Regulating Hepatic Cellular Cholesterol
|
|
- Angel Dickerson
- 6 years ago
- Views:
Transcription
1 Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce cholesterol synthesis, such as HMGoA reductase. Regulating Hepatic ellular SREBP Lipogenic Enzymes mrna Endoplasmic Reticulum HMG-oA Reductase Negative Feedback Geranyl-PP Acetyl-oA HMG-oA Reduction Mevalonate Squalene Farnesyl-PP Hepatic Sinusoid 19 steps including multiple intermediaries including lathosterol Depleted Pool Synthesis Geranlygeranyl-PP Isoprenoids Sterol Regulatory Element Binding Protein 2 (SREBP-2) regulates Synthesis Bile Duct
2 SREBs also induce synthesis of LDL receptors which translocate to the surface of the cell and endocytose lipoproteins with apoe or apob on their surface. These lipoproteins of course deliver sterols in this indirect reverse cholesterol transport process. Upregulation of the Niemann Pick 1 Like 1 protein at the hepatobiliary interface is another source of cholesterol for the hepatocyte. Regulating Hepatic ellular Endoplasmic Reticulum mrna Nucleus DNA LDL receptor synthesis & translocation to cell membrane Decreased cholesterol pool holesteryl ester Sterol Regulatory Element Binding Proteins sense the low sterols Niemann Pick 1 Like 1 Protein Biliary free cholesterol Bile Duct Hepatic Sinusoid LDL receptor endocytosis of LDL particles carrying cholesteryl ester facilitates cholesterol movement from bile back to hepatocytes
3 Sterol cellular toxicity (crystallization) is prevented primarily by the liver X receptors () and the Farnesol or Farnesoid X receptors (FXR). The latter regulate bile acids. FXRs cross talk with the via the short heterodimer protein (SHP). Under circumstances of hepatic sterol excess, s induce the synthesis of several ATP binding cassette transporters namely ABA1, ABG5 and ABG8 and ABB11. All of these after synthesis translocate to various membrane areas and are involved with energy driven exportation of cholesterol (ABA1,ABG5,G8), non cholesterol sterols (ABG5,G8) or bile acids (ABB11). The also by inducing cholesterol 7 alpha hydroxylase induce synthesis of bile acids with are excreted into the bile via the ABB11 transporter. Suppression of HMGoA reductase would also help correct sterol toxicity as would suppression of the hepatobiliary and intestinal upregulaltion of the protein. Regulating Hepatic ellular Liver X Receptors Prevent Sterol Toxicity Heterodimerization with Retinoid X Receptor RXR mrna holate Endoplasmic Reticulum 7α hydroxylase Acetyl-oA HMG-oA Reductase Mevalonate Lathosterol Liver X Receptors () regulate Plasma cellular sterol homeostasis and are upregulated as sterol levels rise Prebeta HDL Niemann Pick 1 Like 1 Protein Bile ductule ABB11 ABG5/8 ABA1 Hepatic influences regulation of proteins involved with sterol homeostasis including sterol efflux transporters, and BA enzymes
4 This slide demonstrates the actions of and FXR agonism. Like so many of the lipid nuclear transcription factors, the and FXR heterodimerize with the RXR to facilitate attachment to the proper DNA response elements. FXR, or the bile acid toxicity nuclear transcription factor, suppress conversion of cholesterol to bile acids whereas induces it. upregulates the ABG5, G8) transporter to efflux cholesterol and noncholesterol sterols into the bile whereas the FXR indices the ABB11 (bile acid transporter) and the multidrug resistance proteins 2/3 (MDR2/3) to secrete phospholipids into bile. FXR inhibits SREBP 1c and TG synthesis whereas (especially isoform alpha) induces it. FXR and Regulation of, Triglycerides and Bile Acids ABG5/G8 Heterodimerization with RXR Acetyl oa FXR SREPB-1c Bile Duct FXR FA, TG MDRP2/3 FXR Bile Acids ABB11 Bile salt export pump (BSEP) Kalaany & Mangelsdorf. Ann Rev Physiol 2006;68:159 Phospholipids VLDL (TG levels)
