Bile-acid synthesis is the major mechanism to

Transcription

1 AUTOIMMUNE, CHOLESTATIC AND BILIARY DISEASE Mechanism of Tissue-Specific Farnesoid X Receptor in Suppressing the Expression of Genes in Bile-Acid Synthesis in Mice Bo Kong, 1 Li Wang, 2 John Y.L. Chiang, 3 Youcai Zhang, 1 Curtis D. Klaassen, 1 and Grace L. Guo 1 Activation of farnesoid X receptor (Fxr, Nr1h4) is a major mechanism in suppressing bileacid synthesis by reducing the expression levels of genes encoding key bile-acid synthetic enzymes (e.g., cytochrome P450 [CYP]7A1/Cyp7a1 and CYP8B1/Cyp8b1). FXR-mediated induction of hepatic small heterodimer partner (SHP/Shp, Nr0b2) and intestinal fibroblast growth factor 15 (Fgf15; FGF19 in humans) has been shown to be responsible for this suppression. However, the exact contribution of Shp/Fgf15 to this suppression, and the associated cell-signaling pathway, is unclear. By using novel genetically modified mice, the current study showed that the intestinal Fxr/Fgf15 pathway was critical for suppressing both Cyp7a1 and Cyp8b1 gene expression, but the liver Fxr/Shp pathway was important for suppressing Cyp8b1 gene expression and had a minor role in suppressing Cyp7a1 gene expression. Furthermore, in vivo administration of Fgf15 protein to mice led to a strong activation of extracellular signal-related kinase (ERK) and, to a smaller degree, Jun N-terminal kinase (JNK) in the liver. In addition, deficiency of either the ERK or JNK pathway in mouse livers reduced the basal, but not the Fgf15-mediated, suppression of Cyp7a1 and Cyp8b1 gene expression. However, deficiency of both ERK and JNK pathways prevented Fgf15-mediated suppression of Cyp7a1 and Cyp8b1 gene expression. Conclusion: The current study clearly elucidates the underlying molecular mechanism of hepatic versus intestinal Fxr in regulating the expression of genes critical for bile-acid synthesis and hydrophobicity in the liver. (HEPATOLOGY 2012;56: ) Abbreviations: AP1, activating protein 1; CA, cholic acid; CDCA, chenodeoxycholic acid; CYP, cytochrome P450; Cyp7a1, cholesterol 7ahydroxylase; Cyp8b1, sterol 12a-hydroxylase; DKO, double knockout; Egr1, early growth response 1; ERK, extracellular signal-regulated kinase; FXR, farnesoid X receptor; FGF15/19, fibroblast growth factor 15/19; FGFR4, fibroblast growth factor receptor 4; HNF4a, hepatocyte nuclear factor 4 alpha; JNK, Jun N- terminal kinase; LRH-1, liver homolog-1; KO, knockout; MAPK, mitogenactivated protein kinase; mrna, messenger RNA; perk, phosphorylated ERK; pjnk, phosphorylated JNK; SHP, small heterodimer partner; shrna, short hairpin RNA; Tg, transgenic; WB, whole body; WT, wild type. From the 1 Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS; 2 Department of Oncological Sciences, University of Utah, Salt Lake City, UT; and 3 Department of Biochemistry and Molecular Pathology, Northeast Ohio Medical University, Rootstown, OH. Received October 13, 2011; accepted March 19, This work was supported by National Institutes of Health funds (P20 RR CDK, DK GLG, R01DK44442-JYLC, and R37DK JYLC). Address reprint requests to: Grace Guo, Ph.D., Department of Pharmacology, Therapeutics, and Toxicology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS lguo@kumc.edu; fax: Copyright VC 2012 by the American Association for the Study of Liver Diseases. View this article online at wileyonlinelibrary.com. DOI /hep Potential conflict of interest: Nothing to report. Additional Supporting Information may be found in the online version of this article. Bile-acid synthesis is the major mechanism to remove extra cholesterol from the body. Bile acids are required for the absorption of lipids and lipid-soluble vitamins from the intestine. Bile acids activate members of the nuclear receptor superfamily, including farnesoid X receptor (FXR/Fxr; encoded by the NR1H4/Nr1h4 gene), pregnane X receptor, vitamin D receptor, 1-5 and a G-protein-coupled receptor, TGR5, 6 which is a critical mechanism for maintaining endobiotic and xenobiotic homeostasis. Two enzymatic pathways are responsible for bileacid synthesis in the liver. The classical pathway generates cholic acid (CA), and the alternative pathway produces chenodeoxycholic acid (CDCA). The cholesterol, 7a-hydroxylase, encoded by the cytochrome P450 (CYP) 7A1/7a1 (CYP7A1/Cyp7a1) gene, is the rate-limiting enzyme in the classical pathway. The sterol, 12a-hydroxylase, encoded by the CYP8b1/Cyp8b1 gene, mediates the production of CA, and cholesterol is converted only to CDCA when CYP8b1/Cyp8b1 is deficient. Because CA is less hydrophobic than CDCA, CYP8B1/Cyp8b1 is critical in regulating the 1034

