Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in

Size: px
Start display at page:

Download "Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in"

Transcription

1 Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for High-Efficiency Tracking Orthotopic Colorectal Tumor in Mouse Hongda Chen, a,c Xiaodong Li, b Fuyao Liu, a Huimao Zhang*,b and Zhenxin Wang*,a a State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, , P. R. China. wangzx@ciac.ac.cn (ZW); Fax: (+86) b Department of Radiology, the First Hospital of Jilin University, Changchun , P. R. China huimaozhanglinda@163.com. c University of Chinese Academy of Sciences, Beijing , P. R. China 1 Additional Experimental Section 2 Additional Figures S1-S12 3 Additional Table S1-S3 4 Additional References

2 1 Additional Experimental Section Synthesis of oleate-capped NaGdF 4 Nanodots: The oleate-capped NaGdF 4 Nanodots were synthesized according to a previously reported method with slight modifications. S1-S3 Typically, 0.5 ml GdCl 3 (1.6 M) aqueous solutions were injected in a 100 ml flask, and dried by heating. Then, oleic acid (4 ml) and 1-octadecene (15 ml) were added into the flask. The mixture was heated to 150 C under argon atmosphere to obtain a homogeneous solution. After cooling to 50 C, a methanol solution (10 ml) containing NH 4 F (3 mmol) and NaOH (2.5 mmol) was slowly added into the solution and stirred overnight. And then the methanol was evaporated and the solution was degassed for 10 min. Subsequently, the temperature of the mixture was increased to 250 C at a rate of 10 C min -1 and maintained at 250 C for 10 min under argon protection. After cooling to room temperature, the as-prepared NaGdF 4 Nanodots were collected by centrifugation (10000 rpm for 10 min), and washed with ethanol (10 ml, three times). Finally, the NaGdF 4 Nanodots were redispersed in cyclohexane (10 ml).

3 2 Additional Figures S1-S9 Figure S1 XPS survey spectra of hydrophobic oleate-nagdf 4 nanodots (a) and hydrophilic ppeptide-nagdf 4 nanodots (b).

4 Figure S2 EDS analysis of hydrophobic oleate-nagdf 4 nanodots (black line) and hydrophilic ppeptide-nagdf 4 nanodots (red line), respectively.

5 Figure S3 FTIR spectra of hydrophobic oleate-nagdf 4 nanodots (black line) and hydrophilic ppeptide-nagdf 4 nanodots (red line), respectively.

6 Figure S4. TGA curves of ppeptide-nagdf 4 nanodots and tryptone-nagdf 4 nanodots.

7 Figure S5. The HDs of ppeptides-nagdf4 nanodots in the PBS with different ph values. The HDs are 11.7 ± 1.3, 10.1 ± 1.2, 7.5 ± 0.6, and 8.7 ± 0.5 for ph 5.0, 6.0, 7.0 and 8.0, respectively.

8 Figure S6 Digital photographs of 1 mg ml -1 ppeptide-nagdf 4 nanodots in different dispersing media including water (a), PBS (ph=7.4, b), 0.9% NaCl solution (c) and DMEM supplemented with 10% FBS (d), respectively.

9 Figure S7 The relative viabilities of SW620 cells as a function of the concentrations of ppeptide-nagdf 4 nanodots in culture medium. Error bars mean standard deviations (n = 5).

10 Figure S8 The histology analysis of drug induced orthotopic colorectal tumor.

11 Figure S9 (a) In vivo MR images of BALB/C mouse bearing drug induced orthotopic colorectal tumor after intravenous injection of tryptone-nagdf 4 nanodots (10 mg Gd kg -1 body) at different timed intervals (pre-injection (0), 1, 2, and 24 h post-injection), respectively. (b) Digital photograph of the rectum with tumor. (c) Corresponding data analysis of MR measurements. The tumor site was marked by circle. Error bars mean standard deviations (n = 5).

12 Figure S10 (a) In vivo MR images of BALB/C mouse bearing drug induced orthotopic colorectal tumor after intravenous injection of ppeptide-nagdf 4 nanodots (2.0 mg Gd kg -1 body) at different timed intervals (pre-injection (0), 1, 2, and 24 h post-injection), respectively. (b) Digital photograph of the rectum with tumor. (c) Corresponding data analysis of MR measurements. The tumor site was marked by circle. Error bars mean standard deviations (n = 5).