5 Nuclear transcription factors also control enterocyte handling (absorption and excretion) of sterols. The Niemann Pick 1 Like 1 protein () attaches to and delipidates sterols from the biliary micelles. Once in the enterocyte induces acylcholesterol acyltransferase (AAT) to change cholesterol into cholesteryl ester (E). AAT cannot esterify noncholesterol sterols. E joins with enterocyte formed TG and apolipoprotein B48 in the genesis of chylomicrons which are secreted into lacteals. The also upregulates enterocyte ABA1 which exports unesterified (free) cholesterol into unlipidated apoa-i or prebeta HDL species. Upwards of 20-30% of total HDL- is acquired intestinally. Excess cholesterol and all noncholesterol sterols can be excreted back to the intestinal lumen via the AB5 and ABG8 half transporters (sometimes called sterolin). Under conditions of sterol excess the protein can be down regulated. Enterocytes and Sterols Sterol excess in enterocytes cause to up-regulate AAT, ABA1 and ABG5, G8 and down-regulate the sterol permease Enterocyte Niemann Pick 1 like 1 protein () facilitates sterol entry from biliary micelles Mature alpha HDL Prebeta HDL 2 ABG5/G8 Absorbed Free Gut Lumen 3 RXR Plasma ABA1 Net effect of enterocyte agonism is decreased sterol absorption and increased sterol efflux 4 TG AAT 1 holesteryl ester Lacteal hylomicrons Micelles
6 Enterocyte sterol deficiency will cause a suppression of the : AAT, ABA1, ABG5,G8 expression is down regulated. There will also be down regulation of the protein. This will decrease chylomicron cholesterol content, HDL cholesterol content and sterol excretion into the gut lumen. It will also cause the retention of noncholesterol sterols. All of these changes can be seen in persons using statins, which likely explains what used to be termed statin tachyphylaxis and why statins increase noncholesterol sterol levels. Enterocytes and Sterol Acquisition Sterol DEFIIENY in enterocytes cause to down-regulate AAT, ABA1 and ABG5, G8 and up-regulate the sterol permease Enterocyte Plasma Prebeta HDL ABG5/G8 Gut Lumen Decreased Pool RXR ABA1 TG AAT holesteryl ester Lacteal hylomicrons Micelles
7 In summary sterols enter via the protein and cholesterol but not noncholesterol sterols are esterified by AAT2. The E, and any noncholesterol sterols not excreted by ABG5,G8 joins with intestinally resynthesized TG, apob48 into chylomicron formation. After secretion into lacteals, where the chylomicrons acquire several other surface apolipoproteins from lymphatic HDLs, they enter the venous and ultimately the arterial circulation where they are exposed to lipoprotein lipase (LPL) at muscular and adipocyte vascular endothelium. Lipolysis of chylomicrons releases phospholipids, fatty acids and surface apoa-i. Unlipidated apoa-i and prebeta HDLs can attach to enterocyte ABA1 and acquire additional unesterified cholesterol. All of the proteins in blue in the slide are under the influence of. Sterol Absorption and Enterocyte Sterols of dietary or biliary origin E () Lacteal apob48 TG hylomicron AAT2 LPL Noncholesterol sterols (N) N ABA1 N HDL ABG5 ABG8 Gut Adapted from irc Res 2004;95: AB = ATP Binding assette Transporters AAT2 = acyl cholesteryl acyl transferase = free or unesterified cholesterol E = cholesteryl ester N = Non cholesterol sterols = Niemann-Pick 1 like 1 protein hylomicron Remnant apoa-i Plasma Target Genes
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More informationLipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels
Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More informationIs it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics
Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationN-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP
Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA
More informationPodcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam
Podcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam Howard J. Sachs, MD www.12daysinmarch.com Email: Howard@12daysinmarch.com Podcast (Video Recorded
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationCholest s er e o r l o ١
Cholesterol ١ Contents of The Lecture What is Cholesterol? Structure of Cholesterol Structure of Cholesteryl Ester Normal Cholestrol Level Sources of Cholesterol What Are The Exogenous Sources Of Cholesterol?