2 HEPATOLOGY, Vol. 56, No. 3, 2012 KONG ET AL hydrophobicity of the bile-acid pool by regulating the CA/CDCA ratio. Bile-acid synthesis is tightly regulated because disruption of bile-acid homeostasis leads to hepatobiliary and intestinal disorders, including cholestasis, gallstone disease, and inflammatory bowel disease, as well as systemic diseases, such as atherosclerosis. 7 Feedback suppression of CYP7A1/Cyp7a1 and CYP8B1/Cyp8b1 gene transcription by nuclear receptors and inflammatory cytokines is the most important mechanism in maintaining bile-acid homeostasis in humans and mice. 8 Under physiological conditions, the activation of FXR is the major mechanism to suppress bile-acid synthesis by directly inducing target genes in both the liver and intestine, including small heterodimer partner (SHP/ Shp; encoded by the NR0B2/Nr0b2 gene) and fibroblast growth factor (Fgf) 15 (FGF19 in humans), which, in turn, inhibits, or activates signaling pathways to inhibit, CYP7A1/Cyp7a1 and CYP8B1/Cyp8b1 gene transcription Specifically, FXR/Fxr induces the expression of SHP/Shp in the liver, which, in turn, inhibits liver homolog-1 (LRH-1/Lrh-1)-induced gene transcription of CYP7A1/Cyp7a1 and CYP8b1/ Cyp8b1. 12,13 In contrast, Fxr induces Fgf15 in the intestine, and released Fgf15 activates its receptor, fibroblast growth factor receptor 4 (Fgfr4) in the liver, to activate mitogen-activated protein kinase (MAPK)- signaling pathways. It has been shown that the activation of extracellular signal-regulated kinase (ERK) in humans and Jun N-terminal kinase (JNK) in rats mediates the suppression of CYP7A1/Cyp7a1 gene expression. 11,14 Furthermore, Shp is reported to be required by Fgf15 to suppress Cyp7a1 gene expression. 9 However, the exact contribution of Shp and Fgf15 to the suppression of bile-acid synthesis after tissue-specific activation of FXR is not known. Furthermore, the exact signaling pathways in the liver with Fgf15 activation are not clear in mice. Elucidating these underlying molecular mechanisms will help to establish the mechanism of the regulation of bile-acid synthesis by FXR/Fxr activation, which will aid in determining future strategies in the treatment of cholesterol and bile-acid disorders by tissue-specific activation of FXR to increase efficacy and, meanwhile, reduce toxic effects resulting from nonspecific activation of FXR. In the current study, by using novel genetically modified mice with various combinations of Fxr, Shp, Fgfr4, early growth response 1 (Egr1), or cjun deletion, as well as purified Fgf15 protein, 15 the contribution of the intestinal Fxr/Fgf15 and the hepatic Fxr/ Shp pathways to the suppression of Cyp7a1 and Cyp8b1 in mice was determined. In addition, whether Shp is required for Fgf15-mediated suppression of Cyp7a1 and Cyp8b1 gene expression was established in mice. Finally, the effect of MAPK-pathway activation on basal and Fgf15-mediated suppression of Cyp7a1 and Cyp8b1 gene expression was determined. Materials and Methods Reagents. GW4064 was provided by the University of Kansas (Kansas City, KS). Other reagents, unless mentioned, were obtained from Sigma-Aldrich (St. Louis, MO). Animals. Whole body (WB) Fxr knockout (KO) mice (Fxr WB KO) were reported on and were on a pure C57BL/6J genetic background. 16,17 The generation of tissue-specific Fxr KO mice on a mixed genetic background has been described previously using loxp/ Cre technology with specific disruption of the Nr1h4 gene in hepatocytes (Fxr Liv KO) or in enterocytes (Fxr Int KO). 18 Specifically, Fxr Liv KO and Fxr Int KO mice were generated by cross-breeding Fxr floxed/ floxed mice with albumin cre (þ) or villin cre (þ) mice. But, these mice were on a mixed genetic background with variable basal expression of bile-acid synthetic genes. So, in the current study, congenic Fxr Liv KO and Fxr Int KO mice in the C57BL/6J genetic background were produced. Shp KO mice and hepatocyte-specific Shp transgenic (Tg) mice (albumin promoter derived, Shp Tg) have been reported on. 19,20 Fxr WB KO mice with hepatocyte-specific Shp overexpression (Fxr WB KO/Shp Tg) were generated by crossing Fxr WB KO mice with Shp Tg mice, with all three strains on the pure C57BL/6J genetic background. Fgfr4 KO mice on a mixed C57/129SvJ background were provided by Dr. Curtis Klaassen (University of Kansas Medical Center). Fgfr4/Shp double-ko (Fgfr4/Shp DKO) mice were generated by cross-breeding Fgfr4 KO and Shp KO mice. Egr1 KO mice on a C57BL/6 genetic background were obtained from Taconic (Hudson, NY). C57BL/6J mice bred in the same animal facility were used as wild-type (WT) controls for KO mice on the C57BL/6J background. If KO mice were on a mixed genetic background (Fgfr4 KO and Fgfr4/Shp DKO), littermates were used as controls. Animal Treatment. Mice were bred and maintained in the laboratory animal research facility at the University of Kansas Medical Center in rooms under a 12- hour light-dark cycle. All protocols were approved by the institutional animal care and use committee. All experiments used week-old male mice, and all

