Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
|
|
- Melinda Chambers
- 5 years ago
- Views:
Transcription
1 5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC NONE SEEN HPF EPI CELL RARE (0-1) HPF BACTERIA NONE SEEN HPF CRYSTALS NONE SEEN HPF CASTS NONE SEEN HPF COLOR YELLOW CLARITY CLEAR MUCUS NONE SEEN Ascn: RE: 900 COLLECTION METHOD FREE-CATCH Protein test is performed and confirmed by the sulfosalicylic acid test. 5/5/2014 L Chemistry results from IDEXX Reference LaboratoryRequisition ID: C Posted Final GLU 105 mg/dl TP 7.3 g/dl ALB 2.7 g/dl ALKP 136 U/L ALT 71 U/L AST 22 U/L BUN/UREA 41 mg/dl H 9-31 Ca 10.4 mg/dl Chloride 111 mmol/l CHOL 227 mg/dl CREA 1.3 mg/dl DBIL 0.0 mg/dl IBIL 0.1 mg/dl West Chelsea Veterinary Page 1 of 5 Date: 5/13/2014 4:22 PM
2 PHOS 3.3 mg/dl Potassium 4.5 mmol/l TBIL 0.1 mg/dl Sodium 148 mmol/l A/G Ratio 0.6 L B/C Ratio 31.5 Na/K Ratio GLOB 4.6 g/dl H RE: 281 HEMOLYSIS INDEX N Index of N,+,++ exhibits no significant effect on chemistry values. RE: 282 LIPEMIA INDEX N Index of N,+,++ exhibits no significant effect on chemistry values. PRE-ACTH 4.6 ug/dl POST-ACTH 4.0 ug/dl TUBE ORDER AND LABELED DRAW TIMES RECHECKED ACTH Reference Range: Canine: Feline Pre-ACTH (resting) cortisol Post-ACTH cortisol Equivocal post-acth cortisol >22 >19 Post-ACTH cortisol consistent with hyperadrenocorticism <2 <0.5 Post-ACTH cortisol consistent with hypoadrenocorticism 1-5 n/a Desired pre- and post-acth cortisol on West Chelsea Veterinary Page 2 of 5 Date: 5/13/2014 4:22 PM
3 lysodren therapy ACTH response test is only clearly positive (>22) in 30% of dogs with hyperadrenocorticism (HAC); equivocally positive in another 30% of dogs with HAC, and normal in 40 % of dogs with HAC.* If the ACTH response test is normal and HAC is still suspected, proceed with a low-dose dexamethasone suppression test. Dogs with iatrogenic Cushing's disease will have flatline response test results in the low end or below the normal reference range. Both HAC and hypoadrenocorticism are rare diseases in cats. *Reference: Feldman and Nelson; Canine and Feline Endocrinology and Reproduction. 3rd ed. W.B.Saunders Co., /5/2014 L Hematology results from IDEXX Reference HCT 42.8 % PLATELETS 614 K/uL H BASO 0.0 % EOS 2.4 % HGB 13.9 g/dl LYMPHS 11.9 % MCH 24.0 pg MCHC 32.5 g/dl L MCV 74 fl MONOS 6.8 % NEUT SEG 78.9 % RBC 5.79 M/uL RETIC CNT 0.6 % WBC 9.0 K/uL ABS BASO 0 /ul ABS EOS 216 /ul ABS LYMPHS 1071 /ul ABS MONOS 612 /ul West Chelsea Veterinary Page 3 of 5 Date: 5/13/2014 4:22 PM
4 ABS NEUTS 7101 /ul ABS RET 35 K/uL AO 854 THYROID PANEL 3 DESRIE MLIBB 2SS,L RE: 3034 REMARKS REMARKS SLIDE REVIEWED MICROSCOPICALLY. PLATELETS APPEAR INCREASED. NO PARASITES SEEN MN 5/5/2014 L Miscellaneous results from IDEXX Reference RE: 9996 ADD-ON TEST ADD-ON TEST Your Add On request has been processed. Refer to Accession: J TSH K ng/ml Ascn: J SS.REFER TO J Increased canine TSH values may occur in dogs with untreated primary hypothyroidism. Sick euthyroid dogs are expected to have low normal TSH concentrations. Secondary or tertiary hypothyroidism (pituitary or hypothalamic lesions) are reported to occur in less than 5% of hypothyroid dogs. West Chelsea Veterinary Page 4 of 5 Date: 5/13/2014 4:22 PM