13 Figure S11 TEM micrograph of ppeptide-nagdf 4 nanodots which were found in the mouse urine.

14 Figure S12 Biodistribution of Gd element in main organs of mice. The organs of mice bearing drug induced orthotopic colorectal tumor were harvested at 1, 2 and 24 h post-intravenous injection of ppeptide-nagdf 4 nanodots. As a control, the organs of health mice were harvested at 24 h post-intravenous injection of ppeptide-nagdf 4 nanodots. The concentration of ppeptide-nagdf 4 nanodots is 10 mg Gd kg -1 body.

15 3 Additional Table S1-S3 Table S1 The HD and Zeta potential of ppeptides-nagdf 4 nanodots with different dispersants. Dispersant Zeta potential (mv) HD (nm) Water 8.24 ± ± 0.1 PBS 7.32 ± ± % NaCl solution 9.45 ± ± 2.0 DMEM with 10% FBS ± ± 2.3 The ppeptides-nagdf 4 nanodots have negative surface charge and relative large HD in DMEM with 10% FBS because the ppeptides-nagdf 4 nanodots can interact with proteins in FBS.

16 Table S2 The blood hematology analysis of healthy mouse at 30 day post-injection of a single dose of ppeptide-nagdf 4 nanodots (Gd content: 10 mg kg -1 body) in NaCl solution (0.9 wt%). Hematological Units Control Treatment WBC 10 9 /L 9.38 ± ± 0.69 RBC /L 9.77 ± ± 0.98 HGB g/l ± ± MCV fl ± ± 6.74 MCH pg ± ± 1.84 MCHC g/l ± ± PLT 10 9 /L ± ± PDW fl ± ± 0.82

17 Table S3 The blood biochemical assay of healthy mouse at 30 day post-injection of a single dose of ppeptide-nagdf 4 nanodots (Gd content: 10 mg kg -1 body) in NaCl solution (0.9 wt%). Biochemistry Units Control Treatment AST U/L ± ± 15.8 ALT U/L 44.7 ± ± 7.2 TP g/l 73.5 ± ± 5.7 BUN mmol/l 7.24 ± ± 0.84 CRE μmol/l 36.8 ± ± 3.86

18 4 Additional References S1. N. J. J. Johnson, W. Oakden, G. J. Stanisz, R. S. Prosser and F. C. J. M. van Veggel, Chem. Mater., 2011, 23, S2. F. Liu, X. He, J. Zhang, H. Zhang and Z. Wang, Small, 2015, 11, S3. H. Xing, S. Zhang, W. Bu, X. Zheng, L. Wang, Q. Xiao, D. Ni, J. Zhang, L. Zhou, W. Peng, K. Zhao, Y. Hua and J. Shi, Adv. Mater., 2014, 26,

General and Facile Surface Functionalization of Hydrophobic Nanocrystals with Poly(amino acid) for Cell Luminescence Imaging

General and Facile Surface Functionalization of Hydrophobic Nanocrystals with Poly(amino acid) for Cell Luminescence Imaging General and Facile Surface Functionalization of Hydrophobic Nanocrystals with Poly(amino acid) for Cell Luminescence Imaging Sheng Huang, Min Bai, Leyu Wang* State Key Laboratory of Chemical Resource Engineering,

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based

More information

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing

More information

EFFECT OF COMPRESSED CO 2 ON THE PROPERTIES OF AOT IN ISOOCTANE REVERSE MICELLAR SOLUTION AND ITS APPLICATION TO RECOVER NANOPARTICLES

EFFECT OF COMPRESSED CO 2 ON THE PROPERTIES OF AOT IN ISOOCTANE REVERSE MICELLAR SOLUTION AND ITS APPLICATION TO RECOVER NANOPARTICLES EFFECT OF COMPRESSED CO 2 ON THE PROPERTIES OF AOT IN ISOOCTANE REVERSE MICELLAR SOLUTION AND ITS APPLICATION TO RECOVER NANOPARTICLES Dongxia Liu, Jianling Zhang, Tiancheng Mu, Jing Chen, Weize Wu, Jun

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

Covering the optical spectrum through collective rare-earth doping of NaGdF 4 nanoparticles: 806 and 980 nm excitation routes

Covering the optical spectrum through collective rare-earth doping of NaGdF 4 nanoparticles: 806 and 980 nm excitation routes Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2017 Electronic Supporting Information Covering the optical spectrum through collective

More information

Supporting information for the manuscript

Supporting information for the manuscript Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2014 Supporting information for the manuscript Toward enhanced photoactivity

