The Lipid Underground: Dissecting the Alkyl Hydroxycinnamate Pathway

Size: px
Start display at page:

Download "The Lipid Underground: Dissecting the Alkyl Hydroxycinnamate Pathway"

Transcription

1 The Lipid Underground: Dissecting the Hydroxycinnamate Pathway Dylan K Kosma, Adam Rice, Isabel Molina, Owen Rowland, Frédéric Domergue, John Ohlrogge, Mike Pollard Department of Plant Biology, Michigan State University, East Lansing, Michigan USA Department of Biology, Algoma University, Sault Ste. Marie, Ontario, Canada Department of Biology and Institute of Biochemistry, Carleton University, Ottawa, Ontario, Canada Laboratoire de Biogenèse Membranaire, Université Victor Ségalen Bordeaux 2, CNRS, Bordeaux cedex, France July 10,

2 What are Hydroxycinnamates? OCH3 O OH O Fatty Alcohol: VLCFA pathway Phenylpropanoid pathway Junction of two distinct biochemical pathways: Phenylpropanoid derived from Phenylalanine VLCFA ER-based elongation of Fatty Acyl-CoAs 2

3 What are Hydroxycinnamates? O O Docosyl p-coumarate Docosyl caffeate Docosyl ferulate O O O O OH OH OH OCH 3 OH 3

4 Where do we find Hydroxycinnamates? hydroxycinnamates are found in root and periderm waxes Thought to be associated with the surfaces of mature taproots (i.e. periderm) Extracted by rapid chloroform dipping of roots Represent a poorly understood aspect of root biology Role in protecting sink tissue? Höfer et al. (2008) Bush (2008) 4

5 Objectives To identify and characterize genes involved in alkyl hydroxycinnamate synthesis Explore the phylogenetic distribution of alkyl hydroxycinnamates in the plant kingdom 5

6 Identification of Candidate Genes Gene Name GPAT5 CYP86A1 ASFT CYP86B1 r 2 r 2 r 2 r 2 Σr 2 /n ASFT FACT DCF

7 outgroups CHAT A (V) B Phylogenetic Tree of Arabidopsis BAHD HXXXD Acyltransferases C (III) D HCT E (II) F (V) AT5MAT AACT1 CER2 G (I) DCF FACT ASFT J I H Molina et al (2009) FACT = Fatty Alcohol:Caffeoyl CoA Caffeoyl Transferase 7

8 fact Mutant Root Waxes are Deficient in Caffeates 8

9 Characterization of BAHD2 Activity Recombinant FACT Enzyme Assay Coupled Enzyme Assay HO O + CoASH OH OH ATP AMP + CoAS PPi O + OH OH OH FACT OH O O OH CoASH 9

10 Recombinant FACT Activity CL Specificity nmols product Caffeate Coumarate Ferulate % Acitivity Caffeate Coumarate Ferulate 10

11 SH

12 far1 Mutant Root Waxes are Deficient C22 Hydroxycinnamates 12

13 far4 Mutant Root Waxes are Deficient in C20 Hydroxycinnamates 13

14 far5 Mutant Root Waxes are Deficient C18 Hydroxycinnamates 14

15 C16:0-ACP Plastid 16:0 C16:0-CoA C18:0-ACP 18:0 ER Coumaroyl-CoA BAHD??? C18:0 Coumarate C20:0 Coumarate C22:0 Coumarate C18:0-CoA C20:0-CoA FAR5 FAR5 FAR1 FAR4 C18:0 1-Alcohol C20:0 1-Alcohol Caffeoyl-CoA Feruloyl-CoA FACT C18:0 Caffeate C20:0 Caffeate C22:0 Caffeate FAR4 FAR1 C22:0 1-Alcohol BAHD??? C18:0 Ferulate C20:0 Ferulate C22:0-CoA C22:0 Ferulate 15