More informationBIOL2171 ANU TCA CYCLE
TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationTopic 11. Coronary Artery Disease
Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides
More informationLipid Metabolism in Familial Hypercholesterolemia
Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More information4. ABSORPTION. Transport mechanisms. Absorption ABSORPTION MECHANISMS. Active transport. Active transport uses metabolic energy
4. ABSORPTION ABSORPTION MECHANISMS Once the digestive process is completed, the nutrients have to be transferred across the digestive tract epithelium into the intracellular space and eventually into
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationCHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna
Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationAnti Hyperlipidemic Drugs. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia
Anti Hyperlipidemic Drugs Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Lipoproteins Macromolecular complexes in the blood that transport lipids Apolipoproteins
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationMoh Tarek + Suhayb. Tamara Al-Azzeh + Asmaa Aljeelani ... Faisal
28 Moh Tarek + Suhayb Tamara Al-Azzeh + Asmaa Aljeelani... Faisal Digestion of dietary lipids Lipid digestion and absorption are complex processes. They involve soluble enzymes, substrates with different
More informationThematic review series: The Pathogenesis of Atherosclerosis
thematic review Thematic review series: The Pathogenesis of Atherosclerosis Effects of infection and inflammation on lipid and lipoprotein metabolism: mechanisms and consequences to the host 1 Weerapan
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationDigestion and transport of TAG by plasma lipoproteins
Digestion and transport of TAG by plasma lipoproteins Lipoproteins are multimolecular complexes of lipids and proteins, they are not macromolecules They transport lipids in the plasma because lipids are
More informationIntroduction Hyperlipidemia hyperlipoproteinemia Primary hyperlipidemia (Familial) Secondary hyperlipidemia (Acquired)
Introduction Hyperlipidemia, or hyperlipoproteinemia, is the condition of abnormally elevated levels of any or all lipids and/or lipoproteins in the blood. Hyperlipidemias are divided in primary and secondary
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationCholesterol and Lipoprotein Metabolism and Atherosclerosis: Recent Advances in Reverse Cholesterol Transport
Cholesterol and Lipoprotein Metabolism and Atherosclerosis. 27 November, Vol. 16 (Suppl. 1), 2017: s27-s42 The Official Journal of the Mexican Association of Hepatology, the Latin-American Association
More information34 Cholesterol Absorption,
34 holesterol Absorption, Synthesis, Metabolism, and Fate holesterol is one of the most highly recognized molecules in human biology, in part because of a direct relationship between its concentrations
More informationREGULATION OF ABCG5 AND ABCG8 STEROL TRANSPORTERS IN BILIARY CHOLESTEROL ELIMINATION, REVERSE CHOLESTEROL TRANSPORT AND DYSLIPIDEMIA
University of Kentucky UKnowledge University of Kentucky Doctoral Dissertations Graduate School 2011 REGULATION OF ABCG5 AND ABCG8 STEROL TRANSPORTERS IN BILIARY CHOLESTEROL ELIMINATION, REVERSE CHOLESTEROL
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationCLINICAL BIOCHEMISTRY - 5 LIPID METABOLISM
CLINICAL BIOCHEMISTRY - 5 LIPID METABOLISM DIGESTIVE MECHANISM FOR LIPIDS The average lipid intake is about 80g/day, of which more than 90% is triacylglycerol (TAG); the remainder consists of cholesterol,
More informationCholesterol metabolism Ι
Sheet # 22 Cholesterol metabolism Ι Today is the first lecture in the Cholesterol metabolism and you can refer to chapter 18 in Lippincott illustrated review Q: Why Cholesterol was written in 3 different
More informationThe new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice
... PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice Based on a presentation by Daniel J. Rader, MD Presentation Summary The guidelines recently released by the National Cholesterol
More informationDrug regulation of serum lipids
Drug regulation of serum lipids Foundations of Biomedical Science MEDS90001 Dr Michelle Hansen Pharmacology & Therapeutics mjhansen@unimelb.edu.au References Katzung, Basic & Clinical Pharmacology Ch 35
More informationEffects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and
Effects of Infection and Inflammation on Lipid and Lipoprotein Metabolism: Mechanisms and Consequences to the Host Weerapan Khovidhunkit*, Min-Sun Kim, Riaz A. Memon**, Judy K. Shigenaga, Arthur H. Moser,
More informationDigestion and Absorption
Digestion and Absorption Digestion and Absorption Digestion is a process essential for the conversion of food into a small and simple form. Mechanical digestion by mastication and swallowing Chemical digestion
More informationLipid Digestion. An Introduction to Lipid Transport and Digestion with consideration of High Density and Low Density Lipoproteins.