5 T4 1.0 ug/dl Ascn: J SS.REFER TO J Interpretive ranges: <1.0 Low Normal >4.0 High Therapeutic Dogs with no clinical signs of hypothyroidism and results within the normal reference range are likely euthyroid. Dogs with low T4 concentrations may be hypothyroid or euthyroid sick. Occasionally, hypothyroid dogs can have T4 concentrations that are low normal. Dogs with clinical signs of hypothyroidism and low or low normal T4 concentrations may be evaluated further by submission of free T4 and canine TSH. A high T4 concentration in a clinically normal dog is likely variation of normal; however elevations may occur secondary to thyroid autoantibodies or rarely thyroid neoplasia. For dogs on thyroid supplement, acceptable 4-6 hour post pill total T4 concentrations generally fall within the higher end or slightly above the reference range. West Chelsea Veterinary Page 5 of 5 Date: 5/13/2014 4:22 PM
Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationHematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit
TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationMeet Moxie. Moxie looks great. Looks can be deceiving. Moxie is visible through die-cut.
Practice what s possible with support from IDEXX Focused on veterinary practices For over 20 years, IDEXX has been a pet health company dedicated to serving you and your staff. The industry s broadest
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
More informationSediVue Dx Urine Sediment Analyser. Fresh samples / Revolutionary technology / A new standard of care. The Complete Diagnostic Solution
SediVue Dx Urine Sediment Analyser Fresh samples / Revolutionary technology / A new standard of care SediVue Dx Urine Sediment Analyser Improving the standard of care Automation ensures consistent, accurate
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationHematology. Chemistry AT HOME VETERINARY CARE. Patient: MAURICE GILLEN ( )
Species: Canine Breed: Poodle Gender: Male Year of Birth: 2005 Client: GILLEN Requisition #: 424 832-6809 Accession #: L0064714 Account Code: 97706 Veterinarian: PATTERSON,BRAD Panel/Profile: SDMA Bile
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationDate By Code Description Qty (Variance) Photo
Shield Stone Pet Hospital 1610 East Shields Avenue Fresno, CA 93704 559-222-2800 Patient Chart Printed: 08-09-18 at 12:21p CLIENT INFORMATION Name JOSE SILVA (12823) Address 3940 N MAROA FRESNO, CA 93704
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationPET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE ACCOUNT #: ATTENDING VET: ANDERSON, DVM, JOY
Text KISMET EVENTOFF PET OWNER: EVENTOFF SPECIES: Feline BREED: GENDER: Female AGE: 2 Months PATIENT ID: PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE 323-294-4030 ACCOUNT #: 93530 ATTENDING VET:
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationthe wait is over... screen for endocrine disorders in as little as 6 minutes
the wait is over... screen for endocrine disorders in as little as 6 minutes IDEXX SNAP Reader Quantitative results for T 4 and cortisol Finally, you can screen T 4 and cortisol levels on all symptomatic
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationHEMATOLOGY. General information Whole blood in EDTA (purple top tube) is the required specimen for mammalian hematology.
