ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool

Size: px
Start display at page:

Download "ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool"

Transcription

1 ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship of the LDL receptor and control of cholesterol metabolism. C. Were awarded the Nobel Prize in Science in II. Source of LDL A. VLDL are synthesized in the liver and secreted with apob 100 and apoe. B. Delipidation by LDL leads to the production of TAG-poor IDL (with apoe). C. Loss of apoe leads to formation of LDL. 1

2 Handout 12 III. Relationship of LDL cholesterol and HDL cholesterol to risk for cardiovascular disease A. Increasing LDL cholesterol can triple the relative risk for CVD. B. Decreasing HDL cholesterol can increase the relative risk for CVD over 4-fold. 3.0 Relative risk 2.0 for CVD LDL cholesterol HDL cholesterol

3 Handout 12 IV. The LDL receptor A. Located on many tissues (especially enriched in liver, adrenal glands, ovaries) in clathrincoated pits. B. Specifically designed to take up LDL particles. 1. The LDL receptor has very high affinity for apoe, so apoe-containing particles (especially IDL) are taken up rapidly (half life approx. 3 hours). 2. The LDL receptor has lower affinity for apob100, so LDL particles (which contain no apoe) remain in circulation much longer (half life approx. 2 days). 3. The LDL receptor does not recognize apob48, so it does not take up chylomicron remnants. LDLparticles Clathrincoated pit Receptor-mediated endocytosis LDL receptor 3

4 C. The LDL receptor is missing in individuals with the genetic defect, familial hypercholesterolemia (FH). 1. FH heterozygote a. Have half the number of LDL receptors. b. Have twice the normal plasma LDL cholesterol (300 mg/dl). Normal is considered 175 mg/dl. c. Begin to have heart attack by age 35. d. For those over 60 who have heart attacks, one in 20 is FH heterozygous. 2. FH homozygote a. Have virtually no functional LDLreceptors (receptors are not synthesized or contain a point mutation). e. FH homozygote also produces b. Have six times the normal LDL about twice as much LDL cholesterol cholesterol (680 mg/dl). per day (due to an increased amount of c. Heart attacks can occur by age 2 and conversion of IDL to LDL). are inevitable by age 20. d. LDL particles circulate about 2.5 times as long as in normal individuals. V. LDL uptake A. Receptor-mediated endocytosis 1. Circulating LDL is taken into a clathrin-coated pit containing LDL receptors. 2. The coated pit invaginates and pinches off to form a coated vesicle. B. Intracellular degradation of LDL 1. Fusion of several vesicles à endosome. 2. LDL dissociates from the receptor (which is recycled to the cell membrane). 3. LDL is delivered to a lysosome, where apob 100 is degraded and cholesterol ester is converted to free cholesterol and fatty acids. 4

5 VI. Regulation of the free cholesterol pool A. Cholesterol synthesis 1. Free cholesterol is oxygenated to 25-hydroxy-cholesterol hydroxy-cholesterol: a. Inhibits HMG-CoA reductase (decreases cholesterol synthesis). b. Inhibits LDL receptor gene transcription (decreases cholesterol uptake from the circulation). 3. Free cholesterol (and oleic acid?) activates acyl-coenzyme A:cholesterol acyltransferase (ACAT; this decreases the free cholesterol pool by converting cholesterol to cholesterol ester). 4. Mevalonate (the product of HMG-CoA reductase) inhibits HMG-CoA reductase. B. ACAT and the regulation of the free cholesterol pool. 1. ACAT = acyl-coenzyme A:cholesterol acyltransferase acyl-coa + cholesterol à CoASH + cholesterol ester 5

