Supplemental data. Uppalapati et al. (2012) Plant Cell /tpc

Supplementary Figures

Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

Sealing Plant Surfaces: Cuticular Wax Formation by Epidermal Cells

Annu. Rev. Plant Biol. 2008. 59:683 707 The Annual Review of Plant Biology is online at plant.annualreviews.org This article s doi: 10.1146/annurev.arplant.59.103006.093219 Copyright c 2008 by Annual Reviews.

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

Supplementary Figures

Supplementary Figures Supplementary Figure 1. AtMYB12 antibody detects both Arabidopsis and tomato MYB12 protein. (a) AtMYB12 antibody detects both SlMYB12 and AtMYB12 in tomato fruit. Both WT and AtMYB12

Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis

Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis

The Plant Cell, Vol. 16, 629 642, March 2004, www.plantcell.org ª 2004 American Society of Plant Biologists The Acyl-CoA Synthetase Encoded by LACS2 Is Essential for Normal Cuticle Development in Arabidopsis

The N-end rule pathway regulates pathogen responses. in plants

SUPPLEMENTARY INFORMATION The N-end rule pathway regulates pathogen responses in plants Rémi de Marchi 1,2, Maud Sorel 1, Brian Mooney 1, Isabelle Fudal 3, Kevin Goslin 1, Kamila Kwaśniewska 4, Patrick

Biosynthesis and secretion of plant cuticular wax

Progress in Lipid Research 42 (2003) 51 80 www.elsevier.com/locate/plipres Review Biosynthesis and secretion of plant cuticular wax L. Kunst, A.L. Samuels* Department of Botany, UBC, 6270 University Boulevard,

Supplementary Figures

Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

RESEARCH ARTICLES. Keywords: Cuticular wax, moisture retention capacity, mulberry, silkworm, wax genes.

Leaf surface wax composition of genetically diverse mulberry (Morus sp.) genotypes and its close association with expression of genes involved in wax metabolism H. M. Mamrutha 1,5, K. N. Nataraja 1, *,

Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg

The Plasticity of Barley (Hordeum vulgare) Leaf Wax Characteristics and their Effects on Early Events in the Powdery Mildew Fungus (Blumeria graminis f.sp. hordei): Interactive Adaptations at the Physiological

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

Supplemental Data. Hiruma et al. Plant Cell. (2010) /tpc Col-0. pen2-1

A Ch B Col-0 Cg pen2-1 Supplemental Figure 1. Trypan Blue Staining of Leaves Inoculated with Adapted and Nonadapted Colletotrichum Species.(A) Conidial suspensions of C. higginsianum MAFF305635 (Ch) were

Biochemistry: A Short Course

Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA

A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

SUPPLEMENTARY INFORMATION

Supplementary igure 1. The expression level of PP4 (At4g16860) is diminished in the rpp4 mutant (SK017569). The mna was extracted to analyze the expression level of PP4 using quantitative PC (qpc). Gene

Supplementary Fig. S1. Schematic diagram of minigenome segments.

open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

ABA-dependant signalling of PR genes and potential involvement in the defence of lentil to Ascochyta lentis

ABA-dependant signalling of PR genes and potential involvement in the defence of lentil to Ascochyta lentis Barkat Mustafa, David Tan, Paul WJ Taylor and Rebecca Ford Melbourne School of Land and Environment

Biosynthesis and functions of free and combined fatty alcohols associated with suberin

Laboratoire Biosynthesis and functions of free and combined fatty alcohols associated with suberin Collaborating Laboratories: Dr. Owen Rowland Sollapura Vishwanath PhD Candidate Department of Biology

Supplemental Data. Wang et al. (2013). Plant Cell /tpc

Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from

Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

Nature Biotechnology: doi: /nbt Supplementary Figure 1. PL gene expression in tomato fruit.