3 1036 KONG ET AL. HEPATOLOGY, September 2012 mice were sacrificed within a 30-minute period in the morning. In addition, all treatments were repeated twice. The activation of Fxr in vivo was achieved by treatment with an Fxr synthetic agonist (GW4064) at 150 mg/kg. GW4064 or vehicle was administered by oral gavage at 6 p.m., followed by a second administration at 8 a.m. the next morning. Two hours later, the liver and ileum were harvested. The generation of purified Fgf15 has been reported on previously. 15 Fgf15 protein was injected into mice through the tail vein at a dosage of 10 lg/kg. Two hours or at indicated time points (for time-course study) after injection, livers were collected. Total bile-acid pool size was determined by measuring bile acids of the small intestine, gallbladder, liver, and their contents. Ten 16-week-old mice were fed a chow diet with 2% cholestyramine for 10 days. Total bile acids were determined using a kit from Bio-Quant Inc. (San Diego, CA), and pool size was expressed as micromoles of bile acids/100 g of body weight. Lentivirus-Mediated Short Hairpin RNA Knockdown of cjun In Vivo. Lentiviral vectors ( IU/mL) expressing short hairpin RNA (shrna) against cjun (plko.1-puro vector, containing the sequence, CCGGCAGTAACCCTAAGATCCTAAAC TCGAGTTTAGGATCTTAGGGTTACTGTTTTTG) was produced by Capitol Science, Inc. (Austin, TX). Lentiviral particles containing the cjun-shrna were injected into WT and Egr1 KO mice at IU/ kg of body weight. Ten days later, WT and Egr1 KO mice were separated into two groups and treated with saline or purified recombinant Fgf15 protein, with livers collected 2 hours later. RNA Isolation and Quantitative PCR Analysis. Total RNA isolation and messenger RNA (mrna) levels were determined by the standard quantitative polymerase chain reaction method. 18S RNA levels were used as the normalization control, with primers listed in Supporting Table 1. Western Blotting. Protein from livers was extracted and phosphorylated JNK1/2, ERK1/2, and p38 as well as total cjun were determined by western blotting using anti-phospho-mapk specific antibodies and anti-cjun antibody (Cell Signaling Technology, Beverly, MA). Statistical Analysis. All experimental data are expressed as the mean 6 standard deviation. Differences among multiple groups were tested using two-way analysis of variance. Differences between two groups were tested by the Student s t test. A P value of <0.05 was considered statistically significant. Results Fxr in Enterocytes Suppressed Both Cyp7a1 and Cyp8b1 Gene Expression, but Fxr in Hepatocytes Mainly Suppressed Cyp8b1 Gene Expression. A slight increase in bile-acid pool size was observed in Fxr Liv KO and Fxr Int KO mice (Fig. 1B). Cholestyramine decreased pool size by 50% in all mice (Fig. 1A,B). In the intestine, Fxr activity was decreased with the decreased pool size (Fig. 1C), as indicated by decreased Ibabp and Fgf15 levels, whereas Fxr mrna levels did not change. Hepatic Fxr mrna levels were increased by 2-fold in WT and Fxr Int KO mice by cholestyramine (Fig. 1D). Moreover, hepatic Shp mrna levels were increased by approximately 3-fold by cholestyramine through an Fxr-independent mechanism, and a similar increase was observed in Fxr Liv KO mice. Furthermore, decrease of pool size promotes bile-acid synthesis, as revealed by an 8- to 10-fold induction of Cyp7a1 in WT mice and FXR Liv KO mice and a 3-fold induction of Cyp8b1 in all mice (Fig. 1D), indicating that an increase in hepatic bile acids and/or Shp induction is not responsible for suppressing bile-acid synthesis. In addition, basal mrna levels of Cyp7a1 increased in Fxr Int KO mice, but not in Fxr Liv mice, which is reciprocal to the reduced Fgf15 levels in the intestine. Cholestyramine did not further increase Cyp7a1 mrna levels in FXR Int KO mice (Fig. 1D). In contrast, Cyp8b1 mrna levels were increased upon cholestyramine in both Fxr Liv KO and Int KO mice (Fig. 1D), suggesting that Fxr in enterocytes suppresses both Cyp7a1 and Cyp8b1, but in hepatocytes, Fxr mainly suppresses Cyp8b1. The effect of tissue-specific activation of Fxr on Cyp7a1 and Cyp8b1 mrna levels was also determined by activating Fxr using GW4064. Cyp7a1 mrna levels were markedly reduced in WT and Fxr Liv KO mice, but not in Fxr Int KO mice (Supporting Fig. 1). Fxr-Mediated Shp Induction Contributed to the Suppression of Cyp8b1, but Not Cyp7a1, Gene Expression. Induction of Shp and Fgf15 by Fxr activation is known to suppress Cyp7a1 and Cyp8b1 gene expression in the liver. However, it is unclear to what degree Shp and Fgf15 contributes to this suppression. Therefore, this study used Shp KO and Shp Tg mice to determine the contribution of Shp in suppressing Cyp7a1 and Cyp8b1 gene expression. In Shp KO mice, activation of Fxr still markedly suppressed Cyp7a1 to approximately 10% of the levels in vehicle-treated mice (Fig. 2A), though the degree was smaller than that in WT mice (99% suppression). In Shp Tg mice with Shp overexpressed in hepatocytes, basal Cyp7a1 mrna levels did not change, nor

