The Lipid Underground: Dissecting the Alkyl Hydroxycinnamate Pathway
|
|
- Cleopatra Alexander
- 5 years ago
- Views:
Transcription
1 The Lipid Underground: Dissecting the Hydroxycinnamate Pathway Dylan K Kosma, Adam Rice, Isabel Molina, Owen Rowland, Frédéric Domergue, John Ohlrogge, Mike Pollard Department of Plant Biology, Michigan State University, East Lansing, Michigan USA Department of Biology, Algoma University, Sault Ste. Marie, Ontario, Canada Department of Biology and Institute of Biochemistry, Carleton University, Ottawa, Ontario, Canada Laboratoire de Biogenèse Membranaire, Université Victor Ségalen Bordeaux 2, CNRS, Bordeaux cedex, France July 10,
2 What are Hydroxycinnamates? OCH3 O OH O Fatty Alcohol: VLCFA pathway Phenylpropanoid pathway Junction of two distinct biochemical pathways: Phenylpropanoid derived from Phenylalanine VLCFA ER-based elongation of Fatty Acyl-CoAs 2
3 What are Hydroxycinnamates? O O Docosyl p-coumarate Docosyl caffeate Docosyl ferulate O O O O OH OH OH OCH 3 OH 3
4 Where do we find Hydroxycinnamates? hydroxycinnamates are found in root and periderm waxes Thought to be associated with the surfaces of mature taproots (i.e. periderm) Extracted by rapid chloroform dipping of roots Represent a poorly understood aspect of root biology Role in protecting sink tissue? Höfer et al. (2008) Bush (2008) 4
5 Objectives To identify and characterize genes involved in alkyl hydroxycinnamate synthesis Explore the phylogenetic distribution of alkyl hydroxycinnamates in the plant kingdom 5
6 Identification of Candidate Genes Gene Name GPAT5 CYP86A1 ASFT CYP86B1 r 2 r 2 r 2 r 2 Σr 2 /n ASFT FACT DCF
7 outgroups CHAT A (V) B Phylogenetic Tree of Arabidopsis BAHD HXXXD Acyltransferases C (III) D HCT E (II) F (V) AT5MAT AACT1 CER2 G (I) DCF FACT ASFT J I H Molina et al (2009) FACT = Fatty Alcohol:Caffeoyl CoA Caffeoyl Transferase 7
8 fact Mutant Root Waxes are Deficient in Caffeates 8
9 Characterization of BAHD2 Activity Recombinant FACT Enzyme Assay Coupled Enzyme Assay HO O + CoASH OH OH ATP AMP + CoAS PPi O + OH OH OH FACT OH O O OH CoASH 9
10 Recombinant FACT Activity CL Specificity nmols product Caffeate Coumarate Ferulate % Acitivity Caffeate Coumarate Ferulate 10
11 SH
12 far1 Mutant Root Waxes are Deficient C22 Hydroxycinnamates 12
13 far4 Mutant Root Waxes are Deficient in C20 Hydroxycinnamates 13
14 far5 Mutant Root Waxes are Deficient C18 Hydroxycinnamates 14
15 C16:0-ACP Plastid 16:0 C16:0-CoA C18:0-ACP 18:0 ER Coumaroyl-CoA BAHD??? C18:0 Coumarate C20:0 Coumarate C22:0 Coumarate C18:0-CoA C20:0-CoA FAR5 FAR5 FAR1 FAR4 C18:0 1-Alcohol C20:0 1-Alcohol Caffeoyl-CoA Feruloyl-CoA FACT C18:0 Caffeate C20:0 Caffeate C22:0 Caffeate FAR4 FAR1 C22:0 1-Alcohol BAHD??? C18:0 Ferulate C20:0 Ferulate C22:0-CoA C22:0 Ferulate 15
16 Hydroxycinnmate Occurrence in Plant Kingdom Compound Class Organism Tissue Alcohol Chain Length Citation Caffeates Ferulates Coumarate Ferulates Caffeates Ferulates Coumarates Ferulates Coumarates Arabidopsis thaliana Solanum tuberosum Acacia sp. Root Surface (periderm) Periderm & Wound Periderm Periderm (bark) Musa textilis Leaf fibers C18 C22 C18 C31 Li et al (2007) Molina et al (2009) Bernard et al (1992) Schreiber et al (2004) Serra et al (2009) C16 C28 Freire et al (2007) C20 C28 Del Rio et al (2004) 16
