Diversity and Assembling Processes of Bacterial Communities in Cryoconite
|
|
- Aubrey Ryan
- 6 years ago
- Views:
Transcription
1 Diversity and Assembling Processes of Bacterial Communities in Cryoconite Holes of a Karakoram Glacier Roberto Ambrosini 1, Federica Musitelli 1, Federico Navarra 1, Ilario Tagliaferri 1, Isabella Gandolfi 1, Giuseppina Bestetti 1, Christoph Mayer, Umberto Minora 3, Roberto Sergio Azzoni 3, Guglielmina Diolaiuti 3, Claudio Smiraglia 3, Andrea Franzetti 1 * 1 Dept. of Earth and Environmental Sciences (DISAT) - University of Milano-Bicocca, Milano, ITALY Bavarian Academy of Sciences and Humanities, Munich, GERMANY 3 A. Desio Dept. of Earth Sciences, Università degli Studi di Milano, Milano, ITALY *Corresponding author: Andrea Franzetti - Dept. of Earth and Environmental Sciences (DISAT) - University of Milano- Bicocca, Piazza della Scienza 1, 016 Milano ITALY Phone Fax: andrea.franzetti@unimib.it Keywords: cryoconite / cryosphere / Baltoro Glacier /
2 SUPPLEMENTARY MATERIAL Full details on PCR conditions Libraries for Illumina sequencing were built with a dual PCR protocol. The first PCR was performed in 75 µl volume reactions with GoTaq Green Master Mix (Promega Corporation, Madison, WI, USA) and 1 µm of each primer. The used primers were 783F and 1046R, which amplify a 8-bp fragment containing the hypervariable regions V5-V6 (783F: 5 -CAGGATTAGATACCC-3, Wang & Qian, 009; 1046R: 5 - CGACRRCCATGCANCACCT-3, Huber et al., 007). Both primers were added with Illumina adapters at 5 position. The cycling conditions were: initial denaturation at 98 C for 30 s; 0 cycles at 98 C for 10 s, 47 C for 30 s, and 7 C for 5 s and a final extension at 7 C for min. The second PCR was performed in 3 50 µl volume reactions by using 3 µl of the purified amplicons (Wizard SV Gel and PCR Clean-up System, Promega Corporation, Madison, WI, USA) from the first step as template and 0. µm of each primer. Primers contained regions complementary to the Illumina adapters and standard Nextera indexes (Illumina, Inc., San Diego, CA, USA). The cycling conditions were: initial denaturation at 98 C for 30 s; 15 cycles at 98 C for 10 s, 6 C for 30 s, and 7 C for 6 s and a final extension at 7 C for min. After the amplification DNA quality was evaluate spectrophotometrically and DNA was quantified using Qubit (Life Technologies, Carlsbad, CA, USA). The sequencing was carried out at Science for Life Sequencing facility (Stockholm, Sweden).
3 Table S1: Results from Indicator Species analysis aiming at identifying OTUs typical of different areas or group of areas. The classification of OTUs at class and order level (if available) is reported, as well as the value of the IndVal statistic and the significance of the test, corrected with the False Discovery Rate procedure.
4 1 Figure S1. Relative abundance of genera belonging to the order Burkholderiales. 100% Unclassified_Burkholderiaceae 90% Oxalicibacterium Limnobacter 80% Herminiimonas Burkholderia 70% Undibacterium Pelomonas 60% Unclassified_Alcaligenaceae Massilia 50% Ideonella Janthinobacterium 40% Unclassified_Oxalobacteraceae Curvibacter 30% Variovorax Aquabacterium 0% Unclassified_Burkholderiales 10% Unclassified_Burkholderiales_incertae_sedis Polaromonas 0% Area 1 Area Area 3 Area 4 Unclassified_Comamonadaceae Limnohabitans
5 Figure S. Boxplots of a) ph and d) Gini inequality index in different areas. Boxes enclose the first and the third quartiles of each measure, whiskers enclose 5th and 95th percentile, dots represent outliers. b): variation in the number of OTUs according to ph. c) variation in Shannon diversity index according to ph. 8
6 9 Figure S3. Relative abundance of OTUs belonging to Sphingobacteriales and Sphingomonadales at different ph value. Sphingobacteriales Sphingomonadales ph ph
7 1 Figure S4. Relative abundance of OTUs belonging to Sphingobacteriales and Sphingomonadales in different areas. 13 Sphingobacteriales Sphingomonadales Month Month 15 16
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationValidation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1
I. Objectives Validation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1 1. To ensure stability of RNA (highly thermolabile and degradatively
More informationSupplementary Information
Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang
More informationSupplement of Co-occurrence patterns in aquatic bacterial communities across changing permafrost landscapes
Supplement of Biogeosciences, 13, 175 190, 2016 http://www.biogeosciences.net/13/175/2016/ doi:10.5194/bg-13-175-2016-supplement Author(s) 2016. CC Attribution 3.0 License. Supplement of Co-occurrence
More informationKit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
More informationCytomegalovirus (CMV) End-Point PCR Kit Product# EP36300
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 Product
More informationAre microbes the missing piece of the gut comfort puzzle?
