a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!
|
|
- Angelina Sherman
- 5 years ago
- Views:
Transcription
1 a! b! c! Diamet (μm) WT Nogo-A/B-deficient PE (LogM) Diamet (μm) U-419 (LogM) Diamet (μm) S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos! β-actin! enos/β-actin (a.u.) WT Nogo-A/B-deficient e! WT! Nogo-A/B-deficient! nnos! β-actin! Aorta! nnos/β-actin (a.u.) Supplementary Fig. 1! Nature Medicine: doi.138/nm.3934
2 b! e r ** ** pmol*mg-1*ml-1 25 pmol*mg-1*ml-1 Nogo-A/B-deficient pmol*mg-1*ml-1 Total camide (pmol*mg-1*ml -1) WT 2 dh d! c! ontrol! myriocin.3 nm! myriocin 1 nm! dh -S 1P dh Sp h Sp h S1 P e! Sphinganine inhibition (%) a! Dose (nmol/l) myriocin 3 nm! ! HUVE + myriocin (nm)!! SM! PS.1 e nin ga hin de! Sp ami r e myriocin 1 nm! f! microsomes! WT! soluble! fraction! Ng-A/BNg-A/Bdeficient! WT! deficient!! myriocin 3 nm! L! alnexin! HSP9! Supplementary Fig. 2! Nature Medicine: doi.138/nm.3934
3 Nature Medicine: doi.138/nm.3934
4 a! Nogo-A/Bf/f! b! VE-cadhin! αsma! HSP9! c! VE-cadhin! IB4! αsma! HSP9!.8.4. Supplementary Fig. 4! Nature Medicine: doi.138/nm g! f! E VSM E VSM Nogo-A/Bf/f SM-Nogo-A/B-deficient h! 1 % Initial diamet e! Nogo Nogo-A/Bf/f E-Nogo-A/B-deficient 1. Nogo d! VE-cadhin α-sma! αsma E-! Nogo-A/B-deficient! α-sma! SM-! Nogo-A/B-deficient! 5 μm! Nogo-A/Bf/f E-NogoA/B-deficient SM-NogoA/B-deficient Phe (LogM)
5 SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. The loss of Nogo-B does not affect the vasoconstriction in response to pharmacological agents. oncentration-response curves of WT and Nogo-A/B-deficient MA in response to (a) PE, (n = 8 WT vs. n = 7 Nogo-A/B-deficient), (b) U-419, (n = 5 p group) and (c) S1P (n = 1 WT vs. n = Nogo-A/B-deficient). WB analysis and relative quantification of (d) enos on MLE from WT and Nogo-A/Bdeficient mice, n = 4 isolations p group, and (e) nnos on WT and Nogo-A/B-deficient aortas (n = 4 aortas from 4 mice p group). β-actin was used as loading control. Data we expressed as the mean ± s.e.m. **P<.1 compared to WT group. Statistical significance was detmined by two-way ANOVA followed by Bonfroni s post-test (a c) and unpaired t-test (d e). Supplementary Figure 2. Sphingolipids levels in vascular SM and SPT assay in E. WT and SM-Nogo- A/B-deficient (a) total camide levels and (b) individual sphingolipid species measured by L/MS as described in Methods. n = 4 independent VSM isolation/group; five mice we used for each VSM isolation. Mean ± s.e.m. (c) Pharmacological inhibition of SPT activity by increasing concentrations of myriocin in HUVE. The inhibition was assessed using [ 3 H]sine as substrate in endothelial cell lysates as described in Methods. amide-8 (camide), sphinganine, phosphatidylsine (PS) and sphingomyelin-8 (SM). (d) Extracted lipids we separated by TL and [ 3 H]sphinganine was detected by using TL scann (TL analyz RITA, Raytest Straubenhardt) and reading values we quantified using a standard curve of [ 3 H]sine. (e) Inhibition of SPT activity, expressed as pcent of the control, by increasing concentrations of myriocin. (f) WB analysis for Nogo-B, SPTL, alnexin and HSP9 in microsomes isolated from WT and Nogo-A/Bdeficient mouse lung. Unpaired t-test was pformed to evaluate the statistical significance. Supplementary Figure 3. Effects of W14 and myriocin on vascular tone regulation. (a) Ach cumulative concentration-response curve in WT mesentic arties treated with myriocin (.3 mg/kg i.p.) or vehicle in presence of L-NAME, (left, n = 7 p group), indomethacin, (middle, n = 13 vehicle vs. n = 9 myriocin), and their combination, (right, n = 5 vehicle vs. n = myriocin). (b) oncentration-response curve of S1P in MA from WT and Nogo-A/B-deficient mice incubated with L-NAME or vehicle. n = 4 p group. (c) WT mesentic arties treated with W14 (1 nm, 45 min) or vehicle, we incubated with L-NAME and the increase in the basal tone was measured as intnal diamet decrease ov the baseline. (n = 11 ctrl vs. n = 5 W14 1 nm). (d) The active diamet of WT mesentic arties treated with diffent concentrations of W14 or vehicle in response to stepwise increase in intraluminal pressure. (n = 12 ctrl vs. n = 5 W14 1 nm and 1 μm). (e) Vasoconstriction induced by PE following W14 treatment of WT mesentic arties. (n = 8 ctrl vs. n = 9 W14 1 nm). (f) Ach-induced vasodilation in WT mesentic arties following W14 (1 nm) treatment. Given that basal and PE-stimulated tone is diffent aft W14 treatment, the following data are expressed as Nature Medicine: doi.138/nm.3934
