Surrface Area (X3 μm) Insu ulin Conte ent (ng/m mg pancreas) 8 b Blood Glucose (m mg/dl) PANIC + AP g 6 9 Minutes After Glucose Vehicle + AP87 5 +/+ / Supplemental Figure 4. Adiponectin preserves functional β cell mass in PANIC ATTAC mice. (a) Pancreata were obtained days after treatment with AP87 (. mg/kg) or vehicle from - week-old male mice overexpressing adiponectin (Tg/+), wildtype for adiponctin (+/+), or lacking adiponectin (-/-). Tissue was sectioned at multiple levels, and islets were imaged after H&E staining with a Nikon Coolscope. Images are representative of 6 animals per condition. with multiple paraffin sections cut in micrometer intervals.(bar=μm). (b) Total pancreatic insulin content was measured from week-old male mice overexpressing adiponectin (+/Tg), wildtype for adiponectin (+/+) or lacking adiponectin di ti ((-/-) / ) on wtt or PANIC ATTAC backgrounds. b k d denotes d t significant i ifi t diff difference between b t PANIC ATTAC transgene t negative ti mice i (WT) and dh homozygous PANIC ATTAC mice i Tg/Tg of the same adiponectin genotype (p<.) N=6/group. (c-g) Metabolic studies were performed on PANIC ATTAC mice. (c) Random fed blood glucose was determined by glucometer in mice lacking adiponectin (-/-) or with wildtype levels of adiponectin (+/+) at indicated ages without AP87 treatment (n=7 per group). denotes significant (p<.) difference between adiponectin transgenic from wt animal of the same treatment. (d) Following injection of L-arginine ( mg/g, IP), serum was collected at indicated time points and insulin concentrations were measured by ELISA ELISA. N=7/group N=7/group. denotes significant (p<.) (p< ) difference between adiponectin transgenic from wt animal of the same treatment. treatment Glucose (e) and insulin (f) ( and minutes) were measured from adiponectin null and wildtype PANIC-ATTAC mice challenged with glucose (mg/g, IP)(n=7 per group). denotes significant (p<.) difference between adiponectin transgenic from wt animal of the same treatment. (g) Pancreas was obtained days after initiating treatment with AP87 (. mg/kg, IP, twice daily for 3 days) or vehicle from - week-old female mice expressing wildtype adiponctin (+/+), or lacking adiponectin (-/-). Tissue was sectioned at multiple levels levels, and islets were imaged after H&E staining with a Nikon Coolscope. Coolscope Islet size was calculated by mean cross-sectional cross sectional area of multicelled islets and reported as microns /islet. N=6/group. Indicates significant effect of dimerizer p<.. Indicates significant difference compared to wildtype mice under the same treatment condition.

7 Ceramid de (Fold ove er control) 4 3 a BSA PAL No Inf BSA PAL BSA PAL wtampk dnampk Viable cells (% total) 9 6 b BSA PAL Ad-AMPK C CER BSA PAL C CER Ad-dnAMPK in ceramide ver basal) Long cha (Fold ov e.5 c C.5 C+ eramide e to initial) C Ce (Relative SP Sphingosine dhsp dhsphingosine Cer--phosphate h dhceramide Ceramide sphingomyelin Glucosylceramide Myriocin.5.5 Sphingolipid concentration (Relative to control) se activity r basal) Ceramidas (fold ove..5 d f MYR.. Adiponectin dpo concentration ce o (μg/ml) Supplemental Figure 5. Adiponectin prevents ceramide overaccumulation and activates ceramidase activity in Ins- β cells independently d of AMPK activation. (a-b) INS- cells were infected with adenovirus encoding wildtype or domininant i negative (K45R)AMPK (5 MOI, h) or left uninfected (No Inf) and maintained for 4 hours before replacing media with % BSA or.75 mm palmitate (in % BSA) with or without adiponectin (3 μg/ml). (a) After 6 hours of lipid exposure, cells were harvested and ceramide was quantified (n=5/group) or (b) cells were washed and cell viability was assessed by MTT assays (presented as % viablility as compared to control cells). N=8 per group from multiple experiments. (c-d) Ins- cells were removed from serum for hours then treated with C ceramide (5 μm) in the presence of myriocin ( μm) or adiponectin (3 μg/ml). Treatments were administered, 4, 8 and 6 minutes prior to harvesting samples by Folch extraction. (c) Long chain (C4-C4) ceramide and (d) C-ceramide content was determined at indicated time points. (n=6/group from 3 separate experiments). (e) Ins- cells were removed to serum-free media for hour, then incubated for hours with full -length adiponectin (.3 μg/ml), the de novo ceramide synthesis inhibitor myriocin ( μm), or. Cells were harvested, and sphingolipid content was determined. Data are presented as fold change as compared to treated cells. N=4 from multiple experiments. (f) Crude lysates of INS- cells were incubated with NBD-ceramide with or with adiponectin added in vitro at increasing doses. Data are reported as the fold increase in ceramidase activty as compared to (non adiponectin control). N=4 from separate experiments. denotes significant difference from basal (p<.5). denotes p<.5 compared to treated control. Nature denotes Medicine: significant doi:.38/nm.77 (p<.5) effect of adiponectin. denotes significant (p<.5) effect of lipid.