Priority Research Programme Foods for improving gut function and comfort Are microbes the missing piece of the gut comfort puzzle? Wayne Young Senior Scientist, AgResearch Host institution Foods for gut
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationNorgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
More informationInternal Validation Guide of Y-STR Systems for Forensic Laboratories Printed in USA. 11/12 Part# GE713
REFERENCE MANUAL Internal Validation Guide of Y-STR Systems for Forensic Laboratories 11/12 Internal Validation Guide of Y-STR Systems for Forensic Laboratories PLEASE DISCARD PREVIOUS VERSIONS. All technical
More informationRealLine Mycoplasma genitalium Str-Format
Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF MYCOPLASMA GENITALIUM DNA BY REAL-TIME PCR METHOD In vitro Diagnostics () VBD4396 96 Tests valid from December 2018 Rev06_1218_EN Page 1
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-cfDNA Serum & Plasma Kit Catalog No. D4076 Highlights High-quality DNA, including cell-free, is easily and robustly purified from up to 10 ml of serum/plasma, up to 1 ml amniotic
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationPG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
More informationMycoplasma Total Solution. Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free)
Mycoplasma Total Solution Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free) Mycoplasma Detection Mycoplasma Detection CellSafe s Mycoplasma Detection
More informationPrevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women
Prevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women K E Y WORDS HPV-16, cervical cancer, E6-T350G variant A BSTRACT High-risk HPV, particularly
More informationSupplementary Material
Supplementary Material 2 4 6 Single-locus gene screening methods We screened for single nucleotide polymorphisms (SNPs) at 16 candidate immune genes (Table S1) by initially sequencing three captive-bred
More informationFor the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationHIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis
Product Manual HIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis For research use only. Not for use in diagnostic procedures for clinical purposes Catalog
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationSupplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse
Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta
More informationAIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria
AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel
More informationaltona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS
altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationHuman Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment
Product Manual Human Immunodeficiency Virus-1 (HIV-1) Genemer Primer Pair for amplification of HIV-1 Specific DNA Fragment Catalog No.: 60-2002-10 Store at 20 o C For research use only. Not for use in
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4
INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationFuture applications of full length virus genome sequencing
Future applications of full length virus genome sequencing Paul Kellam Virus Genomics Revisiting early HIV resistance ideas AIDS 1991 Nature 1993 Virus genome sequencing Population or single genome Whole
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationSupplementary Information
Supplementary Information Methods Growth Characterisation Total Adenosine Triphosphate (ATP) was determined using a Molecular Probes ATP Determination Kit (Life Technologies, USA). 0.5 ml of sample was
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationUNIVERSITY OF MILAN'S AUDITORIA: ANALYSIS AND COMPARISON
UNIVERSITY OF MILAN'S AUDITORIA: ANALYSIS AND COMPARISON PACS REFERENCE: 43.55 Beltramini Filippo; Sindoni Elio; Zambon Giovanni Dipartimento di Scienze dell Ambiente e del Territorio Università degli
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..
INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationHuman malignant mesothelioma is recapitulated in immunocompetent BALB/c mice
SUPPLEMENTARY MATERIAL Human malignant mesothelioma is recapitulated in immunocompetent BALB/c mice injected with murine AB cells Rosanna Mezzapelle 1, Eltjona Rrapaj 1,, Elena Gatti 1, Chiara Ceriotti
More informationRealLine HIV qualitative Str-Format
Instructions for Use REAL TIME PCR DETECTION KIT FOR HUMAN IMMUNODEFICIENCY VIRUS RNA Research Use Only (RUO) RealLine HIV Qualitative (Str-format) VBD0196 96 Tests valid from July 2016 Rev01072016_EN
More information4.3 Measures of Variation
4.3 Measures of Variation! How much variation is there in the data?! Look for the spread of the distribution.! What do we mean by spread? 1 Example Data set:! Weight of contents of regular cola (grams).
More informationSupplementary Information for: Predictors of chronic kidney disease in type 1 diabetes: a longitudinal study from the AMD Annals initiative.