4 HEPATOLOGY, Vol. 56, No. 3, 2012 KONG ET AL Fig. 1. Effect of 2% cholestyramine feeding for 10 days on bileacid pool size in tissue-specific Fxr KO mice. (A) Cholestyramine is a bile-acid sequestrant that binds bile acids in the intestine to prevent their reabsorption. As a result, this decreases the feedback suppression of hepatic bile-acid synthesis from cholesterol. (B) Effect of cholestyramine feeding on bileacid pool size in Fxr Liv KO and Fxr Int KO mice. (C) Effect of cholestyramine feeding on mrna levels of Fxr, Fgf15, and Ibabp in the ileum in Fxr Liv KO and Fxr Int KO mice. (D) Effect of cholestyramine feeding on mrna levels of Fxr, Cyp7a1, Cyp8b1, and Shp in the liver in Fxr Liv KO and Fxr Int KO mice (n ¼ 5 male mice per group). An asterisk (*) indicates P < 0.05 between vehicle- and cholestyramine-fed mice within the same genotype. did the degree of Cyp7a1 suppression after Fxr activation (Fig. 2B). Furthermore, in the FXR KO/Shp Tg mice that are deficient in Fxr but overexpressed Shp, levels of Cyp7a1 mrna were not affected by Shp overexpression either (Fig. 2B). These results indicate that with Fxr activation, Shp may play only a minor role in suppressing Cyp7a1 gene expression. Interestingly, in Shp KO mice, basal Cyp8b1 mrna levels were 2.5-fold higher than those in WT mice. Fxr activation suppressed Cyp8b1 mrna levels in Shp KO mice, but the degree of suppression (an approximate 30% decrease) in Shp KO mice was smaller than that in WT mice (50% decrease) (Fig. 2A). Furthermore, in Shp Tg mice, Cyp8b1 mrna levels were only slightly reduced and were further decreased upon Fxr activation, but the degree of suppression was similar to that in WT mice (Fig. 2B). Exogenous Fgf15 Protein Administration Reduced Both Cyp7a1 and Cyp8b1 mrna Levels. Fgf15 has been shown to be important in suppressing Cyp7a1 and Cyp8b1 gene expression. Furthermore, it was reported that the Fgf15-mediated suppression requires Shp Therefore, in the current study, we determined to what degree Fgf15 mediates the suppression of Cyp7a1 and Cyp8b1 gene expression after Fxr activation. In addition, by using Shp KO mice, we tested whether the Fgf15-mediated suppression of Cyp7a1 and Cyp8b1 requires Shp. The effect of purified recombinant Fgf15 protein on Cyp7a1 mrna levels was determined in WT, Fxr WB KO, Shp KO, Shp

5 1038 KONG ET AL. HEPATOLOGY, September 2012 Fig. 2. Effect of Shp deficiency or hepatic overexpression on relative mrna levels of Cyp7a1, Cyp8b1, and Shp in the liver as well as on mrna levels of Fgf15 in the intestine. (A) mrna levels of hepatic Fxr, Cyp7a1, Cyp8b1, Shp, and intestinal Fgf15 in WT, Fxr WB KO, and Shp KO mice with or without treatment with GW4064. (B) mrna levels of hepatic Fxr, Cyp7a1, Cyp8b1, Shp, and intestinal Fgf15 in WT, Fxr WB KO, Shp Tg, and Fxr KO/Shp Tg mice with or without GW4064 treatment (n ¼ 5 male mice per group). A pound sign (#) indicates P < 0.05 between genetically modified and WT mice; an asterisk (*) indicates P < 0.05 between GW4064- treated and vehicle-treated mice within the same genotype. Tg, and Fxr KO/Shp Tg mice. Compared with vehicle treatment, the Fgf15 protein resulted in a strong reduction of Cyp7a1 mrna levels in all strains (Fig. 3), with 1%, 10%, 10%, 5%, and 10% of Cyp7a1 mrna left, respectively, indicating that Fgf15 is downstream of Fxr and Shp. Fgf15 protein also suppressed Cyp8b1 gene expression in Fxr WB KO, Shp KO, and Fxr WB KO/Shp Tg mice; in addition, Fgf15 tended to suppress Cyp8b1 gene expression in WT mice, but not in Shp Tg mice (Fig. 3). Interestingly, Shp mrna levels were also reduced markedly by Fgf15 treatment, indicating that Fgf15 regulates Shp expression in the liver. Next, by using Fgfr4 KO mice, we determined to what degree the induction of Fgf15 by Fxr activation contributes to the suppression of Cyp7a1 and Cyp8b1 gene expression. Fgfr4 is a transmembrane protein that is highly expressed in the liver and is the major receptor for Fgf15/FGF19, whereas b-klotho acts as a coreceptor to form the Fgfr4/b-Klotho complex and response to Fgf15/FGF19. Fgf15 KO mice on the C57BL/6 background are embryonically lethal, so we used Fgfr4 KO mice as surrogates of Fgf15 KO mice in the current study. Consistent with previous findings, Fgfr4 KO mice expressed higher basal Cyp7a1 mrna levels (Fig. 4A). Treatment with GW4064 in Fgfr4 KO mice only moderately suppressed 40% Cyp7a1 gene expression, compared to the 95% suppression in WT mice (Fig. 4A). Interestingly, Fgfr4 deficiency led to decreased basal Shp gene expression in the liver (Fig. 4B) and decreased GW4064-induced Shp expression as well, indicating that Shp expression may be regulated by MAPK-signaling pathways. Though bileacid synthesis and Cyp7a1 gene expression was increased in b-klotho KO mice, 21 the current study did not show changes in hepatocyte b-klotho mrna levels after treatment with GW4064 (Fig. 4B), indicating that b-klotho may not be regulated by Fxr. Induction of Fgf15 and Shp May Be the Only Two Mechanisms Responsible for Fxr-Mediated Suppression of the Cyp7a1 and Cyp8b1 Gene Expression. Besides Fgf15 and Shp, additional factors may be involved in suppressing Cyp7a1 and Cyp8b1 gene expression after Fxr activation. To test this possibility, we generated mice deficient in both Fgfr4 and Shp (i.e., Fgfr4/Shp DKO mice). A marked increase of approximately 4-fold in Cyp7a1, but not Cyp8b1, mrna levels was observed in these DKO mice (Fig.