17 Maize Beet Rice What s up doc? Carrot Root Wax Hydroxycinnamate Profiling Sweet Potato Tobacco Garden Pea Thellungiella Camelina Arabidopsis Radish Daikon Rapeseed 17 Rutabaga
18 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 18
19 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 19
20 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 20
21 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 21
22 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 22
23 100% % of Total Hydroxycinnamates 80% 60% 40% 20% 0% Caffeate Ferulate Coumarate 23
24 Conclusions We have identified a new acyltransferase gene required for the synthesis of alkyl hydroxycinnamates. FACT encodes a caffeoyl transferase for alkyl caffeate synthesis FAR1,4,5 fatty acyl-coa reductases provide fatty alcohols for alkyl hydroxycinnamate synthesis We have demonstrated biosynthetic overlap between suberin and root waxes We found that root wax alkyl hydroxycinnamates are widely distributed throughout plant kingdom The ability to synthesize AHCs likely originated >150 mya in a common ancestor of monocots and dicots Argues for important biological / physiological function 24
25 Future Directions What are the physiological functions of alkyl hydroxycinnamates? Antimicrobials? Feeding deterrents? Synergistic with allelochemicals? fact and other alkyl hydroxycinnamate deficient mutants can now be used as tools to explore alkyl hydroxycinnamates function Understanding the biosynthesis and physiology of these compounds is necessary to exploit their industrial & medicinal value FAR / FACT interaction How to deliver a hydrophobic substrate to a soluble protein? Does the phylogentic distribution of FACT explain lack of alkyl caffeates in some species? 25
26 Acknowledgements Mike Pollard Adam Rice John Ohlrogge Isabel Molina Owen Rowland National Research Initiative of the USDA CSREES, grant number Fréd Domergue Merissa Strawsine Grant # MCB
27 Questions? 27
Biosynthesis and functions of free and combined fatty alcohols associated with suberin
Laboratoire Biosynthesis and functions of free and combined fatty alcohols associated with suberin Collaborating Laboratories: Dr. Owen Rowland Sollapura Vishwanath PhD Candidate Department of Biology
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More informationVery-Long Chain Fatty Acid Biosynthesis
Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions
More information0.5. Normalized 95% gray value interval h
Normalized 95% gray value interval.5.4.3.2.1 h Supplemental Figure 1: Symptom score of root samples used in the proteomics study. For each time point, the normalized 95% gray value interval is an averaged
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationSupplemental Data. Landgraf et al. (2014). Plant Cell /tpc
C ATGTCAAGGATAGTAGCGGAAAATATGTTACAAGGGGGAGAAAATGTACA ATTTTATGATCAAAGAGTACAACAAGCCATGGAGATGTCACAAGCCAGCG CGTACTCTTCACCCACCCTAGGCCAAATGCTAAAGCGCGTGGGAGACGTG AGAAAAGAAGTCACCGGCGACGAAACTCCGGTGCACCGGATTCTCGATAT
More informationMPS Advanced Plant Biochemistry Course. Fall Semester Lecture 11. Lipids III
MPS 587 - Advanced Plant Biochemistry Course Fall Semester 2011 Lecture 11 Lipids III 9. Triacylglycerol synthesis 10. Engineering triacylglycerol fatty acid composition Today s topics on the Arabidopsis
More informationLignin and the General Phenylpropanoid Pathway. Introduction and Importance:
Lignin and the General Phenylpropanoid Pathway 13. Phenolics and Lignin p. 1 Introduction and Importance: Phenolic: a compound consisting of an aromatic ring plus at least one hydroxyl [= phenyl group],
More informationFatty Acid Desaturation
Fatty Acid Desaturation Objectives: 1. Isolation of desaturase mutants 2. Substrates for fatty acid desaturation 3. ellular localization of desaturases References: Buchanan et al. 2000. Biochemistry and
More informationSummary of fatty acid synthesis
Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationFatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116
Fatty acid synthesis Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai 116 Harper s biochemistry 24 th ed, Pg 218 Fatty acid Synthesis Known as
More informationTailoring lignin biosynthesis for emerging bioenergy and bioproduct applications. Scott Sattler
Tailoring lignin biosynthesis for emerging bioenergy and bioproduct applications Scott Sattler Wheat, Sorghum and Forage Research Unit USDA-ARS Lincoln, Nebraska USA Scott.Sattler@ars.usda.gov Sorghum:
More informationLipids and Fatty Acids
Lipids and Fatty Acids Objectives: 1. What are Lipids? properties glycerolipids vs. isoprenoids glycerolipid structure glycerolipid nomenclature 2. Fatty acid biosynthesis ellular localization Substrate
More informationSupplemental data. Uppalapati et al. (2012) Plant Cell /tpc
PAL Control P. emaculata 0 8 24 48 8 24 48 OPR Control P. emaculata 0 8 24 48 8 24 48 CHS PR3 CHR PR5 CHI PR10 IFS IFR Supplemental Figure 1. Expression profiles for selected genes in phenylpropanoid pathway
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationRe-Designing Alfalfa f for
Re-Designing Alfalfa f for Increased Yield and Quality Trait Targets Agronomic Traits (input traits) Herbicide tolerance Pest resistance Abiotic stress tolerance Increased yield per se Quality Traits (output
More informationSealing Plant Surfaces: Cuticular Wax Formation by Epidermal Cells
Annu. Rev. Plant Biol. 2008. 59:683 707 The Annual Review of Plant Biology is online at plant.annualreviews.org This article s doi: 10.1146/annurev.arplant.59.103006.093219 Copyright c 2008 by Annual Reviews.
More informationChemistry 506: Allied Health Chemistry 2. Chapter 22: Biosynthetic Pathways. Making Complex Biomolecules
Chemistry 506: Allied Health Chemistry 2 1 Chapter 22: Biosynthetic Pathways Making Complex Biomolecules Introduction to General, rganic & Biochemistry, 5 th Edition by Bettelheim and March: Chapter 22,
More informationBiosynthesis and secretion of plant cuticular wax
Progress in Lipid Research 42 (2003) 51 80 www.elsevier.com/locate/plipres Review Biosynthesis and secretion of plant cuticular wax L. Kunst, A.L. Samuels* Department of Botany, UBC, 6270 University Boulevard,
More informationChemistry 1506: Allied Health Chemistry 2. Section 13: Biosynthetic Pathways. Making Complex Biomolecules. Outline
Chemistry 1506 Dr. Hunter s Class Section 13 Notes - Page 1/9 Chemistry 1506: Allied Health Chemistry 2 Section 13: Biosynthetic Pathways Making Complex Biomolecules utline SECTIN 13.1 INTRDUCTIN...2 SECTIN
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationProducing Wax Esters in Transgenic Plants by Expression of Genes Derived from Jojoba
Reprinted from: Perspectives on new crops and new uses. 1999. J. Janick (ed.), ASHS Press, Alexandria, VA. Producing Wax Esters in Transgenic Plants by Expression of Genes Derived from Jojoba Michael W.