Supplementary Information for: Predictors of chronic kidney disease in type 1 diabetes: a longitudinal study from the AMD Annals initiative. Authors: Pamela Piscitelli 1, Francesca Viazzi 2 ; Paola Fioretto
More informationIsolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province
Available online at http://www.ijabbr.com International journal of Advanced Biological and Biomedical Research Volume 2, Issue 1, 2014: 100-104 Isolation and identification of Mycoplasma gallisepticum
More informationBinding Calculator Parameters
Binding Calculator Parameters Quick Reference Card The Binding Calculator assists in sample preparation by providing instructions for primer annealing, polymerase binding and sample loading based on the
More informationSupplementary Figures. Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies.
Supplementary Figures Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies. Supplementary Figure 2. SIV replication and CD4 + T cell count. (A) Log SIVmac239 copies/ml
More informationAn Integrated Quantum Dot Barcode Smartphone. Optical Device for Wireless Multiplexed Diagnosis
Supporting Information An Integrated Quantum Dot Barcode Smartphone Optical Device for Wireless Multiplexed Diagnosis of Infected Patients Kevin Ming 1,2,, Jisung Kim 1,2,, Mia J. Biondi 8, Abdullah Syed
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationAZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
More informationAssociation of Arg16Gly Polymorphism of the Beta-2 Adrenergic receptor with Baroreflex Sensitivity and Indices of Autonomic Cardiovascular Modulation
Association of Arg16Gly Polymorphism of the Beta-2 Adrenergic receptor with Baroreflex Sensitivity and Indices of Autonomic Cardiovascular Modulation Ochoa JE 1,2, Correa M 1,5, Gallo J 3,5, McEwen J 1,3,
More informationLUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE. 1. European Institute of Oncology, Department of Experimental Oncology,
Supplementary information LUNG CANCER ONSET IN WILD TYPE MICE FOLLOWING BONE MARROW RECONSTITUTION WITH k-ras V12 CELLS. Elena Belloni 1*, Ines Martin Padura 2#*, Elvira Gerbino 1, Stefania Orecchioni
More informationRealLine HCV Qualitative Str-Format
Instructions for use REAL TIME PCR DETECTION KIT FOR THE HEPATITIS C VIRUS RNA (HCV) Research Use Only (RUO) (Str-format) VBD0795 96 Tests valid from: October 2018 Rev05_1018_EN Page 1 of 8 Explanation
More informationSupplementary Materials
Supplementary Materials Supplementary figure 1. Taxonomic representation summarized at genus level. Fecal microbiota from a separate set of Jackson and Harlan mice prior to irradiation. A taxon was included
More informationRNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
More informationWHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
More informationA Statistical Framework for Classification of Tumor Type from microrna Data
DEGREE PROJECT IN MATHEMATICS, SECOND CYCLE, 30 CREDITS STOCKHOLM, SWEDEN 2016 A Statistical Framework for Classification of Tumor Type from microrna Data JOSEFINE RÖHSS KTH ROYAL INSTITUTE OF TECHNOLOGY
More informationRelationship between SPOP mutation and breast cancer in Chinese population
Relationship between SPOP mutation and breast cancer in Chinese population M.A. Khan 1 *, L. Zhu 1 *, M. Tania 1, X.L. Xiao 2 and J.J. Fu 1 1 Key Laboratory of Epigenetics and Oncology, The Research Center
More informationFigure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T
Figure S1. Schematic presentation of genomic replication of idsiv after transfection and infection. After transfection of idsiv plasmid DNA into 293T cells, the RNA genomes with all modifications are generated
More informationXCF TM COMPLETE Exosome and cfdna Isolation Kit (for Serum & Plasma)
XCF TM COMPLETE Exosome and cfdna Isolation Kit (for Serum & Plasma) Cat# XCF100A-1 User Manual Store kit components at +4ºC and +25ºC Version 1 2/2/2017 A limited-use label license covers this product.