6 2. Diets high in saturated fatty acids decrease apparent ACAT activity in hepatocytes. 3. Diets high in saturated fatty acids decrease the amount of LDL degraded in hepatocytes. 4. Diets high in 12:0, 14:0, and 16:0 reduce LDL-receptor activity. Apparent ACAT activity (CE/FC) as a function of LDL degradation. CE = cholesterol ester; FC = free cholesterol. Relative LDLR activity as influenced by dietary fatty acids. The graph implies differential effects of fatty acids on ACAT activity. C. Decreasing cholesterol pool by exogenous means 1. Bile acid-binding resins, e.g., cholestyramine a. Bind bile acids and salts, causing excretion in the feces. b. Cause a net 10% reduction in LDL cholesterol in FH heterozygotes. 2. HMG-CoA reductase inhibitors (statins), e.g., compactin, mevinolin a. Inhibit cholesterol synthesis. b. Taken with resins cause 50% reduction in LDL cholesterol in FH heterozygotes. 6

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

More information

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)

More information

Lipid Metabolism in Familial Hypercholesterolemia

Lipid Metabolism in Familial Hypercholesterolemia Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

Lipid metabolism in familial hypercholesterolemia

Lipid metabolism in familial hypercholesterolemia Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

More information

Cholesterol and its transport. Alice Skoumalová

Cholesterol and its transport. Alice Skoumalová Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones

More information

Chapter VIII: Dr. Sameh Sarray Hlaoui

Chapter VIII: Dr. Sameh Sarray Hlaoui Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.

More information

Cholesterol Metabolism

Cholesterol Metabolism Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000

More information

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

More information

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

More information

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 29 Done by Ali Yaghi Corrected by Shahd Alqudah Doctor Faisal Al-Khatibe In this lecture we will continue the steps of synthesizing cholesterol. in the previous sheet we reached the step of forming

More information

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different

More information

Topic 11. Coronary Artery Disease

Topic 11. Coronary Artery Disease Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides

More information

Membrane Lipids & Cholesterol Metabolism

Membrane Lipids & Cholesterol Metabolism Membrane Lipids & Cholesterol Metabolism Learning Objectives 1. How Are Acylglycerols and Compound Lipids Produced? 2. The synthesis of Sphingolipids from Ceramide 3. Diseases due to Disruption of Lipid

More information

ANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD

ANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed

More information

Regulating Hepatic Cellular Cholesterol

Regulating Hepatic Cellular Cholesterol Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce

More information

THE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM

THE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM J. Cell Set. Suppl. 3, 131-137 (1985) Printed in Great Britain The Company of Biologists Limited 1985 131 THE LDL RECEPTOR AND THE REGULATION OF CELLULAR CHOLESTEROL METABOLISM JO SEPH L. G O L D S T E

More information

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo

More information

Podcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam

Podcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam Podcast (Video Recorded Lecture Series): Lipoprotein Metabolism and Lipid Therapy for the USMLE Step One Exam Howard J. Sachs, MD www.12daysinmarch.com Email: Howard@12daysinmarch.com Podcast (Video Recorded

More information

Lipids digestion and absorption, Biochemistry II

Lipids digestion and absorption, Biochemistry II Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very

More information

Cholest s er e o r l o ١

Cholest s er e o r l o ١ Cholesterol ١ Contents of The Lecture What is Cholesterol? Structure of Cholesterol Structure of Cholesteryl Ester Normal Cholestrol Level Sources of Cholesterol What Are The Exogenous Sources Of Cholesterol?

More information

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol

More information

The new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice

The new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice ... PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice Based on a presentation by Daniel J. Rader, MD Presentation Summary The guidelines recently released by the National Cholesterol

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

B. Patient has not reached the percentage reduction goal with statin therapy

B. Patient has not reached the percentage reduction goal with statin therapy Managing Cardiovascular Risk: The Importance of Lowering LDL Cholesterol and Reaching Treatment Goals for LDL Cholesterol The Role of the Pharmacist Learning Objectives 1. Review the role of lipid levels

More information

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels

Lipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital

More information

Introduction Hyperlipidemia hyperlipoproteinemia Primary hyperlipidemia (Familial) Secondary hyperlipidemia (Acquired)

