Future applications of full length virus genome sequencing
|
|
- Ann Owen
- 5 years ago
- Views:
Transcription
1 Future applications of full length virus genome sequencing Paul Kellam Virus Genomics
2 Revisiting early HIV resistance ideas AIDS 1991 Nature 1993
3 Virus genome sequencing Population or single genome
4 Whole genome sequencing Primer-walking with M13 adaptors, capillary sequencing
5
6 Population biology The consensus sequence The treatment The minority species
7 2nd generation: 454 sequencing Throughput: 500 Mb/run (GSFLX) 1 M reads/run Read length: ~500 bp
8 HIV 2 nd generation sequencing Drug resistance mutations Drug Resistance population structure ~400b.p (inc V3) Fragmented (nebulised 454 library)
9 Direct indexing for 454 b)
10
11 Compound errors in 2 nd generation sequencing Process cdna synthesis error rate Library representation PCR error rate for clusters Sequencing error rates Technical Sampling efficiency Robustness of process Cost effectiveness Mutliplexing/logistics
12 Coverage and errors in 454 sequences Wang et al, Genome Res :
13 2 nd generation ATCATCTTCCTCACGACGTTTGCCAATTTAGCCTTCTTCTCNTCCCCTCCGACT + ATAATGGATAAAACCATCATATTGAAAGCAAACTTCAGTGTGATTTTTGACCGG + CCCBC?BCCCCACCCCCCCCCCCCCCC ATATTCTGGAGCAATGAAATTTCCATTACTCTCGAAGTTGATTGCATCATTCGG + BCBCCBCBCBCCCCCACCCCCCCBCC@ ATTTGGCGTCAAGCGAACAATGGAGAGGACGCAACTGCTGGTCTTACCCACCTG + =BBBBBBB@B>?B6BB=B>BBBBB?>A CCTGATGTGTATTTCTTGGTTATGGCCATCTGGTCCACAGTGGTTTTTGTTAGT + ADA>2????:>BBAB>BBBA?.?<?BB BB1?????BAB9A89;0:??>B;;8B6 Etc to ~ 1-3 million? means 99.9% accurate
14 Phred QPHRED = -10 x Log10 (Pe)
15 Phred scores Phred Qual score Prob that base is called wrongly Accuracy of base call ASCI code 10 1 in 10 90% in % in %? 40 1 in % I 50 1 in % S
16 assemblypipeline_splitqa.sh Script splitfastq_by_mid 454FastaFromSFF FASTQ SFF JPEG Fastq_QA SAM/BAM assemblypipeline_qcqa.sh Fastq_QC Fastq_QA SSAHA2 assemblypipeline_ssahamap.sh SAMTools pileupconsensu s
17 1/48 th of a 454 plate (1/12 th of a ¼ plate)
18
19 0 560
20 Phred 25
21 Sequencing whole virus genomes Bluetongue Virus Influenza Virus Varicella Zoster Virus
22 2nd generation: Illumina (Solexa)) sequencing Fragment DNA and add adapters Bind fragments to flow cell Bridge amplification Denature to return to single stranded DNA Images from
23 2nd generation: Illumina (Solexa)) sequencing mages from Produces millions of DNA clusters Add all 4 labelled terminators Lazer excitation causes flourescence which is photographed Repeat these sequencing cycles
24 Illumina Influenza H5N1Pre- & Post Quality Filtering
25 454-Illumina Coverage Comparison PB2 PB1 PA HA NP NA M1/M2 NS1/NS2
26 Dataset Platform Total Reads Mean Read Length Ref Coverage % Min Coverage Max Coverage , , H5N1 Illumina 1,669, ,013 61,435
27 Comparison of platforms consensus sequences Reference Position Called Base 454 Illumina 5615 A R (A or G) 5621 C Y (C or T) 5624 T W (A or T) 6900 G S (C or G) 8472 A W (A or T) 8477 G R (A or G) 8715 A G (difference) 8937 T K (G or T) 9623 G K (G or T) T K (G or T) T K (G or T) A W (A or T) 12 differences / 13,500 bp genome = 0.089%
28 Consensus and population structure Frequency Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Patient 7 Patient 8
29 The problem of linkage
30 Diversity and phenotypic potential Kellam & Larder, J.Virol 1995, 69(2); 669
31 Quasispecies haplotype reconstruction Eriksson et al, Plos Comp Biol May 2008, 4(5); e
32 Conclusions Move towards many more consensus whole genomes and abstraction of population structure Drive down/control/filter for sequencing errors. 3 rd generation (end 2010) will produce longer reads Learn more from ecologists Considerations of genome to infectivity ratio s
33 Virus Genomics Team Astrid Gall Anne Palser Rachael Chiam Greg Baillie HIV; Myra McClure, Deenan Pillay Influenza; James Wood, Maria Zambon BTV; Massimo Palmarini & Peter Mertens VZV; Judy Breuer Presented at the 8th European HIV Drug Resistance Workshop, March , Sorrento, Italy Simon Watson
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs
ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand
More informationHow to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015 Cost per raw Megabase
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationAnalysis of the genetic diversity of influenza A viruses using next-generation DNA sequencing
See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/273470093 Analysis of the genetic diversity of influenza A viruses using next-generation DNA
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationDe Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
More informationThe characterization of the human virome in children and adults
The characterization of the human virome in children and adults Kristine M. Wylie Kathie Mihindukulasuriya Erica Sodergren George M. Weinstock Gregory Storch Background Viruses make up an important part
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11396 A total of 2078 samples from a large sequencing project at decode were used in this study, 219 samples from 78 trios with two grandchildren who were not also members of other trios,
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationCOMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI)
COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI) Kevin D McCormick; Kerri J Penrose; Rahil Sethi; Jacob Waldman; William Schwarzmann; Uma Chandran;
More informationFor the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationMonitoring for Drug Resistance by Genotyping. Urvi M Parikh, PhD MTN Virology Core Lab
Monitoring for Drug Resistance by Genotyping Urvi M Parikh, PhD MTN Virology Core Lab Outline What is Drug Resistance? Genotyping Algorithm Standard vs Sensitive Resistance Testing Sequencing Protocols
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationPhylogenomics. Antonis Rokas Department of Biological Sciences Vanderbilt University.