6 HEPATOLOGY, Vol. 56, No. 3, 2012 KONG ET AL Fig. 3. Effects of exogenous Fgf15 protein on relative mrna levels of Cyp7a1, Cyp8b1, and Shp in the liver. Relative mrna levels of Cyp7a1, Cyp8b1, and Shp in livers of WT, Fxr WB KO, Shp KO, Shp Tg, and Fxr KO/Shp Tg mice at 2 hours after tail-vein injection of purified recombinant Fgf15 protein (10 lg/kg) (n ¼ 5 male mice per group). An asterisk (*) indicates P < 0.05 between Fgf15-treated and saline-treated groups. 4). Surprisingly, the activation of Fxr in these mice did not reduce the mrna levels of Cyp7a1 or Cyp8b1 (Fig. 4), indicating that Fgf15 and Shp may be the only two factors involved in mediating the suppression of Cyp7a1 and Cyp8b1 gene expression after Fxr activation. Time Course of Cyp7a1 and Cyp8b1 Suppression as Well as ERK and JNK Activation by Exogenous Fgf15 Treatment. In vitro, the activation of either JNK1/2 or ERK 1/2 after Fgfr4 activation has been shown to suppress Cyp7a1/CYP7A1 gene expression. 10,11 To clarify which of these two pathways is activated in vivo after Fgfr4 activation in mice, we determined Cyp7a1 and Cyp8b1 mrna levels at 30 minutes and 1, 2, 3, 4, 6, and 8 hours after exogenous Fgf15 protein treatment. As mentioned above, the expression of the Cyp7a1 gene is subject to circadian regulation. After Fgf15 injection, Cyp7a1 mrna levels started to rise during the experimental duration, even with vehicle treatment. With Fgf15 administration, mrna levels of Cyp7a1 decreased at 1 hour, reached their lowest point at 2 hours, stayed low for 3 and 4 hours, and returned to normal at 6 and 8 hours (Fig. 5A). Cyp8b1 mrna levels also showed circadian change with a degree much smaller than those of Cyp7a1. With Fgf15 treatment, Cyp8b1 mrna levels started to decrease at 2 hours and remained reduced during the entire time course examined (Fig. 5A). Once the time course of the suppression of Cyp7a1 and Cyp8b1 gene expression by exogenous Fgf15 protein was established, the protein levels of the total and the phosphorylated (i.e., the active form) MAPK family, including JNK, ERK, and p38, at 30 minutes and 1, 2, and 3 hours after Fgf15 injection, were determined. The protein levels of total JNK1/2 and ERK1/ 2, as well as total and phosphorylated p38, remained unchanged during the time points measured. However, Fgf15 treatment strongly increased phosphorylated ERK (perk)1/2 at both 30 minutes and 1 hour and slightly increased phosphorylated JNK (pjnk)1/2 at 1 hour (Fig. 5B). Both JNK and ERK Supported the Basal, But Suppressed the Fgf15-Mediated, Expression of Cyp7a1 and Cyp8b1 Genes. The downstream target of JNK is cjun, which is a component of activating protein 1 (AP1), and the downstream target of ERK is Egr1, and both AP1 and Egr1 are transcription factors. As shown previously, after Fgf15 treatment, ERK and, to a much smaller degree, JNK were activated in WT mice; therefore, the degree to which JNK and ERK activation contributed to the suppression of Cyp7a1 and Cyp8b1 gene expression was determined in mice with cjun knockdown or Egr1 deletion. The results showed that at 2 hours after Fgf15 treatment, mrna Fig. 4. Effects of a double deficiency of Fgfr4 and Shp on Fxr-activation mediated suppression of Cyp7a1 and Cyp8b1 gene expression. Relative mrna levels of hepatic Cyp7a1, Cyp8b1, Fgfr4, b-klotho, and Shp as well as intestinal Fgf15 in WT, Fgfr4 KO, Shp KO, and Fgfr4/ Shp DKO mice after the activation of FXR by GW4064 treatment (n ¼ 5 male mice per group. A pound sign (#) indicates P < 0.05 between genetically modified and WT mice; an asterisk (*) indicates P < 0.05 between GW4064-treated and vehicle-treated mice within the same genotype.