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationLecture: 26 OXIDATION OF FATTY ACIDS
Lecture: 26 OXIDATION OF FATTY ACIDS Fatty acids obtained by hydrolysis of fats undergo different oxidative pathways designated as alpha ( ), beta ( ) and omega ( ) pathways. -oxidation -Oxidation of fatty
More informationGlycolysis - Plasmodium
Apicomplexan Biochemistry Basics Toxoplasma Good cell biology model Genome sequencing not completed Virtual pathways Cryptosporidium The strange one Genome sequence completed Virtual pathways Plasmodium
More informationOrganic and biochemical synthesis of monolignol biosynthetic pathway intermediates
Jie Liu 2012-2-8 Organic and biochemical synthesis of monolignol biosynthetic pathway intermediates 1. Organic synthesis of 5-hydroxyferulic acid Malonic acid 3, 4-Dihydroxy-5-methoxy-benzaldehyde 0.1
More informationAddress: School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai , China
Plant Physiology Preview. Published on May 31, 2016, as DOI:10.1104/pp.16.00095 1 2 Running head: DPW2 Is Required for Pollen Formation *Corresponding author: Prof. Wanqi Liang 3 4 5 6 7 8 Address: School
More informationMdMyb93 is a regulator of suberin deposition in russeted apple fruit skins
Research MdMyb93 is a regulator of suberin deposition in russeted apple fruit skins Sylvain Legay 1,2, Gea Guerriero 1, Christelle Andre 1,Cedric Guignard 1, Emmanuelle Cocco 1, Sophie Charton 1, Marc
More informationLipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies
Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:
More informationGlycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice
Zheng et al. BMC Plant Biology (2016) 16:70 DOI 10.1186/s12870-016-0758-8 RESEARCH ARTICLE Open Access Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice
More informationUnderstanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels)
Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels) Aruna Kilaru East Tennessee State University Johnson City, TN,
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More informationDisruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty Acids in Plant Growth
The Plant Cell, Vol. 15, 1020 1033, April 2003, www.plantcell.org 2003 American Society of Plant Biologists Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty
More informationRoles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
More informationBiosynthesis of Fatty Acids
Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty
More informationCitrate Cycle. Lecture 28. Key Concepts. The Citrate Cycle captures energy using redox reactions
Citrate Cycle Lecture 28 Key Concepts The Citrate Cycle captures energy using redox reactions Eight reactions of the Citrate Cycle Key control points in the Citrate Cycle regulate metabolic flux What role
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationWhy discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels. Dehesh UC Davis
Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels Dehesh UC Davis Fossil fuel is believed to be derived from ancient lipid rich organic material such as spores and planktonic algae! Rudolf
More informationDivision of Applied Life Sciences (Institute for Chemical R
Chair Division of Applied Life Sciences (Institute for Chemical R 2.3.12 Laboratory:Chemistry of Molecular Biocatalysts Member: Professor Hiratake, Jun, Dr. Agric. Sci. Assistant Professor Watanabe, bunta,
More informationAnabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides
Anabolism of Fatty acids (Anabolic Lynen spiral) Glycerol and Triglycerides Anabolism of fatty acids Fatty acids are not stored in the body free. They are a source of energy in the form of triglycerides
More informationAn Introduction to Carbohydrates
An Introduction to Carbohydrates Carbohydrates are a large class of naturally occurring polyhydroxy aldehydes and ketones. Monosaccharides also known as simple sugars, are the simplest carbohydrates containing
More informationRoadmap of Phenylpropanoids (Fig 18.1)
Roadmap of Phenylpropanoids (Fig 18.1) Phenolics and Phenylpropanoids (non- lignin) These are considered secondary plant metabolites (SPMs) = "small organic plant cons/tuents, not required for day- to-
More informationGLOSSY MUTANTS OF MAIZE
Heredity (1979), 42 (3), 391-395 GLOSSY MUTATS OF MAIZE IX. CHEMISTRY OF GLOSSY 4, GLOSSY 8, GLOSSY 15 AD GLOSSY 18 SURFACE WAXES* G. BtACHI, P. AVATO and F. SALAMII Istituto di Ch,mica organica, Viale
More informationThe Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants. Toshiro Ito 1 & Lee Lishi 2
The Role of Lipids in Flowering Development of Arabidopsis Enhanced pah1pah2 Plants Toshiro Ito 1 & Lee Lishi 2 Department of Biological Sciences, Faculty of Science, National University of Singapore,
More informationSynthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationThe Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis
The Plant Cell, Vol. 16, 629 642, March 2004, www.plantcell.org ª 2004 American Society of Plant Biologists The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis
More informationBiosynthesis and Seasonal Variation of Ethyl Oleate, a Primer Pheromone of the Honey Bee (Apis mellifera L.)