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors

A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors Electronic Supplementary Information (ESI): A Facile Method for Enhancing the Sensing Performance of Zinc Oxide Nanofibers Gas Sensors Pei-Pei Wang a, Qi Qi a, Rui-Fei Xuan a,b, Jun Zhao a, Li-Jing Zhou

More information

Protein-Mediated Anti-Adhesion Surface against Oral Bacteria

Protein-Mediated Anti-Adhesion Surface against Oral Bacteria Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 Supporting Information Protein-Mediated Anti-Adhesion Surface against Oral Bacteria Xi Liu a,b,

More information

Supporting Information

Supporting Information Supporting Information Cancer Cell Membrane-Biomimetic Nanoprobes with Two-Photon Excitation and Near-Infrared Emission for Intravital Tumor Fluorescence Imaging Yanlin Lv 1,2,, Ming Liu 3,4,, Yong Zhang

More information

Supporting information. Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon. Nanoparticles for Synergistic Thermochemotherapy of Tumor

Supporting information. Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon. Nanoparticles for Synergistic Thermochemotherapy of Tumor Supporting information Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon Nanoparticles for Synergistic Thermochemotherapy of Tumor Xian Li, Xiudan Wang, Luping Sha, Da Wang, Wei Shi, Qinfu Zhao*,,

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information A Novel and Facile Zn-mediated Intramolecular Five-membered Cyclization of β-tetraarylporphyrin Radicals from β-bromotetraarylporphyrins Dong-Mei Shen, Chao Liu, Qing-Yun

More information

A quantitative study of chemical kinetics for the synthesis of. doped oxide nanocrystals using FTIR spectroscopy

A quantitative study of chemical kinetics for the synthesis of. doped oxide nanocrystals using FTIR spectroscopy Supporting information A quantitative study of chemical kinetics for the synthesis of doped oxide nanocrystals using FTIR spectroscopy Na Zhang, 1,2 Xin Wang, 1 Zhizhen Ye 1 and Yizheng Jin, 1,3* 1 State

More information

Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery

Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Supporting Information for Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Dongjian Shi a*, Maoshuang Ran a, Li Zhang a, He Huang a, Xiaojie

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2014 Supporting Information Remarkable improvement in visible-light induced

More information

An Orthogonal Array Optimization of Lipid-like Nanoparticles for. mrna Delivery in Vivo

An Orthogonal Array Optimization of Lipid-like Nanoparticles for. mrna Delivery in Vivo Supporting Information An rthogonal Array ptimization of Lipid-like Nanoparticles for mrna Delivery in Vivo Bin Li, Xiao Luo, Binbin Deng, Junfeng Wang, David W. McComb, Yimin Shi, Karin M.L. Gaensler,

More information

Organic Semiconducting Photoacoustic. Nanodroplets for Laser-Activatable Ultrasound. Imaging and Combinational Cancer Therapy

Organic Semiconducting Photoacoustic. Nanodroplets for Laser-Activatable Ultrasound. Imaging and Combinational Cancer Therapy Organic Semiconducting Photoacoustic Nanodroplets for Laser-Activatable Ultrasound Imaging and Combinational Cancer Therapy Wei Tang, Zhen Yang *, Sheng Wang, Zhantong Wang, Jibin Song, Guocan Yu, Wenpei

More information

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin

More information

Supporting Information. Silver Nanoparticle-Gated Mesoporous Silica-Coated Gold Nanorods. Low Premature Release and Multifunctional

Supporting Information. Silver Nanoparticle-Gated Mesoporous Silica-Coated Gold Nanorods. Low Premature Release and Multifunctional Supporting Information Silver Nanoparticle-Gated Mesoporous Silica-Coated Gold Nanorods (AuNR@MS@AgNPs): Low Premature Release and Multifunctional Cancer Theranostic Platform Zhehua Zhang, a, Changhui

More information

Dual-Responsive Polymer Micelles for. Target-Cell-Specific Anticancer Drug Delivery

Dual-Responsive Polymer Micelles for. Target-Cell-Specific Anticancer Drug Delivery Dual-Responsive Polymer Micelles for Target-Cell-Specific Anticancer Drug Delivery Xing Guo, Chunli Shi, Guang Yang, Jie Wang, Zhenghong Cai, and Shaobing Zhou,, * Key Laboratory of Advanced Technologies

More information

HM5. Hematology Analyzer BETTER. ACTUALLY.