7 1040 KONG ET AL. HEPATOLOGY, September 2012 suppression in the cjun knock-down mice, which was not statistically significant (Fig. 6A). Similarly, the expression of Cyp7a1 in Egr1 KO mice was approximately 10-fold reduced, and treatment with Fgf15 further reduced Cyp7a1 expression without statistical significance. Furthermore, cjun knockdown in Egr1 KO mice led to similarly lower basal mrna levels of Cyp7a1, but treatment with the Fgf15 protein in these mice did not further reduce Cyp7a1 mrna levels (Fig. 6A). The effects of cjun and Egr1 deficiency on Fgf15-mediated suppression of Cyp8b1 gene expression were similar to those of the Cyp7a1 gene, except for an even smaller degree of suppression after Fgf15 treatment (Fig. 6A). Because deficiency of cjun or Egr1 not only led to a reduced suppression of Cyp7a1 and Cyp8b1 gene expression after Fgf15 treatment, but also resulted in a marked reduction of basal Cyp7a1 and Cyp8b1 gene expression, it is possible that JNK and ERK compensate each other s function. To examine this possibility, we tested the protein levels of cjun as well as total and activated JNK and ERK in cjun- and Egr1-deficient mice. With cjun knockdown in WT mice, there was a trend toward an increase in perk (Fig. 6D). Likewise, Egr1 deficiency led to a marked increase in cjun and total and activated ERK protein levels, as well as a slight increase in total JNK protein levels (Fig. 6D). When cjun was further knocked down in Egr1 KO mice, the only protein that was changed was activated ERK, which was decreased (Fig. 6D). Fig. 5. Time course of the effects of recombinant Fgf15 protein administration on Cyp7a1 and Cyp8b1 mrna levels and on the activation of MAPK in livers of WT mice. (A) Relative mrna levels of Cyp7a1 and Cyp8b1 in livers of mice at 30 minutes and 1, 2, 3, 4, 6, and 8 hours after tail-vein injection of purified recombinant Fgf15 protein (10 lg/kg). Please note that the expression of Cyp7a1 is strongly and the expression of Cyp8b1 is weakly subject to circadian-rhythm regulation (n ¼ 5 male mice per group). An asterisk (*) indicates P < 0.05 between Fgf15-treated and control vehicle-treated groups. (B) From the same time-course liver samples at 30 minutes and 1, 2, and 3 hours, hepatic protein levels of pjnk1/2 (p-jnk1/2) and total JNK1/2 (T-JNK1/2), perk1/2 (p-erk1/2) and total ERK1/2 (T-ERK1/2), and phosphorylated p38 (p-p38) and total p38 (T-p38) were determined by western blotting analysis. levels of cjun increased in WT mice, but not in Egr1 KO mice, indicating that Egr1 mediates the induction of cjun after MAPK activation (Fig. 6B). Knockdown of cjun by shrna markedly reduced cjun mrna and protein levels in both WT and Egr1 KO mice (Fig. 6B,D). Surprisingly, Cyp7a1 mrna levels were approximately 5-fold reduced with cjun knockdown, and Fgf15 treatment led to only a small, additional Discussion This study presents tissue-specific roles for Fxr, Shp, and Fgf15 in suppressing Cyp7a1 and Cyp8b1 gene expression in mice (Fig 7). Intestinal Fxr activation predominately suppresses Cyp7a1 gene expression through the induction of Fgf15. Hepatic Fxr activation, through the induction of Shp, is less important in suppressing Cyp7a1 expression. In contrast, both intestinal Fxr/Fgf15 and hepatic Fxr/Shp pathways are important in suppressing Cyp8b1 gene expression. In addition, the activation of both JNK and ERK is associated with the suppression of Cyp7a1 and Cyp8b1 gene expression. Finally, cjun and Egr1, the downstream targets of JNK and ERK, respectively, compensate each other in suppressing Cyp7a1 and Cyp8b1 gene expression as well as in maintaining the basal expression of Cyp7a1 and Cyp8b1 genes. It is commonly considered that increased bile acids in the liver initiate the suppression. Recently, this concept has been challenged by studies showing that an

8 HEPATOLOGY, Vol. 56, No. 3, 2012 KONG ET AL Fig. 6. Effects of cjun knockdown and Egr1 KO in vivo on basal, as well as Fgf15-mediated suppression of, mrna levels of Cyp7a1 and Cyp8b1 in mouse livers. (A) Relative mrna levels of Cyp7a1 and Cy8b1. (B) Relative mrna levels of cjun. (C) Relative mrna levels of Egr1 and Shp in mouse livers with in vivo knockdown of cjun or KO of Egr1 (n ¼ 5 male mice per group). A pound sign (#) indicates P < 0.05 between knockdown/ko mice and WT mice receiving the same treatment; an asterisk (*) means P < 0.05 between Fgf15-treated and vehicle-treated groups. (B) From the same mouse livers, western blotting analysis of hepatic protein levels of activated JNK1/2 (p-jnk1/2) and total JNK1/2 (T-JNK1/2), activated ERK1/2 (p-erk1/ 2) and total ERK1/2 (T-ERK1/2), and cjun. increase in intestinal bile acids is critical in suppressing bile-acid synthesis in the liver In addition, the activation of the bile-acid sensing nuclear receptor, FXR/Fxr, is the most important mechanism in suppressing Cyp7a1 and Cyp8b1. 17 Furthermore, at least in mice, intestinal Fxr is important in suppressing Cyp7a1 gene expression, and both hepatic and intestinal Fxr activation is important in suppressing Cyp8b1 gene expression. 18 It is apparent that the activation of Fxr in the intestine is predominant in regulating the amount of bile acids synthesized under physiological conditions, but the activation of Fxr in both the liver and intestine is critical in regulating bile-acid hydrophobicity. This concept is further supported by a recent study showing that the activation of FXR in the intestine protects cholestasis by increasing Fgf15 to suppress Cyp7a1 and Cyp8b1 expression. 25 Furthermore, a significant contribution of this study toward understanding bile-acid synthesis is that Fgf15, but not Shp, predominantly suppresses Cyp7a1 gene expression. However, both Fgf15 and Shp are important for suppressing Cyp8b1 gene expression. Fgf15/ FGF19 is one of the most strongly induced Fxr/FXR target genes and its role in suppressing bile-acid synthesis is novel. 