Introduction Hyperlipidemia hyperlipoproteinemia Primary hyperlipidemia (Familial) Secondary hyperlipidemia (Acquired) Introduction Hyperlipidemia, or hyperlipoproteinemia, is the condition of abnormally elevated levels of any or all lipids and/or lipoproteins in the blood. Hyperlipidemias are divided in primary and secondary

More information

Lipoproteins Metabolism

Lipoproteins Metabolism Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical

More information

Antihyperlipidemic Drugs

Antihyperlipidemic Drugs Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types

More information

Anti Hyperlipidemic Drugs. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia

Anti Hyperlipidemic Drugs. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Anti Hyperlipidemic Drugs Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Lipoproteins Macromolecular complexes in the blood that transport lipids Apolipoproteins

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty

STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But

More information

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the

More information

Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes

Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes Novel Therapeutic Strategies in Lipid Management: Lowering LDL C to Improve Patient Outcomes Rajat Deo, MD, MTR Assistant Professor of Medicine Division of Cardiology University of Pennsylvania April 25,

More information

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013

Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Conflicts CMO for The FH Foundation Pre-talk quiz What is cascade screening? 1. screening all family members 2.

More information

Antihyperlipidemic drugs

Antihyperlipidemic drugs Antihyperlipidemic drugs The clinically important lipoproteins are LDL low density lipoprotein, VLDL very low density lipoprotein, HDL high density lipoprotein. Hyperlipidemia may caused 1. by individual

More information

From Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert

From Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert Dr. Gilles Lambert Associate Professor in Cell Biology University of Nantes Medical School Group Leader, Laboratory of Nutrition and Metabolism, University Hospital of Nantes From Biology to Therapy The

More information

MCB130 Midterm. GSI s Name:

MCB130 Midterm. GSI s Name: 1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal

More information

Digestion and transport of TAG by plasma lipoproteins

Digestion and transport of TAG by plasma lipoproteins Digestion and transport of TAG by plasma lipoproteins Lipoproteins are multimolecular complexes of lipids and proteins, they are not macromolecules They transport lipids in the plasma because lipids are

More information

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

More information

Lipids, lipoproteins and cardiovascular disease

Lipids, lipoproteins and cardiovascular disease Lipids, lipoproteins and cardiovascular disease Presented by Dr. Mohammad Saadeh The requirements for the Clinical Chemistry Philadelphia University Faculty of pharmacy Cardiovascular disease Plasma enzymes

More information

Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats

Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats J. Biosci., Vol. 12, Number 2, June 1987, pp. 137 142. Printed in India. Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats P. VALSALA and P. A. KURUP Department

More information

Hypercholesterolemia: So much cholesterol, so many causes

Hypercholesterolemia: So much cholesterol, so many causes Hypercholesterolemia: So much cholesterol, so many causes Student group names kept anonymous Department of Biology, Lake Forest College, Lake Forest, IL 60045, USA Hypercholesterolemia is a disease characterized

More information

Cholesterol metabolism Ι

Cholesterol metabolism Ι Sheet # 22 Cholesterol metabolism Ι Today is the first lecture in the Cholesterol metabolism and you can refer to chapter 18 in Lippincott illustrated review Q: Why Cholesterol was written in 3 different

More information

Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010 cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

PCSK9 and its Inhibitors Past, Present, and Future Implications

PCSK9 and its Inhibitors Past, Present, and Future Implications PCSK9 and its Inhibitors Past, Present, and Future Implications Seth J. Baum, MD, FACC, FACPM, FAHA, FNLA, FASPC President-Elect, American Society for Preventive Cardiology Medical Director, Women s Preventive

More information

Role of the Liver in the Degradation of Lipoproteins

Role of the Liver in the Degradation of Lipoproteins GASTROENTEROLOGY 1985;88:192-205 PROGRESS ARTICLE Role of the Liver in the Degradation of Lipoproteins ALLEN D. COOPER Department of Medicine. Stanford University School of Medicine, Stanford, California