16 Hydroxycinnmate Occurrence in Plant Kingdom Compound Class Organism Tissue Alcohol Chain Length Citation Caffeates Ferulates Coumarate Ferulates Caffeates Ferulates Coumarates Ferulates Coumarates Arabidopsis thaliana Solanum tuberosum Acacia sp. Root Surface (periderm) Periderm & Wound Periderm Periderm (bark) Musa textilis Leaf fibers C18 C22 C18 C31 Li et al (2007) Molina et al (2009) Bernard et al (1992) Schreiber et al (2004) Serra et al (2009) C16 C28 Freire et al (2007) C20 C28 Del Rio et al (2004) 16

17 Maize Beet Rice What s up doc? Carrot Root Wax Hydroxycinnamate Profiling Sweet Potato Tobacco Garden Pea Thellungiella Camelina Arabidopsis Radish Daikon Rapeseed 17 Rutabaga

18 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 18

19 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 19

20 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 20

21 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 21

22 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 22

23 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 23

24 Conclusions We have identified a new acyltransferase gene required for the synthesis of alkyl hydroxycinnamates. FACT encodes a caffeoyl transferase for alkyl caffeate synthesis FAR1,4,5 fatty acyl-coa reductases provide fatty alcohols for alkyl hydroxycinnamate synthesis We have demonstrated biosynthetic overlap between suberin and root waxes We found that root wax alkyl hydroxycinnamates are widely distributed throughout plant kingdom The ability to synthesize AHCs likely originated >150 mya in a common ancestor of monocots and dicots Argues for important biological / physiological function 24

25 Future Directions What are the physiological functions of alkyl hydroxycinnamates? Antimicrobials? Feeding deterrents? Synergistic with allelochemicals? fact and other alkyl hydroxycinnamate deficient mutants can now be used as tools to explore alkyl hydroxycinnamates function Understanding the biosynthesis and physiology of these compounds is necessary to exploit their industrial & medicinal value FAR / FACT interaction How to deliver a hydrophobic substrate to a soluble protein? Does the phylogentic distribution of FACT explain lack of alkyl caffeates in some species? 25

26 Acknowledgements Mike Pollard Adam Rice John Ohlrogge Isabel Molina Owen Rowland National Research Initiative of the USDA CSREES, grant number Fréd Domergue Merissa Strawsine Grant # MCB

27 Questions? 27

Biosynthesis and functions of free and combined fatty alcohols associated with suberin

Biosynthesis and functions of free and combined fatty alcohols associated with suberin Laboratoire Biosynthesis and functions of free and combined fatty alcohols associated with suberin Collaborating Laboratories: Dr. Owen Rowland Sollapura Vishwanath PhD Candidate Department of Biology

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

0.5. Normalized 95% gray value interval h

0.5. Normalized 95% gray value interval h Normalized 95% gray value interval.5.4.3.2.1 h Supplemental Figure 1: Symptom score of root samples used in the proteomics study. For each time point, the normalized 95% gray value interval is an averaged

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

Supplemental Data. Landgraf et al. (2014). Plant Cell /tpc

Supplemental Data. Landgraf et al. (2014). Plant Cell /tpc C ATGTCAAGGATAGTAGCGGAAAATATGTTACAAGGGGGAGAAAATGTACA ATTTTATGATCAAAGAGTACAACAAGCCATGGAGATGTCACAAGCCAGCG CGTACTCTTCACCCACCCTAGGCCAAATGCTAAAGCGCGTGGGAGACGTG AGAAAAGAAGTCACCGGCGACGAAACTCCGGTGCACCGGATTCTCGATAT

More information

MPS Advanced Plant Biochemistry Course. Fall Semester Lecture 11. Lipids III

MPS Advanced Plant Biochemistry Course. Fall Semester Lecture 11. Lipids III MPS 587 - Advanced Plant Biochemistry Course Fall Semester 2011 Lecture 11 Lipids III 9. Triacylglycerol synthesis 10. Engineering triacylglycerol fatty acid composition Today s topics on the Arabidopsis