HM5. Hematology Analyzer BETTER. ACTUALLY. HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Stepwise Directing Nanocrystals to Self-Assemble at Water/Oil Interfaces Jing Wang, Dayang Wang, Nelli S. Sobal, Michael Giersig, Ming Jiang,

More information

Simultaneous Blood Brain Barrier Crossing and Protection for Stroke Treatment Based on Edaravone-Loaded Ceria Nanoparticles

Simultaneous Blood Brain Barrier Crossing and Protection for Stroke Treatment Based on Edaravone-Loaded Ceria Nanoparticles Supporting Information Simultaneous Blood Brain Barrier Crossing and Protection for Stroke Treatment Based on Edaravone-Loaded Ceria Nanoparticles Qunqun Bao, Ping Hu, * Yingying Xu, Tiansheng Cheng, Chenyang

More information

MOF-Derived Zn-Mn Mixed Hollow Disks. with Robust Hierarchical Structure for High-Performance. Lithium-Ion Batteries

MOF-Derived Zn-Mn Mixed Hollow Disks. with Robust Hierarchical Structure for High-Performance. Lithium-Ion Batteries Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information (ESI) MOF-Derived Zn-Mn Mixed Oxides@Carbon

More information

Supporting Information. Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base

Supporting Information. Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base Supporting Information Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base Feng Wang, a Haijun Yang, b Hua Fu, b,c * and Zhichao Pei a * a College

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Supporting Information X-Ray Responsive Nanoparticles with Triggered Release of Nitrite, a Precursor

More information

Advanced Hematology Five-Part Differential. Simple Operation

Advanced Hematology Five-Part Differential. Simple Operation HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior

More information

Supporting Information

Supporting Information Supporting Information Toward High-Efficient Red Emissive Carbon Dots: Facile Preparation, Unique Properties, and Applications as Multifunctional Theranostic Agents Shan Sun,, Ling Zhang, Kai Jiang, Aiguo

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Supporting Information Cancer-mitochondria-targeted photodynamic therapy with supramolecular

More information

Plasmonic blood glucose monitor based on enzymatic. etching of gold nanorods

Plasmonic blood glucose monitor based on enzymatic. etching of gold nanorods Plasmonic blood glucose monitor based on enzymatic etching of gold nanorods Xin Liu, Shuya Zhang, Penglong Tan, Jiang Zhou, Yan Huang, Zhou Nie* and Shouzhuo Yao State Key Laboratory of Chemo/Biosensing

More information

Electronic Supplementary Material

Electronic Supplementary Material Electronic Supplementary Material PAMAM Dendrimers Bearing Electron-Donating Chromophores: Fluorescence and Electrochemical Properties Bing-BingWang a, Xin Zhang a, Ling Yang a, Xin-Ru Jia* a, Yan Ji a,

More information

Supporting information for

Supporting information for Supporting information for A Coordination Gelator that Shows a Reversible Chromatic Change and a Sol-Gel Phase Transition Behavior upon xidative / Reductive Stimuli Shin-ichiro Kawano, orifumi Fujita,

More information

Electronic Supporting Information

Electronic Supporting Information Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2018 Electronic Supporting Information Tetraphenylpyrazine-based luminogens with full-colour

More information

Facile Cu(II) mediated conjugation of thioesters and thioacids to peptides and proteins under mild conditions

Facile Cu(II) mediated conjugation of thioesters and thioacids to peptides and proteins under mild conditions Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Facile Cu(II) mediated conjugation of thioesters and thioacids to peptides

More information

Lewis acid-catalyzed regioselective synthesis of chiral α-fluoroalkyl amines via asymmetric addition of silyl dienolates to fluorinated sulfinylimines

Lewis acid-catalyzed regioselective synthesis of chiral α-fluoroalkyl amines via asymmetric addition of silyl dienolates to fluorinated sulfinylimines Supporting Information for Lewis acid-catalyzed regioselective synthesis of chiral α-fluoroalkyl amines via asymmetric addition of silyl dienolates to fluorinated sulfinylimines Yingle Liu a, Jiawang Liu

More information

L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular

L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular Supporting Information: L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular Hydrogels Rita Das Mahapatra, a Joykrishna Dey* a, and Richard G. Weiss b a

More information

Polybenzimidazole block sulfonated poly(arylene ether sulfone) ionomers

Polybenzimidazole block sulfonated poly(arylene ether sulfone) ionomers Supplementary information Polybenzimidazole block sulfonated poly(arylene ether sulfone) ionomers Feifei Ng, a Byungchan Bae, a Kenji Miyatake* a,b and Masahiro Watanabe* a a Fuel Cell Nanomaterials Center