More information

Human LDL Receptor / LDLR ELISA Pair Set

Human LDL Receptor / LDLR ELISA Pair Set Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in

More information

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids: CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation

More information

Hyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi

Hyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Hyperlipidemia Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Outline The story of lipids Definition of hyperlipidemia Classification of hyperlipidemia Causes of hyperlipidemia

More information

acyl-coax holesterol acyltransferase in cholesterol metabolism

acyl-coax holesterol acyltransferase in cholesterol metabolism Role of cellular acyl-coax holesterol acyltransferase in cholesterol metabolism Keith E. Suckling* and Eduard F. Stange"' Department of Biochemistry, University of Edinburgh Medical School, * Hugh Robson

More information

Hypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002

Hypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002 Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low

More information

Glossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"

More information

Moh Tarek + Suhayb. Tamara Al-Azzeh + Asmaa Aljeelani ... Faisal

Moh Tarek + Suhayb. Tamara Al-Azzeh + Asmaa Aljeelani ... Faisal 28 Moh Tarek + Suhayb Tamara Al-Azzeh + Asmaa Aljeelani... Faisal Digestion of dietary lipids Lipid digestion and absorption are complex processes. They involve soluble enzymes, substrates with different

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

Chemistry Chapter 21

Chemistry Chapter 21 Chemistry 2100 Chapter 21 Lipids Fa3y Acids CH oleic acid (mp 4 C) CH stearic acid (mp 70 C) Triacylglycerols Fatty Acids! The fatty acid components of triglycerides have certain things in common: 1.

More information

Chapter 16 - Lipid Metabolism

Chapter 16 - Lipid Metabolism Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them

More information

UNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY

UNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY UNIVERSITA DI PISA DIPARTIMENTO DI FARMACIA CHIMICA E TECNOLOGIE FARMACEUTICHE CORSO DI BASI BIOCHIMICHE DELL AZIONE DEI FARMACI FAMILIAL HYPERCHOLESTEROLEMIA GENETIC CAUSES AND THERAPY ERIKA ROSARIA PACCIOLLA

More information

Bio 366: Biological Chemistry II Test #1, 100 points (7 pages)

Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the

More information

Ecosanoids: Prostaglandins and related compounds

Ecosanoids: Prostaglandins and related compounds Ecosanoids: Prostaglandins and related compounds Presented by The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy Ecosanoids: Prostaglandins and related

More information

Bulk Transport * OpenStax. 1 Endocytosis

Bulk Transport * OpenStax. 1 Endocytosis OpenStax-CNX module: m44419 1 Bulk Transport * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able

More information

Zuhier Awan, MD, PhD, FRCPC

Zuhier Awan, MD, PhD, FRCPC Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier

More information

CLINICAL IMPORTANCE OF LIPOPROTEINS

CLINICAL IMPORTANCE OF LIPOPROTEINS 25 Hyperlipidemias CLINICAL IMPORTANCE OF LIPOPROTEINS Raised levels of low-density lipoprotein (LDL) cholesterol and low levels of high density lipoprotein (HDL) cholesterol are independent risk factor

More information

Module 3 Lecture 7 Endocytosis and Exocytosis

Module 3 Lecture 7 Endocytosis and Exocytosis Module 3 Lecture 7 Endocytosis and Exocytosis Endocytosis: Endocytosis is the process by which cells absorb larger molecules and particles from the surrounding by engulfing them. It is used by most of

More information

Familial Hypercholesterolemia

Familial Hypercholesterolemia Familial Hypercholesterolemia Dr.Ramzi Al-Mohammadi Assistant Professor of Medicine Interventional Cardiologist, Advanced HF and Transplant Consultant Classification of Hyperlipedemia Primary hyperlipedemia:

More information

Dr G R Letchuman. Clogged by Cholesterol

Dr G R Letchuman. Clogged by Cholesterol Dr G R Letchuman Clogged by Cholesterol Main message Cholesterol management is all about reducing risk of CV events vs the side effects, hassle and cost of drugs News that it is no longer important to

More information

An educational booklet for patients with familial hypercholesterolemia DR. LEIV OSE

An educational booklet for patients with familial hypercholesterolemia DR. LEIV OSE An educational booklet for patients with familial hypercholesterolemia DR. LEIV OSE CONTENTS WHAT WILL YOU LEARN FROM THIS BOOKLET? You will learn about Familial Hypercholesterolemia, its cause, and the

More information

A Review: Atherosclerosis & its treatment

A Review: Atherosclerosis & its treatment 73 Review Article A Review: Atherosclerosis & its treatment Yogesh K. Patil* Department of Pharmacology, Shree Mahavir Institute of Pharmacy, Nashik, Maharashtra, India *yogesh_kpatil85@yahoo.co.in ABSTRACT

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

Chapter 12. Part II. Biological Membrane

Chapter 12. Part II. Biological Membrane Chapter 12 Part II. Biological Membrane Single-tailed lipids tend to form micelles Critical micelle concentration (cmc): minimum concentration that forms micelles e.g.) cmc for SDS 1mM; cmc for phospholipids

More information

Antihyperlipidemic Drugs

Antihyperlipidemic Drugs Antihyperlipidemic Drugs Lipid disorders: Disorders of lipid metabolism are manifest by elevation of the plasma concentrations of the various lipid and lipoprotein fractions (total and LDL cholesterol,

More information

A RECEPTOR-MEDIATED PATHWAY FOR CHOLESTEROL HOMEOSTASIS

A RECEPTOR-MEDIATED PATHWAY FOR CHOLESTEROL HOMEOSTASIS A RECEPTOR-MEDIATED PATHWAY FOR CHOLESTEROL HOMEOSTASIS Nobel lecture, 9 December, 1985 by MICHAEL S. BROWN AND JOSEPH L. GOLDSTEIN Department of Molecular Genetics, University of Texas Health Science

More information

BIOL2171 ANU TCA CYCLE

BIOL2171 ANU TCA CYCLE TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa

More information

Lipid Metabolism. Catabolism Overview

Lipid Metabolism. Catabolism Overview Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water

More information

10/1/2008. Therapy? Disclosure Statement

10/1/2008. Therapy? Disclosure Statement What s New in Lipid Therapy? Brooke Hudspeth, PharmD Diabetes Care Kroger Pharmacy Disclosure Statement In accordance with policies set forth by the Accreditation Council for Continuing Medical Education

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

The Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia

The Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano

More information

CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna

CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information

Joslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia

Joslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia Consensus and Controversy in Diabetes and Dyslipidemia Om P. Ganda MD Director, Lipid Clinic Joslin diabetes Center Boston, MA, USA CVD Outcomes in DM vs non- DM 102 Prospective studies; 698, 782 people,

More information

Comprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium

Comprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Comprehensive Treatment for Dyslipidemias Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Primary Prevention 41 y/o healthy male No Medications Normal BP, Glucose and BMI Social History:

More information

PCSK9 Inhibition: From Genetics to Patients

PCSK9 Inhibition: From Genetics to Patients PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research

More information

CETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia

CETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia CETP inhibition: pros and cons Philip Barter The Heart Research Institute Sydney, Australia Philip Barter Disclosures Received honorariums for lectures, consultancies or membership of advisory boards from:

More information

Chapter 13: Vesicular Traffic

Chapter 13: Vesicular Traffic Chapter 13: Vesicular Traffic Know the terminology: ER, Golgi, vesicle, clathrin, COP-I, COP-II, BiP, glycosylation, KDEL, microtubule, SNAREs, dynamin, mannose-6-phosphate, M6P receptor, endocytosis,

More information