More information

Lignin and the General Phenylpropanoid Pathway. Introduction and Importance:

Lignin and the General Phenylpropanoid Pathway. Introduction and Importance: Lignin and the General Phenylpropanoid Pathway 13. Phenolics and Lignin p. 1 Introduction and Importance: Phenolic: a compound consisting of an aromatic ring plus at least one hydroxyl [= phenyl group],

More information

Fatty Acid Desaturation

Fatty Acid Desaturation Fatty Acid Desaturation Objectives: 1. Isolation of desaturase mutants 2. Substrates for fatty acid desaturation 3. ellular localization of desaturases References: Buchanan et al. 2000. Biochemistry and

More information

Summary of fatty acid synthesis

Summary of fatty acid synthesis Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

Fatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116

Fatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116 Fatty acid synthesis Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai 116 Harper s biochemistry 24 th ed, Pg 218 Fatty acid Synthesis Known as

More information

Tailoring lignin biosynthesis for emerging bioenergy and bioproduct applications. Scott Sattler

Tailoring lignin biosynthesis for emerging bioenergy and bioproduct applications. Scott Sattler Tailoring lignin biosynthesis for emerging bioenergy and bioproduct applications Scott Sattler Wheat, Sorghum and Forage Research Unit USDA-ARS Lincoln, Nebraska USA Scott.Sattler@ars.usda.gov Sorghum:

More information

Lipids and Fatty Acids

Lipids and Fatty Acids Lipids and Fatty Acids Objectives: 1. What are Lipids? properties glycerolipids vs. isoprenoids glycerolipid structure glycerolipid nomenclature 2. Fatty acid biosynthesis ellular localization Substrate

More information

Supplemental data. Uppalapati et al. (2012) Plant Cell /tpc

Supplemental data. Uppalapati et al. (2012) Plant Cell /tpc PAL Control P. emaculata 0 8 24 48 8 24 48 OPR Control P. emaculata 0 8 24 48 8 24 48 CHS PR3 CHR PR5 CHI PR10 IFS IFR Supplemental Figure 1. Expression profiles for selected genes in phenylpropanoid pathway

More information

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010

cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010 cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is

More information

Re-Designing Alfalfa f for

Re-Designing Alfalfa f for Re-Designing Alfalfa f for Increased Yield and Quality Trait Targets Agronomic Traits (input traits) Herbicide tolerance Pest resistance Abiotic stress tolerance Increased yield per se Quality Traits (output

More information

Sealing Plant Surfaces: Cuticular Wax Formation by Epidermal Cells

Sealing Plant Surfaces: Cuticular Wax Formation by Epidermal Cells Annu. Rev. Plant Biol. 2008. 59:683 707 The Annual Review of Plant Biology is online at plant.annualreviews.org This article s doi: 10.1146/annurev.arplant.59.103006.093219 Copyright c 2008 by Annual Reviews.

More information

Chemistry 506: Allied Health Chemistry 2. Chapter 22: Biosynthetic Pathways. Making Complex Biomolecules

Chemistry 506: Allied Health Chemistry 2. Chapter 22: Biosynthetic Pathways. Making Complex Biomolecules Chemistry 506: Allied Health Chemistry 2 1 Chapter 22: Biosynthetic Pathways Making Complex Biomolecules Introduction to General, rganic & Biochemistry, 5 th Edition by Bettelheim and March: Chapter 22,

More information

Biosynthesis and secretion of plant cuticular wax

Biosynthesis and secretion of plant cuticular wax Progress in Lipid Research 42 (2003) 51 80 www.elsevier.com/locate/plipres Review Biosynthesis and secretion of plant cuticular wax L. Kunst, A.L. Samuels* Department of Botany, UBC, 6270 University Boulevard,

More information

Chemistry 1506: Allied Health Chemistry 2. Section 13: Biosynthetic Pathways. Making Complex Biomolecules. Outline