More information

Electrospun Micropatterned Nanocomposites Incorporated with Cu 2 S Nanoflowers for Skin Tumor Therapy and Wound Healing

Electrospun Micropatterned Nanocomposites Incorporated with Cu 2 S Nanoflowers for Skin Tumor Therapy and Wound Healing Supporting Information for Electrospun Micropatterned Nanocomposites Incorporated with Cu 2 S Nanoflowers for Skin Tumor Therapy and Wound Healing Xiaocheng Wang 1, 2, Fang lv 3, Tian Li 1, 2, Yiming Han

More information

Engineering the Growth of TiO 2 Nanotube Arrays on Flexible Carbon Fibre Sheets

Engineering the Growth of TiO 2 Nanotube Arrays on Flexible Carbon Fibre Sheets Engineering the Growth of TiO 2 Nanotube Arrays on Flexible Carbon Fibre Sheets Peng Chen, a Li Gu, b Xiudong Xue, a Mingjuan Li a and Xuebo Cao* a a Key Lab of Organic Synthesis of Jiangsu Province and

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Supporting Information. Copper-catalyzed cascade synthesis of benzimidazoquinazoline derivatives under mild condition

Supporting Information. Copper-catalyzed cascade synthesis of benzimidazoquinazoline derivatives under mild condition Supporting Information Copper-catalyzed cascade synthesis of benzimidazoquinazoline derivatives under mild condition Shan Xu, Juyou Lu and Hua Fu* Key Laboratory of Bioorganic Phosphorus Chemistry and

More information

Supporting information: Engineering the Edges of MoS 2 (WS 2 ) Crystals for Direct Exfoliation into Monolayers in Polar Micromolecular Solvents

Supporting information: Engineering the Edges of MoS 2 (WS 2 ) Crystals for Direct Exfoliation into Monolayers in Polar Micromolecular Solvents Supporting information: Engineering the Edges of MoS 2 (WS 2 ) Crystals for Direct Exfoliation into Monolayers in Polar Micromolecular Solvents Xiao Hai ζ, Kun Chang* ζ, Hong Pang, Mu Li, Peng Li, Huimin

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Artepillin C, is it a good marker for quality control of Brazilian Green Propolis? Cui-ping Zhang 1, Xiao-ge Shen 1, Jia-wei Chen 1, Xia-sen Jiang 1, Kai Wang 2, Fu-liang Hu 1 *

More information

Supporting information

Supporting information S1 Supporting information Biodegradable Injectable Polymer Systems Exhibiting Temperature-Responsive Irreversible Sol-to-Gel Transition by Covalent Bond Formation Yasuyuki YOSHIDA 1,2, Keisuke KAWAHARA

More information

Journal of Chemical and Pharmaceutical Research, 2015, 7(8): Research Article

Journal of Chemical and Pharmaceutical Research, 2015, 7(8): Research Article Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 215, 7(8):257-261 Research Article ISSN : 975-7384 CODEN(USA) : JCPRC5 Pulping process for rice straw in basic ionic liquid

More information

Supporting Information for. Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the. analysis of Glucose in Whole Blood

Supporting Information for. Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the. analysis of Glucose in Whole Blood Supporting Information for Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the analysis of Glucose in Whole Blood Yueling Liu, Jingwei Zhu, Yanmei Xu, Yu Qin*, Dechen Jiang*

More information

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range 5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN

More information

Tunable surface plasmon resonance and enhanced electrical. conductivity of In doped ZnO colloidal nanocrystals

Tunable surface plasmon resonance and enhanced electrical. conductivity of In doped ZnO colloidal nanocrystals Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Abs (normalised) Electronic Supplementary Information : Tunable surface plasmon resonance and

More information

Supporting Information

Supporting Information Supporting Information Synthesis of N-Heteropolycyclic Compounds Including Quinazolinone Skeletons by Using Friedel-Crafts Alkylation Bu Keun Oh, Eun Bi Ko, Jin Wook Han* and Chang Ho Oh* Department of

More information

A 3D Porous Metal-Organic Framework Exhibiting Selective. Adsorption of Water over Organic Solvents

A 3D Porous Metal-Organic Framework Exhibiting Selective. Adsorption of Water over Organic Solvents Supporting Information for A 3D Porous Metal-Organic Framework Exhibiting Selective Adsorption of Water over Organic Solvents Jin-Zhong Gu, Long Jiang, Wen-Guan Lu, Hong-Cai Zhou, and Tong-Bu Lu* Table

More information

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2011

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2011 Supporting Information Experimental details 1. Materials Ferric chloride (FeCl 3 6H 2 O), Ethylene glycol (EG) and Ammonium hydroxide (NH 3 H 2 O) were obtained from Beijing Chemical Regent Co. Ltd. (Beijing,

More information

Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing, , P. R.

Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing, , P. R. Electrochemical synthesis of p-type Zn-Doped α-fe 2 O 3 nanotube arrays for photoelectrochemical water splitting Xiaopeng Qi, a,b Guangwei She,* a Meng Wang, a,b Lixuan Mu, a and Wensheng Shi* a a Key

More information

Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface. Modification Effects on Cellular Uptake,

Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface. Modification Effects on Cellular Uptake, Electronic Supplementary Material (ESI) for Toxicology Research. This journal is The Royal Society of Chemistry 2014 Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface Modification

More information

Supporting Information

Supporting Information Supporting Information Developing Activity Localization Fluorescence Peptide Probe Using Thiol-Ene Click Reaction for Spatially Resolved Imaging of Caspase-8 in Live Cells Wei Liu,, Si-Jia Liu,, Yong-Qing

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Microwave heating in peptide side chain modification via sulfhydryl reaction

Microwave heating in peptide side chain modification via sulfhydryl reaction Microwave heating in peptide side chain modification via sulfhydryl reaction E. Calce and S. De Luca* Institute of Biostructures and Bioimaging, National Research Council, 80134 Naples, Italy stefania.deluca@cnr.it

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supplementary Information Spacer-enhanced chymotrypsin-activated peptide-functionalized gold

More information

The First Au-Nanoparticles Catalyzed Green Synthesis of Propargylamines Via Three-Component Coupling Reaction of Aldehyde, Alkyne And Amine

The First Au-Nanoparticles Catalyzed Green Synthesis of Propargylamines Via Three-Component Coupling Reaction of Aldehyde, Alkyne And Amine Supporting information of The First Au-anoparticles Catalyzed Green Synthesis of Propargylamines Via Three-Component Coupling Reaction of Aldehyde, Alkyne And Amine Mazaahir Kidwai a *, Vikas Bansal a,

More information

Cytosolar delivery of large proteins using nanoparticlestabilized

Cytosolar delivery of large proteins using nanoparticlestabilized Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Supporting Information Cytosolar delivery of large proteins using nanoparticlestabilized nanocapsules

More information

Supporting Information for. Qixiong Zhang,, Fuzhong Zhang, Yue Chen, Yin Dou, Hui Tao, Dinglin Zhang, Ruibing Wang ǁ, Xiaohui Li, Jianxiang Zhang*,

Supporting Information for. Qixiong Zhang,, Fuzhong Zhang, Yue Chen, Yin Dou, Hui Tao, Dinglin Zhang, Ruibing Wang ǁ, Xiaohui Li, Jianxiang Zhang*, Supporting Information for Structure-Property Correlations of Reactive Oxygen Species-Responsive and Hydrogen Peroxide-Eliminating Materials with Anti-Oxidant and Anti-Inflammatory Activities Qixiong Zhang,,

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Supporting Information

Supporting Information Supporting Information Self-assembled micro/nano-structured Zn 2 GeO 4 hollow spheres: direct synthesis and enhanced photocatalytic activity Jun Liang, ab Jie Xu, a Jinlin Long, a Zizhong Zhang a and Xuxu

More information

Electronic Supplementary Information. High-Yield Bottom-Up Synthesis of 2D Metal Organic Frameworks

Electronic Supplementary Information. High-Yield Bottom-Up Synthesis of 2D Metal Organic Frameworks Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information High-Yield Bottom-Up Synthesis of

More information

Optimization of Enzyme-assisted Ultrasonic Extraction of Total Ginsenosides from Ginseng Roots Guangna LIU, Yulin ZUO, Jing ZHANG

Optimization of Enzyme-assisted Ultrasonic Extraction of Total Ginsenosides from Ginseng Roots Guangna LIU, Yulin ZUO, Jing ZHANG 2019 2nd International Conference on Computer Science and Advanced Materials (CSAM 2019) Optimization of Enzyme-assisted Ultrasonic Extraction of Total Ginsenosides from Ginseng Roots Guangna LIU, Yulin

