ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
|
|
- Amos Harper
- 5 years ago
- Views:
Transcription
1 ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship of the LDL receptor and control of cholesterol metabolism. C. Were awarded the Nobel Prize in Science in II. Source of LDL A. VLDL are synthesized in the liver and secreted with apob 100 and apoe. B. Delipidation by LDL leads to the production of TAG-poor IDL (with apoe). C. Loss of apoe leads to formation of LDL. 1
2 Handout 12 III. Relationship of LDL cholesterol and HDL cholesterol to risk for cardiovascular disease A. Increasing LDL cholesterol can triple the relative risk for CVD. B. Decreasing HDL cholesterol can increase the relative risk for CVD over 4-fold. 3.0 Relative risk 2.0 for CVD LDL cholesterol HDL cholesterol
3 Handout 12 IV. The LDL receptor A. Located on many tissues (especially enriched in liver, adrenal glands, ovaries) in clathrincoated pits. B. Specifically designed to take up LDL particles. 1. The LDL receptor has very high affinity for apoe, so apoe-containing particles (especially IDL) are taken up rapidly (half life approx. 3 hours). 2. The LDL receptor has lower affinity for apob100, so LDL particles (which contain no apoe) remain in circulation much longer (half life approx. 2 days). 3. The LDL receptor does not recognize apob48, so it does not take up chylomicron remnants. LDLparticles Clathrincoated pit Receptor-mediated endocytosis LDL receptor 3
4 C. The LDL receptor is missing in individuals with the genetic defect, familial hypercholesterolemia (FH). 1. FH heterozygote a. Have half the number of LDL receptors. b. Have twice the normal plasma LDL cholesterol (300 mg/dl). Normal is considered 175 mg/dl. c. Begin to have heart attack by age 35. d. For those over 60 who have heart attacks, one in 20 is FH heterozygous. 2. FH homozygote a. Have virtually no functional LDLreceptors (receptors are not synthesized or contain a point mutation). e. FH homozygote also produces b. Have six times the normal LDL about twice as much LDL cholesterol cholesterol (680 mg/dl). per day (due to an increased amount of c. Heart attacks can occur by age 2 and conversion of IDL to LDL). are inevitable by age 20. d. LDL particles circulate about 2.5 times as long as in normal individuals. V. LDL uptake A. Receptor-mediated endocytosis 1. Circulating LDL is taken into a clathrin-coated pit containing LDL receptors. 2. The coated pit invaginates and pinches off to form a coated vesicle. B. Intracellular degradation of LDL 1. Fusion of several vesicles à endosome. 2. LDL dissociates from the receptor (which is recycled to the cell membrane). 3. LDL is delivered to a lysosome, where apob 100 is degraded and cholesterol ester is converted to free cholesterol and fatty acids. 4
5 VI. Regulation of the free cholesterol pool A. Cholesterol synthesis 1. Free cholesterol is oxygenated to 25-hydroxy-cholesterol hydroxy-cholesterol: a. Inhibits HMG-CoA reductase (decreases cholesterol synthesis). b. Inhibits LDL receptor gene transcription (decreases cholesterol uptake from the circulation). 3. Free cholesterol (and oleic acid?) activates acyl-coenzyme A:cholesterol acyltransferase (ACAT; this decreases the free cholesterol pool by converting cholesterol to cholesterol ester). 4. Mevalonate (the product of HMG-CoA reductase) inhibits HMG-CoA reductase. B. ACAT and the regulation of the free cholesterol pool. 1. ACAT = acyl-coenzyme A:cholesterol acyltransferase acyl-coa + cholesterol à CoASH + cholesterol ester 5
6 2. Diets high in saturated fatty acids decrease apparent ACAT activity in hepatocytes. 3. Diets high in saturated fatty acids decrease the amount of LDL degraded in hepatocytes. 4. Diets high in 12:0, 14:0, and 16:0 reduce LDL-receptor activity. Apparent ACAT activity (CE/FC) as a function of LDL degradation. CE = cholesterol ester; FC = free cholesterol. Relative LDLR activity as influenced by dietary fatty acids. The graph implies differential effects of fatty acids on ACAT activity. C. Decreasing cholesterol pool by exogenous means 1. Bile acid-binding resins, e.g., cholestyramine a. Bind bile acids and salts, causing excretion in the feces. b. Cause a net 10% reduction in LDL cholesterol in FH heterozygotes. 2. HMG-CoA reductase inhibitors (statins), e.g., compactin, mevinolin a. Inhibit cholesterol synthesis. b. Taken with resins cause 50% reduction in LDL cholesterol in FH heterozygotes. 6
Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More informationLipid Metabolism in Familial Hypercholesterolemia
Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More informationnumber Done by Corrected by Doctor
number 29 Done by Ali Yaghi Corrected by Shahd Alqudah Doctor Faisal Al-Khatibe In this lecture we will continue the steps of synthesizing cholesterol. in the previous sheet we reached the step of forming
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationTopic 11. Coronary Artery Disease
Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides
More informationMembrane Lipids & Cholesterol Metabolism
Membrane Lipids & Cholesterol Metabolism Learning Objectives 1. How Are Acylglycerols and Compound Lipids Produced? 2. The synthesis of Sphingolipids from Ceramide 3. Diseases due to Disruption of Lipid
More informationANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD
ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationTHE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM
J. Cell Set. Suppl. 3, 131-137 (1985) Printed in Great Britain The Company of Biologists Limited 1985 131 THE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM JO SEPH L. G O L D S T E
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationPodcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam
Podcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam Howard J. Sachs, MD www.12daysinmarch.com Email: Howard@12daysinmarch.com Podcast (Video Recorded
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationCholest s er e o r l o ١
Cholesterol ١ Contents of The Lecture What is Cholesterol? Structure of Cholesterol Structure of Cholesteryl Ester Normal Cholestrol Level Sources of Cholesterol What Are The Exogenous Sources Of Cholesterol?
More informationCHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
More informationThe new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice
... PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice Based on a presentation by Daniel J. Rader, MD Presentation Summary The guidelines recently released by the National Cholesterol
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationB. Patient has not reached the percentage reduction goal with statin therapy
Managing Cardiovascular Risk: The Importance of Lowering LDL Cholesterol and Reaching Treatment Goals for LDL Cholesterol The Role of the Pharmacist Learning Objectives 1. Review the role of lipid levels
More informationLipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels
Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital
More informationIntroduction Hyperlipidemia hyperlipoproteinemia Primary hyperlipidemia (Familial) Secondary hyperlipidemia (Acquired)
Introduction Hyperlipidemia, or hyperlipoproteinemia, is the condition of abnormally elevated levels of any or all lipids and/or lipoproteins in the blood. Hyperlipidemias are divided in primary and secondary
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationAnti Hyperlipidemic Drugs. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia
Anti Hyperlipidemic Drugs Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Lipoproteins Macromolecular complexes in the blood that transport lipids Apolipoproteins
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationSTRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty
STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationNovel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes
Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes Rajat Deo, MD, MTR Assistant Professor of Medicine Division of Cardiology University of Pennsylvania April 25,
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationFocus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013
Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Conflicts CMO for The FH Foundation Pre-talk quiz What is cascade screening? 1. screening all family members 2.