Chemistry 1506: Allied Health Chemistry 2. Section 13: Biosynthetic Pathways. Making Complex Biomolecules. Outline Chemistry 1506 Dr. Hunter s Class Section 13 Notes - Page 1/9 Chemistry 1506: Allied Health Chemistry 2 Section 13: Biosynthetic Pathways Making Complex Biomolecules utline SECTIN 13.1 INTRDUCTIN...2 SECTIN

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Producing Wax Esters in Transgenic Plants by Expression of Genes Derived from Jojoba

Producing Wax Esters in Transgenic Plants by Expression of Genes Derived from Jojoba Reprinted from: Perspectives on new crops and new uses. 1999. J. Janick (ed.), ASHS Press, Alexandria, VA. Producing Wax Esters in Transgenic Plants by Expression of Genes Derived from Jojoba Michael W.

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Lecture: 26 OXIDATION OF FATTY ACIDS

Lecture: 26 OXIDATION OF FATTY ACIDS Lecture: 26 OXIDATION OF FATTY ACIDS Fatty acids obtained by hydrolysis of fats undergo different oxidative pathways designated as alpha ( ), beta ( ) and omega ( ) pathways. -oxidation -Oxidation of fatty

More information

Glycolysis - Plasmodium

Glycolysis - Plasmodium Apicomplexan Biochemistry Basics Toxoplasma Good cell biology model Genome sequencing not completed Virtual pathways Cryptosporidium The strange one Genome sequence completed Virtual pathways Plasmodium

More information

Organic and biochemical synthesis of monolignol biosynthetic pathway intermediates

Organic and biochemical synthesis of monolignol biosynthetic pathway intermediates Jie Liu 2012-2-8 Organic and biochemical synthesis of monolignol biosynthetic pathway intermediates 1. Organic synthesis of 5-hydroxyferulic acid Malonic acid 3, 4-Dihydroxy-5-methoxy-benzaldehyde 0.1

More information

Address: School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai , China

Address: School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai , China Plant Physiology Preview. Published on May 31, 2016, as DOI:10.1104/pp.16.00095 1 2 Running head: DPW2 Is Required for Pollen Formation *Corresponding author: Prof. Wanqi Liang 3 4 5 6 7 8 Address: School

More information

MdMyb93 is a regulator of suberin deposition in russeted apple fruit skins

MdMyb93 is a regulator of suberin deposition in russeted apple fruit skins Research MdMyb93 is a regulator of suberin deposition in russeted apple fruit skins Sylvain Legay 1,2, Gea Guerriero 1, Christelle Andre 1,Cedric Guignard 1, Emmanuelle Cocco 1, Sophie Charton 1, Marc

More information

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:

More information

Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice

Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice Zheng et al. BMC Plant Biology (2016) 16:70 DOI 10.1186/s12870-016-0758-8 RESEARCH ARTICLE Open Access Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice

More information

Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels)

Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels) Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels) Aruna Kilaru East Tennessee State University Johnson City, TN,

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information

Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty Acids in Plant Growth

Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty Acids in Plant Growth The Plant Cell, Vol. 15, 1020 1033, April 2003, www.plantcell.org 2003 American Society of Plant Biologists Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty

More information

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

More information

Biosynthesis of Fatty Acids

Biosynthesis of Fatty Acids Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty

More information

Citrate Cycle. Lecture 28. Key Concepts. The Citrate Cycle captures energy using redox reactions

Citrate Cycle. Lecture 28. Key Concepts. The Citrate Cycle captures energy using redox reactions Citrate Cycle Lecture 28 Key Concepts The Citrate Cycle captures energy using redox reactions Eight reactions of the Citrate Cycle Key control points in the Citrate Cycle regulate metabolic flux What role

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels. Dehesh UC Davis

Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels. Dehesh UC Davis Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels Dehesh UC Davis Fossil fuel is believed to be derived from ancient lipid rich organic material such as spores and planktonic algae! Rudolf