More information

Graphene Quantum Dots-Band-Aids Used for Wound Disinfection

Graphene Quantum Dots-Band-Aids Used for Wound Disinfection Supporting information Graphene Quantum Dots-Band-Aids Used for Wound Disinfection Hanjun Sun, Nan Gao, Kai Dong, Jinsong Ren, and Xiaogang Qu* Laboratory of Chemical Biology, Division of Biological Inorganic

More information

Supporting Information (SI) for

Supporting Information (SI) for Supporting Information (SI) for Component-Controlled Synthesis and Assembly of Cu-Pd Nanocrystals on Graphene for Oxygen Reduction Reaction Yulin Zheng, Shulin Zhao, Suli Liu, Huanhuan Yin, Yu-Yun Chen,

More information

Date... Name... Group... Urine sample (Tube No 2)

Date... Name... Group... Urine sample (Tube No 2) Date... Name... Group... Instructions for the practical lesson on biochemistry Topic: Non-protein nitrogen compounds Task 1: Estimation of creatinine in serum and urine 1. Trichloroacetic acid 1.22 mol/l

More information

SediVue Dx Urine Sediment Analyser. Fresh samples / Revolutionary technology / A new standard of care. The Complete Diagnostic Solution

SediVue Dx Urine Sediment Analyser. Fresh samples / Revolutionary technology / A new standard of care. The Complete Diagnostic Solution SediVue Dx Urine Sediment Analyser Fresh samples / Revolutionary technology / A new standard of care SediVue Dx Urine Sediment Analyser Improving the standard of care Automation ensures consistent, accurate

More information

Supporting Information for

Supporting Information for Supporting Information for Tandem Mass Spectrometry Assays of Palmitoyl Protein Thioesterase and Tripeptidyl Peptidase Activity in Dried Blood Spots for the Detection of Neuronal Ceroid Lipofuscinoses

More information

Supporting Information For

Supporting Information For Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li

More information

ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation

ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation

More information

ph and Reduction Dual Responsive Polyurethane Triblock Copolymers for Efficient Intracellular Drug Delivery

ph and Reduction Dual Responsive Polyurethane Triblock Copolymers for Efficient Intracellular Drug Delivery Supporting Information ph and Reduction Dual Responsive Polyurethane Triblock Copolymers for Efficient Intracellular Drug Delivery Shuangjiang Yu a, Chaoliang He* a, Jianxun Ding a,b, Yilong Cheng a,b,

More information

Supporting Information

Supporting Information Supporting Information Discovery of Pentacyclic Triterpenes as Potential Entry Inhibitors of Influenza Viruses Maorong Yu*,,, Longlong Si,, Yufei Wang, Yiming Wu, Fei Yu,, Pingxuan Jiao, Yongying Shi,

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Enzyme-activatable Probe with a Self-immolative Linker for Rapid and Sensitive

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Supporting Information Facile Three-Step Synthesis and Photophysical Properties of [8]-, [9]-,

More information

Zillillah, a Guowei Tan, a,b and Zhi Li* a,b. 4 Engineering Drive 4, Singapore Fax: ; Tel:

Zillillah, a Guowei Tan, a,b and Zhi Li* a,b. 4 Engineering Drive 4, Singapore Fax: ; Tel: Highly Active, Stable, and Recyclable Magnetic Nano-size Solid Acid Catalysts: Efficient Esterification of Free Fatty Acid in Grease to Produce Biodiesel Zillillah, a Guowei Tan, a,b and Zhi Li* a,b a

More information

Supporting information

Supporting information Supporting information Blue Quantum Dot Light-Emitting Diodes with High Electroluminescent Efficiency Lishuang Wang,, Jie Lin *, Yongsheng Hu, Xiaoyang Guo,Ying Lv, Zhaobing Tang,, Jialong Zhao *, Yi Fan,

More information

Research Article Study on Optimal Conditions of Alcalase Enzymatic Hydrolysis of Soybean Protein Isolate

Research Article Study on Optimal Conditions of Alcalase Enzymatic Hydrolysis of Soybean Protein Isolate Advance Journal of Food Science and Technology 9(2): 154-158, 2015 DOI: 10.19026/ajfst.9.1952 ISSN: 2042-4868; e-issn: 2042-4876 2015 Maxwell Scientific Publication Corp. Submitted: February 13, 2015 Accepted:

More information

Rb 1. Results of variance analysis REFERENCES Chin J Mod Appl Pharm, 2014 September, Vol.31 No

Rb 1. Results of variance analysis REFERENCES Chin J Mod Appl Pharm, 2014 September, Vol.31 No 5 Tab. 5 Results of variance analysis F A 0.589 2 0.295 22.9 B 0.065 0 2 0.032 5 2.5 C 0.286 2 0.143 11.14 D( ) 0.025 8 2 0.012 9 F [4] F 0.05(2,2) =19 F 0.01(2,2) =99 Note: Chek the table of F values

More information

Supporting Information

Supporting Information Supporting Information ph- and Amylase-Responsive Carboxymethyl Starch/Poly(2-Isobutyl-acrylic acid) Hybrid Microgels as Effective Enteric Carriers for Oral Insulin Delivery Liang Liu, a,b Ying Zhang,

More information

Fluorescent Carbon Dots as Off-On Nanosensor for Ascorbic Acid

Fluorescent Carbon Dots as Off-On Nanosensor for Ascorbic Acid Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Fluorescent Carbon Dots as Off-On Nanosensor for Ascorbic Acid Jun Gong, Xin Lu, Xueqin An*

More information

Surface-Enhanced Raman Scattering Active Gold Nanoparticles. with Enzyme-Mimicking Activities for Measuring Glucose and

Surface-Enhanced Raman Scattering Active Gold Nanoparticles. with Enzyme-Mimicking Activities for Measuring Glucose and Surface-Enhanced Raman Scattering Active Gold Nanoparticles with Enzyme-Mimicking Activities for Measuring Glucose and Lactate in Living Tissues Yihui Hu, Hanjun Cheng, Xiaozhi Zhao, Jiangjiexing Wu, Faheem

More information

Supporting information

Supporting information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information Experimental Section Synthesis and modification of SBA-15. In a typical

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information ovel pseudo[2]rotaxanes constructed by selfassembly of dibenzyl

More information

Alumina stabilized ZnO-graphene anode for lithium ion

Alumina stabilized ZnO-graphene anode for lithium ion Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting Information for Alumina stabilized ZnO-graphene anode for lithium ion batteries via

More information

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing

More information

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan

More information

Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells

Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing

More information

A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state

A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state Mingguang Pan, Min Xue* Department of Chemistry, Zhejiang University, Hangzhou 310027, P. R. China Fax:

More information

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test. 5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC

More information

Photo-reduction and Stabilization Capability of Molecular Weight. Fractionated Natural Organic Matter in Transformation of Silver Ion to

Photo-reduction and Stabilization Capability of Molecular Weight. Fractionated Natural Organic Matter in Transformation of Silver Ion to Supporting information Photo-reduction and Stabilization Capability of Molecular Weight Fractionated Natural Organic Matter in Transformation of Silver Ion to Metallic Nanoparticle 7 8 9 Yongguang Yin

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information MnO 2 -induced synthesis of fluorescent polydopamine nanparticles

More information

Supporting Information. Zinc hydroxide nanostrands: unique precursor for ZIF-8. thin membranes toward highly size-sieving gas separation

Supporting Information. Zinc hydroxide nanostrands: unique precursor for ZIF-8. thin membranes toward highly size-sieving gas separation Electronic Supplementary Material (ESI) for CrystEngComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Zinc hydroxide nanostrands: unique precursor for ZIF-8 thin membranes

More information

CHAPTER 4 SYNTHESIS AND CHARACTERIZATION OF ZnO NANOPARTICLES 4.1 INTRODUCTION 4.2 EXPERIMENTAL DETAILS Synthesis of ZnO nanoparticles

CHAPTER 4 SYNTHESIS AND CHARACTERIZATION OF ZnO NANOPARTICLES 4.1 INTRODUCTION 4.2 EXPERIMENTAL DETAILS Synthesis of ZnO nanoparticles CHAPTER 4 SYNTHESIS AND CHARACTERIZATION OF ZnO NANOPARTICLES 4.1 INTRODUCTION Because of the very small grain size and large surface area per unit mass, the nanostructured materials exhibit a variety

More information

Supporting information

Supporting information Supporting information Conformationally Induced Off-On Cell Membrane Chemosensor Targeting Receptor Protein-Tyrosine Kinases for in Vivo and in Vitro Fluorescence Imaging of Cancers Yang Jiao,, Jiqiu Yin,

More information

Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms

Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Supporting Information for Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Submitted by Yong Feng, Deli

More information