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationREAL-TIME PCR ANALYSIS OF DOG CEREBROSPINAL FLUID AND SALIVA SAMPLES FOR ANTE-MORTEM DIAGNOSIS OF RABIES
REAL-TIME PCR ANALYSIS OF DOG CEREBROSPINAL FLUID AND SALIVA SAMPLES FOR ANTE-MORTEM DIAGNOSIS OF RABIES Wachiraporn Saengseesom, Channarong Mitmoonpitak, Songsri Kasempimolporn and Visith Sitprija Queen
More informationin the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares
Influence of Probiotics on Microflora in the Gastrointestinal and Reproductive Tracts of Quarter Horse Mares Katie Barnhart Research Advisors: Dr. Kimberly Cole and Dr. John Mark Reddish Department of
More informationRady Children s Hospital- San Diego Child Life Practicum Application Checklist (Please enclose with application)
Applicant Name: Rady Children s Hospital- San Diego Child Life Practicum Application Checklist (Please enclose with application) Completed Child Life Practicum Application Typed Practicum Application Typed
More informationSupplementary Online Content
Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationSupplementary Figure 1
Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationBaoyu Tian 1, *, Yi Cao 2,3, Keqin Zhang 2, *
Metagenomic insights into communities, functions of endophytes, and their associates with infection by root-knot nematode, Meloidogyne incognita, in tomato roots Baoyu Tian 1, *, Yi Cao 2,3, Keqin Zhang
More informationMENU PRODUCT MOLECULAR. International Product Listing. Simplexa Molecular Kits Integrated Cycler Molecular Reagents and Primer Pairs
International Product Listing MOLECULAR PRODUCT MENU Simplexa Molecular Kits Integrated Cycler Molecular Reagents and Primer Pairs Products are not intended for donor screening. Simplexa Molecular Kits
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationA copy can be downloaded for personal non-commercial research or study, without prior permission or charge
Van der Walt, D., Cloete, S.W.P., Storbeck, K., and Swart, P. (2009) The role of Cytochrome P450 17-alpha-Hydroxylase/ 17,20-Lyase (CYP17) in the stress coping ability in a divergently selected Merino
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationigem2013 Microbiology BMB SDU
igem2013 Microbiology BMB SDU Project type: Creation of Biobrick with Prenyltransferase Project title: Biobrick_Prenyltransferase Sub project: Creation date: 13.08.09 Written by: SIS Performed by: PRA,
More informationEnd of the Note Book
End of the Note Book 16 September 2016 Colonies PCR Mix (25 µl total volume reaction): + clones - 12.5 µl DreamTaq PCR Mastermix 2X (ThermoScientific) - 2.5 µl 10X DreamTaq Green Buffer (ThermoScientific)
More informationTargeted Therapies and Gut Microbiome in Renal Cell Carcinoma (RCC)
Targeted Therapies and Gut Microbiome in Renal Cell Carcinoma (RCC) Nazli Dizman, MD Postdoctoral Fellow Department of Medical oncology & Experimental Therapeutics City of Hope Comprehensive Center December
More informationProject Information. Manufacturer Information. Stakeholder Information. Evaluation Team. Evaluation Summary
Evaluation of Applied Biosystems AmpFℓSTR Identifiler Plus Amplification Kit 7881 114th Avenue North Largo, FL 33773 ph (727) 549-6067 www.nfstc.org Project Information Title: Evaluation of Applied Biosystems
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationTwo. The Power of. Special offers on Thermo Scientific products:
The Power of Two Special offers on Thermo Scientific products: Phusion High-Fidelity DNA Polymerases Phire Hot Start II DNA Polymerase Direct PCR Kits dntp Solutions PCR Cloning Kits FastRuler DNA Ladders
More informationWolf Laboratories Limited
Wolf Laboratories Limited www.wolflabs.co.uk Tel: 01759 301142 Fax:01759 301143 sales@wolflabs.co.uk Use the above details to contact us if this literature doesn't answer all your questions. Pricing on
More informationCell counting (EtBr) Before cell-lysis. Cell-lysis by 3% SDS beads beating. After cell-lysis
Key words Sample Cell counting (EtBr) DNA extraction Cell-lysis by 3% SDS beads beating Before cell-lysis After cell-lysis Cell-lysis efficiency (Maintained70%) PCR PCR amplification of partial fragments
More informationHIV-1 Viral Load Real Time (RG)
-1 Viral Load Real Time (RG) Real Time RT-PCR type 1 RNA quantification assay MSP Reg. pending Valdense 3616. 11700. Montevideo. Uruguay. phone (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Greco E, Minasi MG, Fiorentino F. Healthy babies after intrauterine
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationTransient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding
SUPPLEMENTARY INFORMATION: Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding Gong Zhang 1,2, Magdalena Hubalewska 1 & Zoya Ignatova 1,2 1 Department of Cellular
More informationSelective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationCMV DNA Quantification Using an Automated Platform for Nucleic Acid Extraction and Real- time PCR Assay Set-up
JCM Accepts, published online ahead of print on 11 May 2011 J. Clin. Microbiol. doi:10.1128/jcm.00721-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationPinpoint Slide RNA Isolation System II Catalog No. R1007
INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et
More informationCladosporium_spp genesig Standard Kit
TM Primerdesign Ltd Cladosporium_spp genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More information