9,11,18,26,27 The current study clearly demonstrates that Fgf15 is largely responsible for suppressing Cyp7a1 gene expression in mice after Fxr activation in the intestine. Shp has been shown to inhibit Cyp7a1/CYP7A1 and Cyp8b1/CYP8B1 gene expression in rats and primary human hepatocytes by inhibiting the LRH-1-mediated transcriptional activation of Cyp7a1/CYP7A1 and Cyp8b1/ CYP8B1 genes. 12,13 In addition, Shp has been shown to be required for the Fgf15-mediated suppression of Cyp7a1 gene expression in mice. 9 In the current study, Shp seemed to contribute a minor role (15%) in the suppression of Cyp7a1 gene expression, but Shp played an equally important role as with Fgf15 in suppressing Cyp8b1 gene expression. In support of this conclusion, studies have shown that hepatic Lrh-1 gene deletion and Shp reduction did not affect Cyp7a1 gene expression, but, instead, markedly reduced Cyp8b1 gene expression. 28,29 Furthermore, Shp has been shown to be required to suppress Cyp7a1 gene expression by the Fxr-Fgf15/ Fgfr4 pathway. 9 However, in the current study, exogenous Fgf15 protein treatment strongly inhibited Cyp7a1 gene expression in Shp KO mice as well, indicating that Fgf15 suppresses Cyp7a1 gene expression independent of Shp. This conclusion is also supported by a study that showed, in primary human

9 1042 KONG ET AL. HEPATOLOGY, September 2012 Fig. 7. Model of negative-feedback regulation of hepatic bile-acid synthesis by nuclear receptor Fxr in a tissue-specific manner. Bile acids in hepatocytes activate Fxr to induce Shp expression, which inhibited Lrh-1- and/or Hnf4a-induced gene transcription of Cyp7a1 and Cyp8b1, to mainly result in decreasing the expression of the Cyp8b1 gene and, to a minor extent, the Cyp7a1 gene. Bile acids in enterocytes activated Fxr to induce Fgf15 expression. Fgf15 is released into the circulation and is transported to the liver followed by binding to its cognate tyrosine kinase receptor (Fgfr4) and Fgfr4 coreceptor (b- Klotho) on hepatocyte cell membrane. Activation of Fgfr4 activated mainly ERK1/2 and, to a less extent, JNK1/2 to down-regulate both Cyp7a1 and Cyp8b1 gene expression. Furthermore, Shp appeared to be regulated by Fgf15/Fgfr4. hepatocytes, that the knockdown of SHP did not affect the FGF19-mediated suppression of CYP7A1 gene expression. 11 MAPK activation is associated with the suppression of Cyp7a1/CYP7A1 gene expression by Fgf15/FGF19. p38 activation indirectly increases Cyp7a1 expression by increasing the hepatocyte nuclear factor 4 alpha (HNF4a)-mediated inducton of the Cyp7a1 gene, 30 but our results showed that Fgf15 did not activate p38. It was also reported that overexpression of FGFR4 in mice reduces Cyp7a1 expression, which is associated with the activation of JNK in the liver, 14 and in primary human hepatocytes, treatment with FGF19 selectively activates ERK1/2 to suppress CYP7A1 expression. 11 The downstream target of JNK and ERK is cjun and Egr1, respectively. This study showed that in mice, treatment with Fgf15 rapidly mainly increased ERK activation and, to a smaller degree, JNK activation. However, the knockdown/ko of cjun or Egr1 markedly reduced the basal expression of Cyp7a1 and Cyp8b1, but did not prevent the suppression of Cyp7a1 and Cyp8b1 by the Fgf15 protein. These data also indicate that the ERK and JNK pathways tend to compensate each other in suppressing Cyp7a1 and Cyp8b1 gene expression. Egr1 deficiency led to a strong induction of cjun, and it was reported that ERK activation leads to the induction of c-fos, which is a partner of cjun, to form AP1. 31 Therefore, increased ERK activation with a Egr1 deletion may increase AP1, which may result in the suppression of Cyp7a1 expression. These data may suggest a species difference in the MAPK-pathway mediated suppression of Cyp7a1/CYP7A1 and Cyp8b1/CYP8B1 gene expression between mice and humans. In addition, despite that cjun and Egr1 support the basal expression of Cyp7a1 and Cyp8b1, Fgf15-activated JNK and ERK activation results in the suppression of Cyp7a1 and Cyp8b1 expression, indicating that Fgf15 may switch the effects of MAPK on regulating Cyp7a1 and Cyp8b1 expression. Another novel finding from this study is that in addition to regulating Cyp7a1 expression, the Fgf15/ Fgfr4 pathway affects liver Shp expression. Basal and Fxr-induced Shp mrna levels were decreased in Fgfr4 KO mice. It will be interesting to determine the mechanisms of the Fgf15/Fgfr4 regulation of Shp expression. This mechanism may involve a post-translational modification of Fxr after MAPK activation. In fact, a post-translational modification of Fxr by acetylation or phosphorylation has been reported to affect Fxr function. 32,33 In conclusion, this study provides several significant findings: (1) At least in mice, intestinal, but not hepatic, Fxr is important in suppressing Cyp7a1 gene expression; (2) Fgf15 is the major and Shp is a minor mediator in suppressing Cyp7a1, but both are equally important in suppressing Cyp8b1, gene expression in mice; (3) likely, Fgf15 and Shp are the only two factors in mice to suppress Cyp7a1 and Cyp8b1 gene expression after Fxr activation; and (4) ERK and, to a small degree, JNK are involved in the Fgf15-mediated suppression of bile-acid synthesis. However, deficiency of both ERK and JNK markedly reduced the basal expression of the Cyp7a1 and Cyp8b1 genes, adding another layer of complexity in regulating bile-acid synthesis after MAPK activation. Our study suggests that activating Fxr in the intestine may result in a stronger suppression of bile-acid synthesis, which may be used as a strategy to inhibit bile-acid synthesis to treat diseases with overt bile-acid production. In contrast, inhibiting Fxr in the intestine may lead to enhanced cholesterol conversion to bile acids, which may be used as a useful strategy to reduce cholesterol levels. Acknowledgment: The authors thank Dr. Silvia Giordano (University of Torino, Torino, Italy) for the cjun-shrna vector.