Biosynthesis and Seasonal Variation of Ethyl leate, a Primer Pheromone of the Honey Bee (Apis mellifera L.) Carlos Castillo 1,3, Hao Chen 1, Carolyn Graves 1, Alban Maisonnasse 2, Yves Le Conte 2 and Erika
More informationFatty acid breakdown
Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of
More informationacyltransferase activity
Proc. Natl. Acad. Sci. USA Vol. 85, pp. 4143-4147, June 1988 Biochemistry Altered regulation of lipid biosynthesis in a mutant of Arabidopsis deficient in chloroplast glycerol-3-phosphate acyltransferase
More informationThese are example problems, which are similar to those you may see on the final exam.
MCB102 / Metabolism Problem Set #3 Spring 2008 These are example problems, which are similar to those you may see on the final exam. QUESTION 1: /. Circle the correct answer, but if the answer is provide
More informationSynthesis and degradation of fatty acids Martina Srbová
Synthesis and degradation of fatty acids Martina Srbová martina.srbova@lfmotol.cuni.cz Fatty acids (FA) mostly an even number of carbon atoms and linear chain in esterified form as component of lipids
More information5.2 Lipids 5.21 Triglycerides 5.22 Phospholipids 5.23 Wax 5.24 Steroids. 5.3 Proteins 5.4 Nucleic Acids
BIOCHEMISTRY Class Notes Summary Table of Contents 1.0 Inorganic and Organic Compounds 2.0 Monomers and Polymers 3.0 Dehydration (Condensation) Synthesis 4.0 Hydrolysis Reaction 5.0 Organic Compounds 5.1
More informationCell wall components:
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during
More informationMain differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function
More informationBIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.
BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In
More information* This work was supported by the Department of Energy Great Lakes Bioenergy Research Center Office of Science Grant DE-FC02-07ER64494.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 11, pp. 8347 8355, March 9, 2012 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Identification of Grass-specific
More informationAn Introduction to Carbohydrates
An Introduction to Carbohydrates Carbohydrates are a large class of naturally occurring polyhydroxy aldehydes and ketones. Monosaccharides also known as simple sugars, are the simplest carbohydrates containing
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationCHY2026: General Biochemistry. Lipid Metabolism
CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)
More information6. How Are Fatty Acids Produced? 7. How Are Acylglycerols and Compound Lipids Produced? 8. How Is Cholesterol Produced?