VETERINARY DIAGNOSTIC SERVICES CLINICAL PATHOLOGY Updated: October 1, 2014 The Clinical Pathology Section of Veterinary Diagnostic Services provides testing in the fields of hematology, urinalysis, cytology,
More informationSMALL GROUP DISCUSSION SESSION I
MHD I Session I Student Copy Page 1 SMALL GROUP DISCUSSION SESSION I MHD I Monday, September 9, 2013 STUDENT COPY MHD I Session I Student Copy Page 2 Helpful Resources for Session Murray s Medical Microbiology,
More information2010 Miniboard Exam- Clinical Pathology
2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)
More informationSMALL GROUP DISCUSSION SESSION
MHD I Session 1 Student Copy Page 1 SMALL GROUP DISCUSSION SESSION 1 MHD I Friday, September 4, 2015 STUDENT COPY MHD I Session 1 Student Copy Page 2 Helpful Resources for Session Murray s Medical Microbiology,
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationMiniboard Exam 2009 Clinical Pathology
Miniboard Exam 2009 Clinical Pathology 1. Blood gas sample from a 10-year-old pony: ph 7.25 (Ref. Int. 7.32-7.44) HCO3 40 meq/l (Ref. Int. 24-30) PCO2 55 mmhg (Ref. Int. 36-46) PO2 88 mmhg (Ref. Int. 94)
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I November 12, 2015 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am very tired and
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XIII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION XIII MHD I November 13, 2014 STUDENT COPY MHD I, Session XIII, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am very tired
More informationACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More information5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationMHD I SESSION X. Renal Disease
MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationA. SAP is the D-Lab's name for a specific set of serum biochemical tests.
Understanding CBC, SAP, UA/Laura J. Steadman, DVM I. CBC - Complete Blood Count A. Three major types of cells are counted 1. Red Blood Cells 2. White Blood Cells 3. Platelets B. Cells are counted at the
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationMHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY
MHD I, Session VIII, Student Copy Page 1 MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 2 Case #1 Chief Complaint: I have been feeling just lousy
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationComplete Pet Care Animal Hospital at Heritage
Complete Pet Care Animal Hospital at Heritage 941 Gateway Commons Circle Wake Forest, NC 27587 919-263-9778 Patient Chart Printed: 05-01-18 at 4:09p CLIENT INFORMATION Name Amy Gant (588) Address 625 Walters
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationLABORATORY 5: The Complete Urinalysis
LABORATORY 5: The Complete Urinalysis Notes 1. This lab combines the objectives and activities of the macroscopic and microscopic lab activities. Students are expected to review those labs for reference.
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationMiniboard Exam 2011 Veterinary Pathology - Clinical Pathology
Miniboard Exam 2011 Veterinary Pathology - Clinical Pathology 1. The following information is given for an 8 year old felid: Na+ - 138 mmol/l Cl - 102 mmol/l Mg+- 2.4 mmol/l Phos- 11.2 mg/dl Ca²+- 10.1
More informationHypothyroidism part two diagnosis, treatment and nursing
Vet Times The website for the veterinary profession https://www.vettimes.co.uk Hypothyroidism part two diagnosis, treatment and nursing Author : Gemma Reid Categories : RVNs Date : July 1, 2008 Gemma Reid
More informationMineral Panel, Urine. Mineral/Lytes Panel, Urine. Metabolic Profile Test Panel Urea NEFA AST BHB. Non-Mammalian Chem Panel
CHEMISTRY PANELS Bilirubin Panel Bilirubin, Total Bilirubin, Direct Bilirubin, Indirect Canine Chemistry Panel See Small Animal Chemistry Panel Electrolyte Panel (NA) (K) (CL) Electrolyte Panel, Urine*
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More information* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil
LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationMandy presented to the Purdue University Veterinary Teaching Hospital for progressive
Signalment Mandy, 8-month old, female, Pug, 8.2 kg, Case log #9 Chief Complaint Mandy presented to the Purdue University Veterinary Teaching Hospital for progressive seizures, worsening in both frequency
More information8/16/2016. What is screening? What makes a good test? Can we screen for endocrine disorders? Screening test Diagnos c test.