10 HEPATOLOGY, Vol. 56, No. 3, 2012 KONG ET AL References 1. Xie W, Radominska-Pandya A, Shi Y, Simon CM, Nelson MC, Ong ES, et al. An essential role for nuclear receptors SXR/PXR in detoxification of cholestatic bile acids. Proc Natl Acad Sci U S A 2001;98: Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM, et al. Vitamin D receptor as an intestinal bile acid sensor. Science 2002;296: Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, et al. Identification of a nuclear receptor for bile acids. Science 1999; 284: Parks DJ, Blanchard SG, Bledsoe RK, Bledsoe RK, Chandra G, Consler TG, et al. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999;284: Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999;3: Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, et al. A G protein-coupled receptor responsive to bile acids. J Biol Chem 2003;278: Zhu Y, Li F, Guo GL. Tissue-specific function of farnesoid X receptor in liver and intestine. Pharmacol Res 2011;63: Chiang JYL. Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. J Hepatol 2004;40: Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, et al. Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2005;2: Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF, et al. Definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev 2003;17: Song KH, Li T, Owsley E, Strom S, Chiang JY. Bile acids activate fibroblast growth factor 19 signaling in human hepatocytes to inhibit cholesterol 7alpha-hydroxylase gene expression. HEPATOLOGY 2009;49: Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000;6: Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000;6: Yu C, Wang F, Jin C, Huang X, McKeehan WL. Independent repression of bile acid synthesis and activation of c-jun N-terminal kinase (JNK) by activated hepatocyte fibroblast growth factor receptor 4 (FGFR4) and bile acids. J Biol Chem 2005;280: Kong B, Guo GL. Enhanced in vitro refolding of fibroblast growth factor 15 with the assistance of SUMO fusion partner. PLoS ONE 2011; 6:e Guo GL, Santamarina-Fojo S, Akiyama TE, Amar MJ, Paigen BJ, Brewer B, Jr., Gonzalez FJ. Effects of FXR in foam-cell formation and atherosclerosis development. Biochim Biophys Acta 2006;1761: Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000;102: Kim I, Ahn SH, Inagaki T, Choi M, Ito S, Guo GL, et al. Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J Lipid Res 2007;48: Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS, et al. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2002;2: Zhang Y, Xu P, Park K, Choi Y, Moore DD, Wang L. Orphan receptor small heterodimer partner suppresses tumorigenesis by modulating cyclin D1 expression and cellular proliferation. HEPATOLOGY 2008;48: Ito S, Fujimori T, Furuya A, Satoh J, Nabeshima Y, Nabeshima Y. Impaired negative feedback suppression of bile acid synthesis in mice lacking betaklotho. J Clin Invest 2005;115: Rao A, Haywood J, Craddock AL, Belinsky MG, Kruh GD, Dawson PA. The organic solute transporter a-b, Osta-Ostb, is essential for intestinal bile acid transport and homeostasis. Proc Natl Acad Sci U S A 2008;105: Pandak WM, Heuman DM, Hylemon PB, Chiang JY, Vlahcevic ZR. Failure of intravenous infusion of taurocholate to down-regulate cholesterol 7 alpha-hydroxylase in rats with biliary fistulas. Gastroenterology 1995;108: Chanda D, Park JH, Choi HS. Molecular basis of endocrine regulation by orphan nuclear receptor Small Heterodimer Partner. Endocr J 2008; 55: Modica S, Petruzzelli M, Bellafante E, Murzilli S, Salvatore L, Celli N, et al. Selective activation of nuclear bile acid receptor FXR in the intestine protects mice against cholestasis. Gastroenterology : Wright TJ, Ladher R, McWhirter J, Murre C, Schoenwolf GC, Mansour SL. Mouse FGF15 is the ortholog of human and chick FGF19, but is not uniquely required for otic induction. Dev Biol 2004;269: Yu C, Wang F, Kan M, Jin C, Jones RB, Weinstein M, et al. Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem 2000;275: Mataki C, Magnier BC, Houten SM, Annicotte JS, Argmann C, Thomas C, et al. Compromised intestinal lipid absorption in mice with a liver-specific deficiency of liver receptor homolog 1. Mol Cell Biol 2007;27: Lee Y-K, Schmidt DR, Cummins CL, Choi M, Peng L, Zhang Y, et al. Liver receptor homolog-1 regulates bile acid homeostasis but is not essential for feedback regulation of bile acid synthesis. Mol Endocrinol 2008;22: Xu Z, Tavares-Sanchez OL, Li Q, Fernando J, Rodrigues CM, Studer EJ, et al. Activation of bile acid biosynthesis by the p38 mitogen-activated protein kinase (MAPK): hepatocyte nuclear factor-4{alpha} phosphorylation by the p38 MAPK is required for cholesterol 7{alpha}- hydroxylase expression. J Biol Chem 2007;282: Hodge C, Liao J, Stofega M, Guan K, Carter-Su C, Schwartz J. Growth hormone stimulates phosphorylation and activation of Elk-1 and expression of c-fos, egr-1, and junb through activation of extracellular signal-regulated kinases 1 and 2. J Biol Chem 1998;273: Kemper JK, Xiao Z, Ponugoti B, Miao J, Fang S, Kanamaluru D, et al. FXR acetylation is normally dynamically regulated by p300 and SIRT1 but constitutively elevated in metabolic disease states. Cell Metab 2009;10: Martínez-Fernandez P, Hierro L, Jara P, Alvarez L. Knockdown of ATP8B1 expression leads to specific downregulation of the bile acid sensor FXR in HepG2 cells: effect of the FXR agonist GW4064. Am J Physiol Gastrointest Liver Physiol 2009;296:G1119-G1129.