Phylogenomics Antonis Rokas Department of Biological Sciences Vanderbilt University http://as.vanderbilt.edu/rokaslab High-Throughput DNA Sequencing Technologies 454 / Roche 450 bp 1.5 Gbp / day Illumina
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationSynthetic Genomics and Its Application to Viral Infectious Diseases. Timothy Stockwell (JCVI) David Wentworth (JCVI)
Synthetic Genomics and Its Application to Viral Infectious Diseases Timothy Stockwell (JCVI) David Wentworth (JCVI) Outline Using informatics to predict drift (strain selection) Synthetic Genomics: Preparedness
More informationGene transcript profiles to diagnose infectious diseases. ESCMID Conference on Diagnosing Infectious Diseases: Future and Innovation
Gene transcript profiles to diagnose infectious diseases ESCMID Conference on Diagnosing Infectious Diseases: Future and Innovation 24-26 October 2011, Venice, Italy Matthew Berry Consultant Respiratory
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationStudy the Evolution of the Avian Influenza Virus
Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction
More informationThe Open Bioinformatics Journal, 2014, 8, 1-5 1
Send Orders for Reprints to reprints@benthamscience.net The Open Bioinformatics Journal, 214, 8, 1-5 1 Open Access Performances of Bioinformatics Pipelines for the Identification of Pathogens in Clinical
More informationColorspace & Matching
Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties
More informationMeasuring DNA Methylation with the MinION
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other
More informationClinical utility of NGS for the detection of HIV and HCV resistance
18 th Annual Resistance and Antiviral Therapy Meeting v Professor Janke Schinkel Academic Medical Centre, Amsterdam, The Netherlands Thursday 18 September 2014, Royal College of Physicians, London Clinical
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationالحترمونا من خري الدعاء
الحترمونا من خري الدعاء Instructions for candidates The examination consists of 30 multiple choice questions, each divided into 5 different parts. Each part contains a statement which could be true or
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationOncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies
OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationLEIDEN, THE NETHERLANDS
Full-length CYP2D6 diplotyping for better drug dosage and response management Henk Buermans, PhD Leiden University Medical Center Human Genetics, LGTC LEIDEN, THE NETHERLANDS CYP2D6 Function Metabolism
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationReport concerning identification of the Northern European isolate of BTV (26 th August 2006)
Report concerning identification of the Northern European isolate of BTV (26 th August 2006) Peter Mertens, Carrie Batten, Simon Anthony, Lydia Kgosana, Karin Darpel, Kasia Bankowska, Eva Veronesi, Abid
More informationMin Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention. June 18, 2015 NIBSC
Workshop on Immunoassay Standardization for Universal Flu Vaccines Min Levine, Ph. D. Influenza Division US Centers for Disease Control and Prevention June 18, 2015 NIBSC 1 Multiple Immune Mechanisms Contribute
More informationReal-Time PCR Detects Viral Nucleic Acids in Universal Transport Medium (UTM-RT) with Flocked Swabs
Real-Time PCR Detects Viral Nucleic Acids in Universal Transport Medium (UTM-RT) with Flocked Swabs S. CASTRICIANO*, A. PETRICH, M. SMIEJA and M.A. CHERNESKY Departments of Pathology & Molecular Medicine,
More informationVirusDetect pipeline - virus detection with small RNA sequencing
VirusDetect pipeline - virus detection with small RNA sequencing CSC webinar 16.1.2018 Eija Korpelainen, Kimmo Mattila, Maria Lehtivaara Big thanks to Jan Kreuze and Jari Valkonen! Outline Small interfering
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationncounter Assay Automated Process Immobilize and align reporter for image collecting and barcode counting ncounter Prep Station
ncounter Assay ncounter Prep Station Automated Process Hybridize Reporter to RNA Remove excess reporters Bind reporter to surface Immobilize and align reporter Image surface Count codes Immobilize and
More informationa) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationHigh Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P
High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P Zach Smith and Scott D. Michaels The Center for Genomics and Bioinformatics Indiana University Bloomington, IN USA Mary Blair
More informationMolecular Diagnosis Future Directions
Molecular Diagnosis Future Directions Philip Cunningham NSW State Reference Laboratory for HIV/AIDS & Molecular Diagnostic Medicine Laboratory, SydPath St Vincent s Hospital Sydney Update on Molecular
More informationGEN ETICS AN D GEN OM ICS IN CANCER PREVENTION AN D TREATM EN T. Robert Nathan Slotnick MD PhD Director, Medical Genetics and Genomics
GEN ETICS AN D GEN OM ICS IN CANCER PREVENTION AN D TREATM EN T Robert Nathan Slotnick MD PhD Director, Medical Genetics and Genomics The Medical/Surgical/Radiation Oncologist s View of Genetics Cancer
More informationReducing INDEL calling errors in whole genome and exome sequencing data.
Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationTrends in molecular diagnostics
Trends in molecular diagnostics Detection of target genes of interest Quantification Infectious diseases HIV Hepatitis C & B TB / MAC Cytomegalovirus Herpes simplex Varicella zoster CT/GC HPV Profiling
More informationProposal of a validation method for automated nucleic acid extraction and RT-qPCR analysis : an example with Bluetongue virus
Proposal of a validation method for automated nucleic acid extraction and RT-qPCR analysis : an example with Bluetongue virus Elise Vandemeulebroucke Kris De Clercq Frank Vandenbussche Yves Van Der Stede
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationPREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis
PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis Marina Kleanthous Cyprus School of Molecular Medicine The Cyprus Institute of Neurology and Genetics
More informationSupplemental Methods RNA sequencing experiment
Supplemental Methods RNA sequencing experiment Mice were euthanized as described in the Methods and the right lung was removed, placed in a sterile eppendorf tube, and snap frozen in liquid nitrogen. RNA
More informationGenome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S.
Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. December 17, 2014 1 Introduction Asthma is a chronic respiratory disease affecting
More informationRapid genomic screening of embryos using nanopore sequencing
Rapid genomic screening of embryos using nanopore sequencing Daniel J Turner, PhD Senior Director of Applications Oxford Nanopore Technologies Forman EJ & Scott RT Jr Contemporary OB/GYN () 2014 Euploid
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationBacteriophage Reproduction
Bacteriophage Reproduction Lytic and Lysogenic Cycles The following information is taken from: http://student.ccbcmd.edu/courses/bio141/lecguide/unit3/index.html#charvir Bacteriophage Structure More complex
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More information1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir
New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal
More informationOVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationValidation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1
I. Objectives Validation Report: VERSA Mini PCR Workstation Reverse Transcription of Avian Flu RNA and Amplification of cdna & Detection of H5N1 1. To ensure stability of RNA (highly thermolabile and degradatively
More informationEvaluation of real time PCR reagents for detection of influenza A virus RNA CAHLN 2017 June 7th 2017, Kristin Mesires, Ph.D.
Evaluation of real time PCR reagents for detection of influenza A virus RNA CAHLN 2017 June 7th 2017, Kristin Mesires, Ph.D. 2017 IDEXX Laboratories, Inc. All rights reserved. Agenda Overview of the RealPCR
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationRelative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
More informationThis is DUE: Come prepared to share your findings with your group.
Biology 160 Reading Guide 10: Population Dynamics, HIV NAME: This is DUE: Come prepared to share your findings with your group. *As before, please turn in only the Critical Thinking questions on a separate
More informationVIP: an integrated pipeline for metagenomics of virus
VIP: an integrated pipeline for metagenomics of virus identification and discovery Yang Li 1, Hao Wang 2, Kai Nie 1, Chen Zhang 1, Yi Zhang 1, Ji Wang 1, Peihua Niu 1 and Xuejun Ma 1 * 1. Key Laboratory
More informationMathematical Modelling of Infectious Diseases. Raina MacIntyre
Mathematical Modelling of Infectious Diseases Raina MacIntyre A little bit of EBM is a dangerous thing Research question: Does smoking cause lung cancer? Answer: I couldn t find a meta-analysis or even
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationA novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationSupplementary Online Content
Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationTechnical Bulletin No. 161
CPAL Central Pennsylvania Alliance Laboratory Technical Bulletin No. 161 cobas 6800 HIV-1 Viral Load Assay - New Platform - June 1, 2017 Contact: Heather Habig, MLS (ASCP) CM, MB CM, 717-851-1422 Operations
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More information