Can we screen for endocrine disorders? What is screening? Principles: Testing performed on asymptomatic individuals Intention is to identify undetected diseases or conditions Objectives: Detection of disease
More informationMORE ACCURATE THAN EVER. Vcheck Product catalog_2.1
MORE ACCURATE THAN EVER Vcheck Product catalog_2.1 TABLE OF CONTENTS Vcheck Analyzers 06 07 V2400 V200 Vcheck Test Reagent - Quantitative Renal Biomarker 08 SDMA (Symmetric Dimethylarginine) Acute Phase
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationCase Log Number(s) Veterinarian or VTS Accurately report test results, using appropriate units of measurement Quality Control/Assurance Date Mastered
AVCPT Skills List Candidate: Understanding of test methodology, techniques and ability to perform testing must be applied to each skill. The overall goal is to provide accurate and valid results to assist
More informationControls & Calibrators Clinical Chemistry
Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD II, Session VIII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session VIII April 2, 2014 STUDENT COPY MHD II, Session VIII, Student Copy Page 2 CASE 1 Chief Complaint: I ve just been
More informationMHD II Session 3 STUDENT COPY
MHD II, Session 3, Student Copy - Page 1 MHD II Session 3 January 15, 2016 STUDENT COPY MHD II, Session 3, Student Copy - Page 2 CASE HISTORY 1 Cc: Terrible diarrhea for 1 ½ days A 66 year-old woman presents
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationThe Minimum Diagnostic Database: Chemistry
The Minimum Diagnostic Database: Chemistry Jeff Niziolek, DVM Professional Services Veterinarian IDEXX Laboratories, Inc. 208 Bay Meadows Drive Holland, MI 49424 Biochemical profiling is a wide and important
More informationDavid Bruyette, DVM DACVIM Medical Director
VCAWLAspecialty.com David Bruyette, DVM DACVIM Medical Director In 2012, the American College of Veterinary Internal Medicine (acvim.org) issued a consensus statement addressing the diagnosis of spontaneous
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I Session 2 STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION 2 Friday, September 11, 2015 STUDENT COPY MHD I Session 2 STUDENT Copy Page 2 Helpful Session Resources Murray s Medical
More informationREFERENCE RANGES. NSLIJ Reference Ranges Long Version Document / Version # 69. Effective Date: 2/29/2016
AUTOMATED LABORATORY / CHEMISTRY Albumin 3.3-5.0 g/dl Alk Phosphatase 1 to 9 yrs 40-350 U/L Alk Phosphatase 10 to 14 yrs 40-280 U/L Alk Phosphatase 15 to 19 yrs 40-150 9 U/L Alk Phosphatase 19 to 150 30-120
More informationAVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
More informationJOB AID CRITICAL VALUES AND TESTS W/O MICRO CRITICAL TESTS. Always call results for the following test(s):
Facilities: NoCo Laboratories JOB AID CRITICAL VALUES AND TESTS W/O MICRO CRITICAL TESTS Always call results for the following test(s): CONSTITUENT Ethylene Glycol (Performed at CU) Time Interval (from
More informationSlide # 23 peripheral blood smear from a dog
Slide # 23 peripheral blood smear from a dog Cinzia Mastrorilli 1, Elizabeth Welles 1, Lauren Reid 2 1 Department of Pathobiology, 2 Department of Clinical Science College of Veterinary Medicine, Auburn
More informationIDEXX Catalyst One Chemistry Analyzer for In-house Measurement of Total Thyroxine (TT 4 ) Concentration in Serum from Dogs and Cats
IDEXX Catalyst One Chemistry Analyzer for In-house Measurement of Total Thyroxine (TT 4 ) Concentration in Serum from Dogs and Cats Authors: Kate Cote, Ph.D., Graham Bilbrough, MA, VetMB, CertVA, MRCVS,
More informationWHAT IS YOUR DIAGNOSIS?
WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More information