Lipid Metabolism Learning bjectives 1 How Are Lipids Involved in the Generationand Storage of Energy? 2 How Are Lipids Catabolized? 3 What Is the Energy Yield from the xidation of Fatty Acids? 4 How Are
More informationA REVIEW ON BIOCHEMICAL MECHANISM OF FATTY ACIDS SYNTHESIS AND OIL DEPOSITION IN BRASSICA AND ARABIDOPSIS
American Journal of Agricultural and Biological Sciences 9 (4): 534-545, 2014 ISSN: 1557-4989 2014 M. Rahman, This open access article is distributed under a Creative Commons Attribution (CC-BY) 3.0 license
More informationLipids and Classification:
Lipids and Classification: Lipids: Biological lipids are a chemically diverse group of organic compounds which are insoluble or only poorly soluble in water. They are readily soluble in non-polar solvents
More informationLipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10
1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural
More informationBCMB 3100 Fall 2013 Exam III
BCMB 3100 Fall 2013 Exam III 1. (10 pts.) (a.) Briefly describe the purpose of the glycerol dehydrogenase phosphate shuttle. (b.) How many ATPs can be made when electrons enter the electron transport chain
More informationPlant Cell Biology; Identification and manipulation of plant quality traits
Plant Cell Biology; Identification and manipulation of plant quality traits Phil Morris, Mark Robbins, Joe Gallagher and Ana Winters Mechanisms of protein protection in forages 30 Determining the constraints
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationOil biosynthesis in a basal angiosperm: transcriptome analysis of Persea Americana mesocarp
Oil biosynthesis in a basal angiosperm: transcriptome analysis of Persea Americana mesocarp Kilaru et al. Kilaru et al. BMC Plant Biology (2015) 15:203 DOI 10.1186/s12870-015-0586-2 Kilaru et al. BMC Plant
More informationQuantification of Free Sterols, Sterol Esters, Sterol Glucosides and Acylated Sterol Glucosides in Plants by
Quantification of Free Sterols, Sterol Esters, Sterol Glucosides and Acylated Sterol Glucosides in Plants by Q-TOF Mass Spectrometry Vera Wewer and Peter Dörmann Seville, Spain, July 2012 Institute of
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. AtMYB12 antibody detects both Arabidopsis and tomato MYB12 protein. (a) AtMYB12 antibody detects both SlMYB12 and AtMYB12 in tomato fruit. Both WT and AtMYB12
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationCells extract energy from their environment and use the energy for a host of biological activities including biosynthesis.
ATP=cellular energy Cells extract energy from their environment and use the energy for a host of biological activities including biosynthesis. The reactions of energy extraction and energy use are called
More informationIntroduction to Metabolism Cell Structure and Function
Introduction to Metabolism Cell Structure and Function Cells can be divided into two primary types prokaryotes - Almost all prokaryotes are bacteria eukaryotes - Eukaryotes include all cells of multicellular
More informationPlant Biochemistry 31S2-33. ACADEMIC PRESS San Diego London Boston New York Sydney Tokyo Toronto. P.M. Dey. J.B. Harborne. edited by.
31S2-33 Plant Biochemistry edited by P.M. Dey Division of Biochemistry, School of Biological Sciences, Royal Holloway, University of London, Egham Hill, Egham, Surrey TW20 OEX, UK. and J.B. Harborne Department
More informationFinal Report for Tufts Institute of the Environment Graduate Fellowship
Final Report for Tufts Institute of the Environment Graduate Fellowship TITLE: Using Jasmonates to Enhance Long-Term Sequestration of Atmospheric Carbon. Benjamin A. Babst, Ph. D. Department of Biology,
More informationVol. 63, No 3/ Thuy T. P. Doan 2 * , Anders S. Carlsson 1, Sten Stymne 1 and Per Hofvander 1
Regular paper Vol. 63, No 3/2016 565 570 http://dx.doi.org/10.18388/abp.2016_1245 Biochemical characteristics of AtFAR2, a fatty acid reductase from Arabidopsis thaliana that reduces fatty acyl-coa and
More informationPart III => METABOLISM and ENERGY. 3.4 Lipid Catabolism 3.4a Fatty Acid Degradation 3.4b Ketone Bodies
Part III => METABOLISM and ENERGY 3.4 Lipid Catabolism 3.4a Fatty Acid Degradation 3.4b Ketone Bodies Section 3.4a: Fatty Acid Degradation Synopsis 3.4a - Triglycerides (or fats) in the diet or adipose
More informationAcyltransferase Domain Analysis using HMMER. Seoul National Univ. Hyo jin Kang
Acyltransferase Domain Analysis using HMMER Seoul National Univ. Hyo jin Kang Introduction What is an Acyltransferase? A group of enzymes catalysing the transfer of acyl groups Where can we find it? Capsaicinoid
More informationApicoplast. Treatments and New drug targets
Treatments and New drug targets Apicoplast What is the apicoplast? Where does it come from? How are proteins targeted to the organelle? How does the organelle replicate? What is the function of the organelle?