More information

Division of Applied Life Sciences (Institute for Chemical R

Division of Applied Life Sciences (Institute for Chemical R Chair Division of Applied Life Sciences (Institute for Chemical R 2.3.12 Laboratory:Chemistry of Molecular Biocatalysts Member: Professor Hiratake, Jun, Dr. Agric. Sci. Assistant Professor Watanabe, bunta,

More information

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides

Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides

More information

An Introduction to Carbohydrates

An Introduction to Carbohydrates An Introduction to Carbohydrates Carbohydrates are a large class of naturally occurring polyhydroxy aldehydes and ketones. Monosaccharides also known as simple sugars, are the simplest carbohydrates containing

More information

Roadmap of Phenylpropanoids (Fig 18.1)

Roadmap of Phenylpropanoids (Fig 18.1) Roadmap of Phenylpropanoids (Fig 18.1) Phenolics and Phenylpropanoids (non- lignin) These are considered secondary plant metabolites (SPMs) = "small organic plant cons/tuents, not required for day- to-

More information

GLOSSY MUTANTS OF MAIZE

GLOSSY MUTANTS OF MAIZE Heredity (1979), 42 (3), 391-395 GLOSSY MUTATS OF MAIZE IX. CHEMISTRY OF GLOSSY 4, GLOSSY 8, GLOSSY 15 AD GLOSSY 18 SURFACE WAXES* G. BtACHI, P. AVATO and F. SALAMII Istituto di Ch,mica organica, Viale

More information

The Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants. Toshiro Ito 1 & Lee Lishi 2

The Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants. Toshiro Ito 1 & Lee Lishi 2 The Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants Toshiro Ito 1 & Lee Lishi 2 Department of Biological Sciences, Faculty of Science, National University of Singapore,

More information

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis

The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis The Plant Cell, Vol. 16, 629 642, March 2004, www.plantcell.org ª 2004 American Society of Plant Biologists The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis

More information

Biosynthesis and Seasonal Variation of Ethyl Oleate, a Primer Pheromone of the Honey Bee (Apis mellifera L.)

Biosynthesis and Seasonal Variation of Ethyl Oleate, a Primer Pheromone of the Honey Bee (Apis mellifera L.) Biosynthesis and Seasonal Variation of Ethyl leate, a Primer Pheromone of the Honey Bee (Apis mellifera L.) Carlos Castillo 1,3, Hao Chen 1, Carolyn Graves 1, Alban Maisonnasse 2, Yves Le Conte 2 and Erika

More information

Fatty acid breakdown

Fatty acid breakdown Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of

More information

acyltransferase activity

acyltransferase activity Proc. Natl. Acad. Sci. USA Vol. 85, pp. 4143-4147, June 1988 Biochemistry Altered regulation of lipid biosynthesis in a mutant of Arabidopsis deficient in chloroplast glycerol-3-phosphate acyltransferase

More information

These are example problems, which are similar to those you may see on the final exam.

These are example problems, which are similar to those you may see on the final exam. MCB102 / Metabolism Problem Set #3 Spring 2008 These are example problems, which are similar to those you may see on the final exam. QUESTION 1: /. Circle the correct answer, but if the answer is provide

More information

Synthesis and degradation of fatty acids Martina Srbová

Synthesis and degradation of fatty acids Martina Srbová Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids

More information

5.2 Lipids 5.21 Triglycerides 5.22 Phospholipids 5.23 Wax 5.24 Steroids. 5.3 Proteins 5.4 Nucleic Acids

5.2 Lipids 5.21 Triglycerides 5.22 Phospholipids 5.23 Wax 5.24 Steroids. 5.3 Proteins 5.4 Nucleic Acids BIOCHEMISTRY Class Notes Summary Table of Contents 1.0 Inorganic and Organic Compounds 2.0 Monomers and Polymers 3.0 Dehydration (Condensation) Synthesis 4.0 Hydrolysis Reaction 5.0 Organic Compounds 5.1

More information

Cell wall components:

Cell wall components: Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during

More information

Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.

Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function

More information

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc. BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In

More information

* This work was supported by the Department of Energy Great Lakes Bioenergy Research Center Office of Science Grant DE-FC02-07ER64494.

* This work was supported by the Department of Energy Great Lakes Bioenergy Research Center Office of Science Grant DE-FC02-07ER64494. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 11, pp. 8347 8355, March 9, 2012 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Identification of Grass-specific

More information

An Introduction to Carbohydrates

An Introduction to Carbohydrates An Introduction to Carbohydrates Carbohydrates are a large class of naturally occurring polyhydroxy aldehydes and ketones. Monosaccharides also known as simple sugars, are the simplest carbohydrates containing

More information

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM

Biosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives

More information

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

More information

CHY2026: General Biochemistry. Lipid Metabolism

CHY2026: General Biochemistry. Lipid Metabolism CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)

More information

6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced?

6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced? Lipid Metabolism Learning bjectives 1 How Are Lipids Involved in the Generationand Storage of Energy? 2 How Are Lipids Catabolized? 3 What Is the Energy Yield from the xidation of Fatty Acids? 4 How Are

More information

A REVIEW ON BIOCHEMICAL MECHANISM OF FATTY ACIDS SYNTHESIS AND OIL DEPOSITION IN BRASSICA AND ARABIDOPSIS

A REVIEW ON BIOCHEMICAL MECHANISM OF FATTY ACIDS SYNTHESIS AND OIL DEPOSITION IN BRASSICA AND ARABIDOPSIS American Journal of Agricultural and Biological Sciences 9 (4): 534-545, 2014 ISSN: 1557-4989 2014 M. Rahman, This open access article is distributed under a Creative Commons Attribution (CC-BY) 3.0 license

More information

Lipids and Classification:

Lipids and Classification: Lipids and Classification: Lipids: Biological lipids are a chemically diverse group of organic compounds which are insoluble or only poorly soluble in water. They are readily soluble in non-polar solvents

More information

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10 1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural

More information

BCMB 3100 Fall 2013 Exam III

BCMB 3100 Fall 2013 Exam III BCMB 3100 Fall 2013 Exam III 1. (10 pts.) (a.) Briefly describe the purpose of the glycerol dehydrogenase phosphate shuttle. (b.) How many ATPs can be made when electrons enter the electron transport chain

More information

Plant Cell Biology; Identification and manipulation of plant quality traits

Plant Cell Biology; Identification and manipulation of plant quality traits Plant Cell Biology; Identification and manipulation of plant quality traits Phil Morris, Mark Robbins, Joe Gallagher and Ana Winters Mechanisms of protein protection in forages 30 Determining the constraints

More information

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

More information

Oil biosynthesis in a basal angiosperm: transcriptome analysis of Persea Americana mesocarp

Oil biosynthesis in a basal angiosperm: transcriptome analysis of Persea Americana mesocarp Oil biosynthesis in a basal angiosperm: transcriptome analysis of Persea Americana mesocarp Kilaru et al. Kilaru et al. BMC Plant Biology (2015) 15:203 DOI 10.1186/s12870-015-0586-2 Kilaru et al. BMC Plant

More information

Quantification of Free Sterols, Sterol Esters, Sterol Glucosides and Acylated Sterol Glucosides in Plants by

Quantification of Free Sterols, Sterol Esters, Sterol Glucosides and Acylated Sterol Glucosides in Plants by Quantification of Free Sterols, Sterol Esters, Sterol Glucosides and Acylated Sterol Glucosides in Plants by Q-TOF Mass Spectrometry Vera Wewer and Peter Dörmann Seville, Spain, July 2012 Institute of

More information

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. AtMYB12 antibody detects both Arabidopsis and tomato MYB12 protein. (a) AtMYB12 antibody detects both SlMYB12 and AtMYB12 in tomato fruit. Both WT and AtMYB12

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

Cells extract energy from their environment and use the energy for a host of biological activities including biosynthesis.