More informationAntihyperlipidemic drugs
Antihyperlipidemic drugs The clinically important lipoproteins are LDL low density lipoprotein, VLDL very low density lipoprotein, HDL high density lipoprotein. Hyperlipidemia may caused 1. by individual
More informationFrom Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert
Dr. Gilles Lambert Associate Professor in Cell Biology University of Nantes Medical School Group Leader, Laboratory of Nutrition and Metabolism, University Hospital of Nantes From Biology to Therapy The
More informationMCB130 Midterm. GSI s Name:
1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal
More informationDigestion and transport of TAG by plasma lipoproteins
Digestion and transport of TAG by plasma lipoproteins Lipoproteins are multimolecular complexes of lipids and proteins, they are not macromolecules They transport lipids in the plasma because lipids are
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationLipids, lipoproteins and cardiovascular disease
Lipids, lipoproteins and cardiovascular disease Presented by Dr. Mohammad Saadeh The requirements for the Clinical Chemistry Philadelphia University Faculty of pharmacy Cardiovascular disease Plasma enzymes
More informationInvestigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats
J. Biosci., Vol. 12, Number 2, June 1987, pp. 137 142. Printed in India. Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats P. VALSALA and P. A. KURUP Department
More informationHypercholesterolemia: So much cholesterol, so many causes
Hypercholesterolemia: So much cholesterol, so many causes Student group names kept anonymous Department of Biology, Lake Forest College, Lake Forest, IL 60045, USA Hypercholesterolemia is a disease characterized
More informationCholesterol metabolism Ι
Sheet # 22 Cholesterol metabolism Ι Today is the first lecture in the Cholesterol metabolism and you can refer to chapter 18 in Lippincott illustrated review Q: Why Cholesterol was written in 3 different
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationPCSK9 and its Inhibitors Past, Present, and Future Implications
PCSK9 and its Inhibitors Past, Present, and Future Implications Seth J. Baum, MD, FACC, FACPM, FAHA, FNLA, FASPC President-Elect, American Society for Preventive Cardiology Medical Director, Women s Preventive
More informationRole of the Liver in the Degradation of Lipoproteins
GASTROENTEROLOGY 1985;88:192-205 PROGRESS ARTICLE Role of the Liver in the Degradation of Lipoproteins ALLEN D. COOPER Department of Medicine. Stanford University School of Medicine, Stanford, California
More informationHuman LDL Receptor / LDLR ELISA Pair Set
Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationHyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi
Hyperlipidemia Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Outline The story of lipids Definition of hyperlipidemia Classification of hyperlipidemia Causes of hyperlipidemia
More informationacyl-coax holesterol acyltransferase in cholesterol metabolism
Role of cellular acyl-coax holesterol acyltransferase in cholesterol metabolism Keith E. Suckling* and Eduard F. Stange"' Department of Biochemistry, University of Edinburgh Medical School, * Hugh Robson
More informationHypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002
Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low
More informationGlossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
More informationMoh Tarek + Suhayb. Tamara Al-Azzeh + Asmaa Aljeelani ... Faisal
28 Moh Tarek + Suhayb Tamara Al-Azzeh + Asmaa Aljeelani... Faisal Digestion of dietary lipids Lipid digestion and absorption are complex processes. They involve soluble enzymes, substrates with different
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationChemistry Chapter 21
Chemistry 2100 Chapter 21 Lipids Fa3y Acids CH oleic acid (mp 4 C) CH stearic acid (mp 70 C) Triacylglycerols Fatty Acids! The fatty acid components of triglycerides have certain things in common: 1.
More informationChapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
More informationUNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY
UNIVERSITA DI PISA DIPARTIMENTO DI FARMACIA CHIMICA E TECNOLOGIE FARMACEUTICHE CORSO DI BASI BIOCHIMICHE DELL AZIONE DEI FARMACI FAMILIAL HYPERCHOLESTEROLEMIA GENETIC CAUSES AND THERAPY ERIKA ROSARIA PACCIOLLA
More informationBio 366: Biological Chemistry II Test #1, 100 points (7 pages)
Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the
More informationEcosanoids: Prostaglandins and related compounds
Ecosanoids: Prostaglandins and related compounds Presented by The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy Ecosanoids: Prostaglandins and related
More informationBulk Transport * OpenStax. 1 Endocytosis
OpenStax-CNX module: m44419 1 Bulk Transport * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able
More informationZuhier Awan, MD, PhD, FRCPC
Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier
More informationCLINICAL IMPORTANCE OF LIPOPROTEINS
25 Hyperlipidemias CLINICAL IMPORTANCE OF LIPOPROTEINS Raised levels of low-density lipoprotein (LDL) cholesterol and low levels of high density lipoprotein (HDL) cholesterol are independent risk factor
More informationModule 3 Lecture 7 Endocytosis and Exocytosis
Module 3 Lecture 7 Endocytosis and Exocytosis Endocytosis: Endocytosis is the process by which cells absorb larger molecules and particles from the surrounding by engulfing them. It is used by most of
More informationFamilial Hypercholesterolemia
Familial Hypercholesterolemia Dr.Ramzi Al-Mohammadi Assistant Professor of Medicine Interventional Cardiologist, Advanced HF and Transplant Consultant Classification of Hyperlipedemia Primary hyperlipedemia:
More informationDr G R Letchuman. Clogged by Cholesterol
Dr G R Letchuman Clogged by Cholesterol Main message Cholesterol management is all about reducing risk of CV events vs the side effects, hassle and cost of drugs News that it is no longer important to
More informationAn educational booklet for patients with familial hypercholesterolemia DR. LEIV OSE
An educational booklet for patients with familial hypercholesterolemia DR. LEIV OSE CONTENTS WHAT WILL YOU LEARN FROM THIS BOOKLET? You will learn about Familial Hypercholesterolemia, its cause, and the
More informationA Review: Atherosclerosis & its treatment
73 Review Article A Review: Atherosclerosis & its treatment Yogesh K. Patil* Department of Pharmacology, Shree Mahavir Institute of Pharmacy, Nashik, Maharashtra, India *yogesh_kpatil85@yahoo.co.in ABSTRACT
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationChapter 12. Part II. Biological Membrane
Chapter 12 Part II. Biological Membrane Single-tailed lipids tend to form micelles Critical micelle concentration (cmc): minimum concentration that forms micelles e.g.) cmc for SDS 1mM; cmc for phospholipids
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Lipid disorders: Disorders of lipid metabolism are manifest by elevation of the plasma concentrations of the various lipid and lipoprotein fractions (total and LDL cholesterol,
More informationA RECEPTOR-MEDIATED PATHWAY FOR CHOLESTEROL HOMEOSTASIS
A RECEPTOR-MEDIATED PATHWAY FOR CHOLESTEROL HOMEOSTASIS Nobel lecture, 9 December, 1985 by MICHAEL S. BROWN AND JOSEPH L. GOLDSTEIN Department of Molecular Genetics, University of Texas Health Science
More informationBIOL2171 ANU TCA CYCLE
TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More information10/1/2008. Therapy? Disclosure Statement
What s New in Lipid Therapy? Brooke Hudspeth, PharmD Diabetes Care Kroger Pharmacy Disclosure Statement In accordance with policies set forth by the Accreditation Council for Continuing Medical Education
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationThe Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia
The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano
More informationCHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna
Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationJoslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia
Consensus and Controversy in Diabetes and Dyslipidemia Om P. Ganda MD Director, Lipid Clinic Joslin diabetes Center Boston, MA, USA CVD Outcomes in DM vs non- DM 102 Prospective studies; 698, 782 people,
More informationComprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium
Comprehensive Treatment for Dyslipidemias Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Primary Prevention 41 y/o healthy male No Medications Normal BP, Glucose and BMI Social History:
More informationPCSK9 Inhibition: From Genetics to Patients
PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research
More informationCETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia
CETP inhibition: pros and cons Philip Barter The Heart Research Institute Sydney, Australia Philip Barter Disclosures Received honorariums for lectures, consultancies or membership of advisory boards from:
More informationChapter 13: Vesicular Traffic
Chapter 13: Vesicular Traffic Know the terminology: ER, Golgi, vesicle, clathrin, COP-I, COP-II, BiP, glycosylation, KDEL, microtubule, SNAREs, dynamin, mannose-6-phosphate, M6P receptor, endocytosis,
More information