6 absolute intnal diamet (μm) of MA. (n = 21 ctrl vs. n = 7 W14 1 nm). (g) In anoth set of expiments, aft incubation with W14, Ach cumulative concentration-response curve was pformed in presence of: L- NAME (left, (n = 8 ctrl vs. n = 5 W14 1 nm),.indomethacin (middle, n = 7 p group) and their combination (right, n = p group). (h) Schematic summary of myriocin and W14 effects on the vascular tone. Data are expressed as the mean±s.e.m. *P<.5; **P<.1 compared to vehicle. Statistical significance was detmined by two-way ANOVA followed by Bonfroni s post-test (a b, d g) and unpaired t-test (c). Supplementary Figure 4: haractization of the re-mediated excision of Nogo-B in E and VSM of E- Nogo-A/B-deficient and SM-Nogo-A/B-deficient mice. (a) IF staining of MA cross-sections for: (top panels) Nogo-B (red) and α-smooth muscle actin (αsma; green) in NogoA/B f/f MA; (central panels) Nogo-B (red) and E with isolectin-b4 (IB4, green) in SM-Nogo-A/B-deficient MA; and (bottom panels) Nogo-B (red) and αsma (green) in SM-Nogo-A/B-deficient MA. (b) Westn blot analysis for Nogo-B in E isolated from NogoA/B f/f and E-Nogo-A/B-deficient lungs. (c) Westn blot analysis for Nogo-B in VSM isolated from NogoA/B f/f and SM-Nogo-A/B-deficient thoracic aortas as described in Methods. Heat shock protein 9 (HSP9) was used as loading control. Vascular endothelial cadhin (VE-cadhin) and αsma we used as lineage marks of E and smooth muscle cells/fibroblasts, respectively. (d) RT-PR for Nogo-B in E isolated from NogoA/B f/f and E-Nogo-A/B-deficient lungs; RT-PR for (e) αsma and (f) VE-cadhin in endothelial and smooth muscle cells mrna isolated from NogoA/B f/f and SM-Nogo-A/B-deficient thoracic aortas as described in Methods. (g) Nogo-B expression of thoracic aorta VSM mrna isolated from NogoA/B f/f and SM-Nogo-A/B-deficient mice (h) PE-concentration-response curves of Nogo-A/B f/f, E-Nogo- A/B-deficient and SM-Nogo-A/B-deficient MA. Nature Medicine: doi.138/nm.3934
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationa 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationSUPPLEMENTAL DATA. Lumen area ( m 2 )
Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental
More informationmtorc2 controls actin polymerization required for consolidation of long-term memory
CORRECTION NOTICE Nat. Neurosci.; doi:1.138/nn.3351 mtorc2 controls actin polymerization required for consolidation of long-term memory Wei Huang, Ping Jun Zhu, Shixing Zhang, Hongyi Zhou, Loredana Stoica,
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationAdiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular
Supplemental Data Adiponectin/herin system enhances exosome biogenesis and decreases cellular ceramides by exosomal release 5 Yoshinari Obata, Shunbun Kita, *,, Yoshihisa Koyama, Shiro Fukuda, Hiroaki
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1
Supplementary Figure 1 ZV 50 nm Relative to Protein Levels () C Relative to Protein Levels () 6 4 2 0 10 8 6 4 2 0 Treatment Time (6 h) ZV Concentration (25 µm) ZV Concentration (25 µm) Supplementary Figure
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationmm Distance (mm)
b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human
Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human dpasmcs (a) and PAECs (b) treated with IL-1β (1 ng ml -1
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationBoucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Information
Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationSupplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
More informationdoi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationCathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury
Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,
More informationSupplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSocial deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationXiangde Liu, Amy Nelson, Xingqi Wang, MahaFarid, Yoko Gunji, Jun Ikari, ShunIwasawa, HeshamBasma, Carol Feghali-Bostwick, Stephen I.
Online Data Supplement Vitamin D Modulates PGE 2 Synthesis and Degradation in Human Lung Fibroblasts Xiangde Liu, Amy Nelson, Xingqi Wang, MahaFarid, Yoko Gunji, Jun Ikari, ShunIwasawa, HeshamBasma, Carol
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More information