Cells extract energy from their environment and use the energy for a host of biological activities including biosynthesis. ATP=cellular energy Cells extract energy from their environment and use the energy for a host of biological activities including biosynthesis. The reactions of energy extraction and energy use are called

More information

Introduction to Metabolism Cell Structure and Function

Introduction to Metabolism Cell Structure and Function Introduction to Metabolism Cell Structure and Function Cells can be divided into two primary types prokaryotes - Almost all prokaryotes are bacteria eukaryotes - Eukaryotes include all cells of multicellular

More information

Plant Biochemistry 31S2-33. ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto. P.M. Dey. J.B. Harborne. edited by.

Plant Biochemistry 31S2-33. ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto. P.M. Dey. J.B. Harborne. edited by. 31S2-33 Plant Biochemistry edited by P.M. Dey Division of Biochemistry, School of Biological Sciences, Royal Holloway, University of London, Egham Hill, Egham, Surrey TW20 OEX, UK. and J.B. Harborne Department

More information

Final Report for Tufts Institute of the Environment Graduate Fellowship

Final Report for Tufts Institute of the Environment Graduate Fellowship Final Report for Tufts Institute of the Environment Graduate Fellowship TITLE: Using Jasmonates to Enhance Long-Term Sequestration of Atmospheric Carbon. Benjamin A. Babst, Ph. D. Department of Biology,

More information

Vol. 63, No 3/ Thuy T. P. Doan 2 * , Anders S. Carlsson 1, Sten Stymne 1 and Per Hofvander 1

Vol. 63, No 3/ Thuy T. P. Doan 2 * , Anders S. Carlsson 1, Sten Stymne 1 and Per Hofvander 1 Regular paper Vol. 63, No 3/2016 565 570 http://dx.doi.org/10.18388/abp.2016_1245 Biochemical characteristics of AtFAR2, a fatty acid reductase from Arabidopsis thaliana that reduces fatty acyl-coa and

More information

Part III => METABOLISM and ENERGY. 3.4 Lipid Catabolism 3.4a Fatty Acid Degradation 3.4b Ketone Bodies

Part III => METABOLISM and ENERGY. 3.4 Lipid Catabolism 3.4a Fatty Acid Degradation 3.4b Ketone Bodies Part III => METABOLISM and ENERGY 3.4 Lipid Catabolism 3.4a Fatty Acid Degradation 3.4b Ketone Bodies Section 3.4a: Fatty Acid Degradation Synopsis 3.4a - Triglycerides (or fats) in the diet or adipose

More information

Acyltransferase Domain Analysis using HMMER. Seoul National Univ. Hyo jin Kang

Acyltransferase Domain Analysis using HMMER. Seoul National Univ. Hyo jin Kang Acyltransferase Domain Analysis using HMMER Seoul National Univ. Hyo jin Kang Introduction What is an Acyltransferase? A group of enzymes catalysing the transfer of acyl groups Where can we find it? Capsaicinoid

More information

Apicoplast. Treatments and New drug targets

Apicoplast. Treatments and New drug targets Treatments and New drug targets Apicoplast What is the apicoplast? Where does it come from? How are proteins targeted to the organelle? How does the organelle replicate? What is the function of the organelle?

More information

The Manga Guide to Biochemistry 2011 Masaharu Takemura, Kikuyaro, and Office Sawa.

The Manga Guide to Biochemistry 2011 Masaharu Takemura, Kikuyaro, and Office Sawa. Contents Preface.... xi Prologue... 1 1 What Happens Inside Your Body?... 13 1. Cell Structure... 14 What Are the Components of a Cell?... 16 2. What Happens Inside a Cell?... 18 Protein Synthesis... 19

More information

FATTY ACID SYNTHESIS

FATTY ACID SYNTHESIS FATTY ACID SYNTHESIS Malonyl- CoA inhibits Carni1ne Palmitoyl Transferase I. Malonyl- CoA is a precursor for fa=y acid synthesis. Malonyl- CoA is produced from acetyl- CoA by the enzyme Acetyl- CoA Carboxylase.