Digestion An Introduction to Transport and Digestion with consideration of High Density and Low Density Lipoproteins By Noel Ways Suspension and Nutralization of Chyme ph Boli containing lipids enters
More informationnumber Done by Corrected by Doctor
number 29 Done by Ali Yaghi Corrected by Shahd Alqudah Doctor Faisal Al-Khatibe In this lecture we will continue the steps of synthesizing cholesterol. in the previous sheet we reached the step of forming
More informationNutrigenetics Today s Concept Tomorrow s Reality
Nutrigenetics Today s Concept Tomorrow s Reality Jose M Ordovas, PHD Director, Nutrition and Genomics Laboratory Jean Mayer USDA Human Nutrition Research Center on Aging at Tufts University Some recent
More informationPathophysiology of Bile Secretion
Pathophysiology of Bile Secretion Martin C. Carey, D.Sc., M.D. Division of Gastroenterology, Brigham and Women s Hospital and Department of Medicine, Harvard Medical School Boston, MA, U.S.A. Functions
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationPhysiology Unit 4 DIGESTIVE PHYSIOLOGY
Physiology Unit 4 DIGESTIVE PHYSIOLOGY In Physiology Today Functions Motility Ingestion Mastication Deglutition Peristalsis Secretion 7 liters/day! Exocrine/endocrine Digestion Absorption Digestion of
More informationCombined lipid lowering drug therapy for the effective treatment of hypercholesterolaemia
European Heart Journal (2003) 24, 685 689 Editorial Combined lipid lowering drug therapy for the effective treatment of hypercholesterolaemia James Shepherd * Institute of Biochemistry, Royal Infirmary,
More informationHepatic Transporter Proteins involved in Bile Formation
Bile salt synthesis Hepatic Transporter Proteins involved in Bile Formation Basolateral membrane transporter proteins fx: NTCP uptake of bile salts OATP bulky organic anions Canalicular membrane transporter
More informationThe Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia
The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano
More informationReviews. This Review is part of a thematic series on ABC Transporters in the Cardiovascular System, which includes the following articles:
Reviews This Review is part of a thematic series on ABC Transporters in the Cardiovascular System, which includes the following articles: ATP-Binding Cassette Cholesterol Transporters and Cardiovascular
More informationLIPID CASE 272 New HDL nomenclature
LIPID CASE 272 New HDL nomenclature Some exciting stuff on High Density Lipoproteins has happened: advanced students and those trying to really develop an understanding of these enigmatic lipid transportation
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More informationHypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002
Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low
More informationCHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationLIPID CASE 226 Low TC and Low HDL-C Treat? DAYSPRING ADVICE:
LIPID CASE 226 Low TC and Low HDL-C Treat? Our first case of 2009 deals with a not uncommon clinical condition on which my opinion is solicited several times a year. It revolves around the ingrained assumption
More informationLipid Metabolism * OpenStax
OpenStax-CNX module: m46462 1 Lipid Metabolism * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able
More informationANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD
ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed
More informationEcosanoids: Prostaglandins and related compounds
Ecosanoids: Prostaglandins and related compounds Presented by The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy Ecosanoids: Prostaglandins and related
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationTowards novel strategies to improve lipid homeostasis - targeting the intestine Wulp, Mariëtte Ymkje Maria van der
University of Groningen Towards novel strategies to improve lipid homeostasis - targeting the intestine Wulp, Mariëtte Ymkje Maria van der IMPORTANT NOTE: You are advised to consult the publisher's version
More informationLipid metabolism disorders
Lipid metabolism disorders Lipids any fat-soluble (= lipophilic) molecule fats (TAG, oils) fatty acids (FA) derivatives of FA mono-, diacylglycerols,.. eikosanoids waxes cholesterol sterols fat-soluble
More informationA Review: Atherosclerosis & its treatment
73 Review Article A Review: Atherosclerosis & its treatment Yogesh K. Patil* Department of Pharmacology, Shree Mahavir Institute of Pharmacy, Nashik, Maharashtra, India *yogesh_kpatil85@yahoo.co.in ABSTRACT
More informationLipids, lipoproteins and cardiovascular disease
Lipids, lipoproteins and cardiovascular disease Presented by Dr. Mohammad Saadeh The requirements for the Clinical Chemistry Philadelphia University Faculty of pharmacy Cardiovascular disease Plasma enzymes
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationCholesterol Transport and Regulation in the Mammary Gland