8 Dead Cells (% total) 4 a Vehicle SP ) BSA Palmitate C Ceramide b Adiponectin Fraction # WT MEF RR DKO MEF WT MEF RR DKO MEF Fraction # Adiponectin Supplemental Figure 6. Adiponectin receptor double knockout MEFs are more susceptible to lipid induced cell death and overaccumulate ceramide in caveolar fractions and non-caveolar fractions. (a) MEFs deficient for both AdipoR and AdipoR were removed from serum and maintained i for 6 hours in % BSA, % BSA conjugated to palmitate t (.75 mm), or % BSA containing C- ceramide (5 μm). Cell viability was assessed by MTT assay. N=8, from multiple experiments. denotes a significant effect of the pro-apoptotic lipid treatment (p<.). denotes a significant (p<.5) effect of SP. (b) After hours of treatment with adiponectin (3 μg/ml, Right 6 lanes), embryonic fibroblasts (8% confluent) were washed twice in cold, scraped into ml of MBS (5 mm Mes, ph 6.5, 5 mm NaCl) containing % Triton X-, passed 5 times through a loose fitting Dounce homogenizer, and mixed with an equal volume of 8% sucrose (prepared in MBS lacking Triton X-). The sample was then transferred to a -ml ultracentrifuge tube and overlaid with a discontinuous sucrose gradient (4 ml of % sucrose, 4 ml of 5% sucrose, both prepared in MBS, lacking detergent). The samples were subjected to centrifugation at, g (39, rpm in Sorval rotor TH-64) for 6 h. A light scattering band was observed at the 5/% sucrose interface. Twelve -ml fractions were collected, and lipids were extracted for radioactive assessment of ceramide. 3 P labeled ceramide- phosphate was resolved by TLC, visualized on a Storm phosphorescent p imager after phosphorylation p by DAG kinase. Quantifiaction of lanes 3-6 correspond to caveolin-enriched fractions indicates that adiponectin decreased raft-associated ceramides by 3% in wt (but not DKO) MEFs.

9 Supplemental Table. Primers for AdipoR and AdipoR constructs and site directed mutagenesis. AdipoR and AdipoR were cloned from a mouse liver cdna library. A carboxy-terminal flag tag was introduced to allow for expression verification by western blot; BamH and EcoR cloning sites were introduced to allow ligation into the pcdna3. backbone. Site directed mutagenisis allowed for the point mutation of histidine (residues 4 and 9 in AdipoR, residues 5 and in AdipoR) to arginine. Altered bases are shown in bold. Primers for Apn R and R constructs Name Sequence Forward AdipoR BamH cgggatccgccgccaccatgtcttcccacaaag Reverse AdipoR Flag atcgtcgtccttgtagtcgagaagggagtcgtc Reverse AdipoR BamH cgggatcctcacttgtcatcgtcgtccttgtag Forward AdipoR BamH cgggatccgccgccaccatgtcttcccacaaag Reverse AdipoR Flag atcgtcgtccttgtagtccagtgcatcctcttc Reverse AdipoR EcoR ggaattctca cttgtcatcgtcgtccttgtag Forward AdipoR His4Arg ctggcaacatctggacacgtctgcttggttttgtg Reverse AdipoR His4Arg cacaaaaccaagcagacgtgtccagatgttgccag Forward AdipoR His9Arg ctcctggctcttccgcactgtctactgtcattc Reverse AdipoR His9Arg gaatgacagtagacagtgcggaagagccaggag Forward AdipoR His5Arg gcaacatttggacacgtctcctaggttgtgtattc Reverse AdipoR His5Arg gaatacacaacctaggagacgtgtccaaatgttgc Forward AdipoR HisArg cttttcatggctcttccgcacggtgtactgccact Reverse AdipoR HisArg agtggcagtacaccgtgcggaagagccatgaaaag

10 Supplementary Methods Lipid Standards and quantification Labeled 8: sphingosine (Sph), 6:, 8: and 4: Ceramides (Cer), 6:, 7:, 8:, 4: GM3 and were synthesized internally at Eli Lilly and Company. Ceramides, sphingosines, sphingosine--phosphate, dihydrosphingosine--phosphate, glucosylceramides, and GM3 levels were quantified by the ratio of analyte and internal standard and calibration curves obtained by serial dilution of a mixture of sphingolipids. Hyperinsulinemic-Euglycemic Clamps Ten week-old male ob/ob (C57Bl6J) mice were anesthetized under isoflurane anesthesia, and chronic indwelling silicone catheters were aseptically placed in the right jugular vein and animals were allowed 5 days to recover to preoperative weight. After initiating hyperinsulinemia ( mu/kg/min), variable infusion of dextrose (5%, iv, Figure B) was used to maintain euglcemia (~5 mg/dl). Whole blood glucose was monitored every minutes by glucometer from a tail nick. An iv bolus of adiponectin (adn, mg/kg, IV, minutes post insulin) or (.ml) was given through after achieving an initial clamped state. 3 H-Glucose was infused for 9 minutes prior to insulin delivery and co-infused throughout the 5-hour clamped period. Glucose turnover and hepatic glucose output were calculated from triplicate serum samples obtained during basal state (-, -, minutes before insulin), during a steady-state clamped state (9,, minutes after insulin), and after a bolus injection of adiponectin (, mg/kg, iv, minutes post-insulin) during a final steady-state period (8, 9, minutes after insulin; 6-8 minutes after adiponectin).

11 Ceramidase Activity Assays Cells were removed from serum for hours, washed twice in cold, and scraped into ice cold buffer B [5 mm Tris-HCl (ph 7.4), 5 mm CaCl, protease inhibitor cocktail]. After brief sonication, μl (containing approximately 5 μg protein) of lysate was added to resuspended NBD-ceramide and reactions were allowed to proceed for 9 minutes at 37 C. Reactions were stopped by boiling, dried by speed-vac, resuspended in : chloroform:methanol, and resolved by TLC [(9::.5 chloroform:methanol:ammonium hydroxide(5%) on Silica gel 6 plates]. The resulting NBD-stearate was identified and quantified relative to NBD-stearate standards, and ceramidase activity was normalized to protein content (BCA assay).