More informationThe Manga Guide to Biochemistry 2011 Masaharu Takemura, Kikuyaro, and Office Sawa.
Contents Preface.... xi Prologue... 1 1 What Happens Inside Your Body?... 13 1. Cell Structure... 14 What Are the Components of a Cell?... 16 2. What Happens Inside a Cell?... 18 Protein Synthesis... 19
More informationFATTY ACID SYNTHESIS
FATTY ACID SYNTHESIS Malonyl- CoA inhibits Carni1ne Palmitoyl Transferase I. Malonyl- CoA is a precursor for fa=y acid synthesis. Malonyl- CoA is produced from acetyl- CoA by the enzyme Acetyl- CoA Carboxylase.
More informationMetabolic Flux Analysis of the Phenylpropanoid Pathway in Elicitor-treated Potato Tuber Tissue
Plant Cell Physiol. 46(3): 454 466 (2005) doi:10.1093/pcp/pci042, available online at www.pcp.oupjournals.org JSPP 2005 Metabolic Flux Analysis of the Phenylpropanoid Pathway in Elicitor-treated Potato
More informationC 6 C 3 unit. Figure 2: Volatile oils simple C6 C3 metabolite
Phenylpropenses Are the simplest of shikimic-acid-derived biosynthetic subunit. These secondary metabolites are consist of purely of an aromatic ring (C6), with an unsaturated 3-carbon chain (C3), attached
More informationTala Saleh. Razi Kittaneh ... Nayef Karadsheh
Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationManuscript Information. Manuscript Files
Manuscript Information Journal name: Phytochemistry NIHMS ID: NIHMS930878 Manuscript Title:Potato native and wound periderms are differently affected by down-regulation of FHT, a suberin feruloyl transferase
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationReviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author:
Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author: In the manuscript by Ohno et al, the authors set out to identify the enzyme responsible for the ester bond formation
More informationSyllabus for BASIC METABOLIC PRINCIPLES
Syllabus for BASIC METABOLIC PRINCIPLES The video lecture covers basic principles you will need to know for the lectures covering enzymes and metabolism in Principles of Metabolism and elsewhere in the
More informationIdentification of intact long-chain p-hydroxycinnamate esters in leaf fibers of abaca (Musa textilis) using gas chromatography/mass spectrometry
RAPID COMMUNICATIONS IN MASS SPECTROMETRY Rapid Commun. Mass Spectrom. 2004; 18: 2691 2696 Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/rcm.1677 Identification of intact
More informationCHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005
CHEM-643 Biochemistry Mid-term Examination 8:00 10:00, Monday, 24 October 2005 Name Dr. H. White - Instructor There are 8 pages to this examination including this page. In addition, you will get a metabolic
More informationPWNI I'IHITIIBIH UI'IIVERSITY. (Including this front page) SUPPLEMENTARY/SECOND OPPORTUNITY QUESTION PAPER FACULTY OF HEALTH AND APPLIED SCIENCES
I. I'IHITIIBIH UI'IIVERSITY 0F SCIEI ICE HUD TECHNOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF NATURAL AND APPLIED SCIENCES QUALIFICATION: BACHELOR OF SCIENCE QUALIFICATION CODE: O7BOSC LEVEL:
More informationObjectives. Carbon Bonding. Carbon Bonding, continued. Carbon Bonding
Biochemistry Table of Contents Objectives Distinguish between organic and inorganic compounds. Explain the importance of carbon bonding in biological molecules. Identify functional groups in biological
More informationnumber Done by Corrected by Doctor Faisal Al- Khateeb
number 21 Done by Omar Sami Corrected by حسام أبو عوض Doctor Faisal Al- Khateeb 1 P a g e (Only one or two marks are allocated for this sheetin the exam). Through this lecture we are going to cover the
More information