J Mammary Gland Biol Neoplasia (2014) 19:43 58 DOI 10.1007/s10911-014-9316-x Cholesterol Transport and Regulation in the Mammary Gland Edgar C. Ontsouka & Christiane Albrecht Received: 10 September 2013
More informationSTUDIES ON CHOLESTEROL AND LIPOPROTEIN METABOLISM. emphasis on diabetes and sugar
From THE DEPARTMENT OF MEDICINE, HUDDINGE Karolinska Institutet, Stockholm, Sweden STUDIES ON CHOLESTEROL AND LIPOPROTEIN METABOLISM emphasis on diabetes and sugar Johanna Apro Stockholm 2015 All previously
More informationLiver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia
REVIEW Liver X Receptors (LXR) as Therapeutic Targets in Dyslipidemia Jerzy Bełtowski Department of Pathophysiology, Medical University, Lublin, Poland Keywords Atherosclerosis; Lipogenesis; Liver X receptor;
More informationInvestigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats
J. Biosci., Vol. 12, Number 2, June 1987, pp. 137 142. Printed in India. Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats P. VALSALA and P. A. KURUP Department
More informationLipid Diges.on 11/4/ CLASSIFICATION OF LIPID LIPID GLYCEROL BASED NON- GLYCEROL BASED SIMPLE COMPOUND GLYCOLIPID PHOSPHOGLYCERIDES
Lipid Diges.on 3.1 CLASSIFICATION OF LIPID LIPID GLYCEROL BASED NON- GLYCEROL BASED SIMPLE COMPOUND GLYCOLIPID PHOSPHOGLYCERIDES FATS GLUCOLIPIDS GALACTOLIPIDS LECITHINS CEPHALINS SPHINGOMYELINS CEREBROSIDES
More informationGROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM. Caroline Améen
GROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM Caroline Améen Department of Physiology and Wallenberg Laboratory for Cardiovascular Research Sahlgrenska Academy
More informationKinetics of the disappearance of lipoprotein cholesteryl esters in pigs as affected by dietary fat
Retrospective Theses and Dissertations 1993 Kinetics of the disappearance of lipoprotein cholesteryl esters in pigs as affected by dietary fat Terry Durk Faidley Iowa State University Follow this and additional
More informationSTUDIES ON THE REGULATORY ROLES OF CHOLESTEROL AND BILE ACIDS
From the Department of Laboratory Medicine, Division of Clinical Chemistry Karolinska Institutet, Stockholm, Sweden STUDIES ON THE REGULATORY ROLES OF CHOLESTEROL AND BILE ACIDS Charlotte Murphy Stockholm
More informationHyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi
Hyperlipidemia Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Outline The story of lipids Definition of hyperlipidemia Classification of hyperlipidemia Causes of hyperlipidemia
More informationChapter 21 Lipid Biosynthesis. 1. Fatty acids 2. Eicosanoids 3. Triacylglycerols 4. Membrane phospholipids 5. Cholesterol, steroids, and isoprenoids
Chapter 21 Lipid Biosynthesis 1. Fatty acids 2. Eicosanoids 3. Triacylglycerols 4. Membrane phospholipids 5. Cholesterol, steroids, and isoprenoids 1. Fatty acid synthesis takes a different pathway from
More informationOmics Techniques Applied to Diabetes Research - Focus on HSL-Null Mice and Clonal -Cells
Omics Techniques Applied to Diabetes Research - Focus on HSL-Null Mice and Clonal -Cells Fernandez, Celine 2008 Link to publication Citation for published version (APA): Fernandez, C. (2008). Omics Techniques
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our
More informationCorrected by. numb. Done. Doctor. Asma Karameh. Faisal Al Khateeb. 1 P age
numb 27 Done Asma Karameh Corrected by ا لاء العجرمي Doctor Faisal Al Khateeb 1 P age DIGESTION AND TRANSPORT OF TRIACYL-GLYCEROL BY PLASMA LIPOPROTEIN General Lipids refer to a collection ofheterogeneous
More informationBiosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015
Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism- 2015 The major site of acetoacetate and 3-hydorxybutyrate production is the liver. They are preferred substrates for myocardiocytes
More informationSTRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty
STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationDYSLIPIDEMIA PHARMACOLOGY. University of Hawai i Hilo Pre- Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D
DYSLIPIDEMIA PHARMACOLOGY University of Hawai i Hilo Pre- Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D 1 LEARNING OBJECTIVES Know normal cholesterol levels Understand what the role
More information- Most nutrients are absorbed before reaching the ileum. - Colon is responsible for final removal of electrolytes and water.
University of Jordan Department of physiology and Biochemistry Gastro-Intestinal physiology, Medical, Pt III. ---------------------------------------------------------------------------- Academic year:
More informationEbrahim Abbasi Oshaghi 1,2
1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationOVERVIEW AND INTRODUCTION: THEMATIC REVIEW SERIES ON INTESTINAL LIPID METABOLISM
OVERVIEW AND INTRODUCTION: THEMATIC REVIEW SERIES ON INTESTINAL LIPID METABOLISM Nicholas O. Davidson Division of Gastroenterology Washington University School of Medicine St. Louis, MO 63110 Email: nod@dom.wustl.edu
More information