More information

Metabolic Flux Analysis of the Phenylpropanoid Pathway in Elicitor-treated Potato Tuber Tissue

Metabolic Flux Analysis of the Phenylpropanoid Pathway in Elicitor-treated Potato Tuber Tissue Plant Cell Physiol. 46(3): 454 466 (2005) doi:10.1093/pcp/pci042, available online at www.pcp.oupjournals.org JSPP 2005 Metabolic Flux Analysis of the Phenylpropanoid Pathway in Elicitor-treated Potato

More information

C 6 C 3 unit. Figure 2: Volatile oils simple C6 C3 metabolite

C 6 C 3 unit. Figure 2: Volatile oils simple C6 C3 metabolite Phenylpropenses Are the simplest of shikimic-acid-derived biosynthetic subunit. These secondary metabolites are consist of purely of an aromatic ring (C6), with an unsaturated 3-carbon chain (C3), attached

More information

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty

More information

Lipid Metabolism. Catabolism Overview

Lipid Metabolism. Catabolism Overview Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water

More information

Manuscript Information. Manuscript Files

Manuscript Information. Manuscript Files Manuscript Information Journal name: Phytochemistry NIHMS ID: NIHMS930878 Manuscript Title:Potato native and wound periderms are differently affected by down-regulation of FHT, a suberin feruloyl transferase

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author:

Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author: Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author: In the manuscript by Ohno et al, the authors set out to identify the enzyme responsible for the ester bond formation

More information

Syllabus for BASIC METABOLIC PRINCIPLES

Syllabus for BASIC METABOLIC PRINCIPLES Syllabus for BASIC METABOLIC PRINCIPLES The video lecture covers basic principles you will need to know for the lectures covering enzymes and metabolism in Principles of Metabolism and elsewhere in the

More information

Identification of intact long-chain p-hydroxycinnamate esters in leaf fibers of abaca (Musa textilis) using gas chromatography/mass spectrometry

Identification of intact long-chain p-hydroxycinnamate esters in leaf fibers of abaca (Musa textilis) using gas chromatography/mass spectrometry RAPID COMMUNICATIONS IN MASS SPECTROMETRY Rapid Commun. Mass Spectrom. 2004; 18: 2691 2696 Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/rcm.1677 Identification of intact

More information

CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005

CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005 CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005 Name Dr. H. White - Instructor There are 8 pages to this examination including this page. In addition, you will get a metabolic

More information

PWNI I'IHITIIBIH UI'IIVERSITY. (Including this front page) SUPPLEMENTARY/SECOND OPPORTUNITY QUESTION PAPER FACULTY OF HEALTH AND APPLIED SCIENCES

PWNI I'IHITIIBIH UI'IIVERSITY. (Including this front page) SUPPLEMENTARY/SECOND OPPORTUNITY QUESTION PAPER FACULTY OF HEALTH AND APPLIED SCIENCES I. I'IHITIIBIH UI'IIVERSITY 0F SCIEI ICE HUD TECHNOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF NATURAL AND APPLIED SCIENCES QUALIFICATION: BACHELOR OF SCIENCE QUALIFICATION CODE: O7BOSC LEVEL:

More information

Objectives. Carbon Bonding. Carbon Bonding, continued. Carbon Bonding

Objectives. Carbon Bonding. Carbon Bonding, continued. Carbon Bonding Biochemistry Table of Contents Objectives Distinguish between organic and inorganic compounds. Explain the importance of carbon bonding in biological molecules. Identify functional groups in biological

More information

number Done by Corrected by Doctor Faisal Al- Khateeb

number Done by Corrected by Doctor Faisal Al- Khateeb number 21 Done by Omar Sami Corrected by حسام أبو عوض Doctor Faisal Al- Khateeb 1 P a g e (Only one or two marks are allocated for this sheetin the exam). Through this lecture we are going to cover the

More information