Supplementary Figure 1 PL gene expression in tomato fruit. Relative expression of five PL-coding genes measured in at least three fruit of each genotype (cv. Alisa Craig) at four stages of development,

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

Supporting Information

Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing

The Lipid Underground: Dissecting the Alkyl Hydroxycinnamate Pathway

The Lipid Underground: Dissecting the Hydroxycinnamate Pathway Dylan K Kosma, Adam Rice, Isabel Molina, Owen Rowland, Frédéric Domergue, John Ohlrogge, Mike Pollard Department of Plant Biology, Michigan

Supplementary Figures and Tables

Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:

Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty Acids in Plant Growth

The Plant Cell, Vol. 15, 1020 1033, April 2003, www.plantcell.org 2003 American Society of Plant Biologists Disruption of the FATB Gene in Arabidopsis Demonstrates an Essential Role of Saturated Fatty

Fatty Acid Desaturation

Fatty Acid Desaturation Objectives: 1. Isolation of desaturase mutants 2. Substrates for fatty acid desaturation 3. ellular localization of desaturases References: Buchanan et al. 2000. Biochemistry and

Supplementary Information

Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

Fatty acid synthesis. Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai - 116

Fatty acid synthesis Dr. Nalini Ganesan M.Sc., Ph.D Associate Professor Department of Biochemistry SRMC & RI (DU) Porur, Chennai 116 Harper s biochemistry 24 th ed, Pg 218 Fatty acid Synthesis Known as

Pome Fruit Diseases IOBC/wprs Bull. 29(1), 2006 pp

Pome Fruit Diseases IOBC/wprs Bull. 29(1), 2006 pp. 123-127 Screening of organically based fungicides for apple scab (Venturia inaequalis) control and a histopathological study of the mode of action of

Introduction. Lucas Busta 1 Daniela Hegebarth

Planta (17) 5:97 311 DOI.7/s5-1-3- ORIGINAL ARTICLE Changes in cuticular wax coverage and composition on developing Arabidopsis leaves are influenced by wax biosynthesis gene expression levels and trichome

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

Supplementary Figure 1

A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus

Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and

A WD40 Repeat Protein from Medicago truncatula Is Necessary for Tissue-Specific Anthocyanin and Proanthocyanidin Biosynthesis But Not for Trichome Development 1[W][OA] Yongzhen Pang, Jonathan P. Wenger,

Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination

Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang

Acetyl-CoA or BC acyl-coa. Int1-ACP. FabH. FabF. Anti-FabF Platensimycin ACP. Fak

Initiation Acetyl-CoA AccBCDA FabZ Int-ACP Elongation [N+] FabG Int1-ACP Acetyl-CoA or BC acyl-coa FabH FabD CoA Malonyl-ACP Malonyl CoA ACP Anti-FabI Triclosan AFN-15 FabI acyl-acp PlsX PlsY Pls C Lipoic

Supplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1

Supplemental Data Supplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1 and kan1-11 kan2-5 double mutants. A, The numbers of hydathodes in different leaves of Col-0, as2-1 rev-1,

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function

Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical

Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc

Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented

Open Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA

PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79

NO APICAL MERISTEM (MtNAM) regulates floral organ identity and lateral organ separation in Medicago truncatula

Research NO APICAL MERISTEM (MtNAM) regulates floral organ identity and lateral organ separation in Medicago truncatula Xiaofei Cheng, Jianling Peng, Junying Ma, Yuhong Tang, Rujin Chen, Kirankumar S.

Supplemental Figure 1. Small RNA size distribution from different soybean tissues.

Supplemental Figure 1. Small RNA size distribution from different soybean tissues. The size of small RNAs was plotted versus frequency (percentage) among total sequences (A, C, E and G) or distinct sequences

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

Supplemental Figure 1

1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

Figure S1 Expression of AHL gene family members in diploid (Ler Col) and triploid (Ler

Supplemental material Supplemental figure legends Figure S Expression of AHL gene family members in diploid (Ler ) and triploid (Ler osd) seeds. AHLs from clade B are labelled with (I), and AHLs from clade

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila

SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila Ayako Kohyama-Koganeya, 1,2 Takuji Nabetani, 1 Masayuki Miura, 2,3 Yoshio Hirabayashi

MPS Advanced Plant Biochemistry Course. Fall Semester Lecture 11. Lipids III

MPS 587 - Advanced Plant Biochemistry Course Fall Semester 2011 Lecture 11 Lipids III 9. Triacylglycerol synthesis 10. Engineering triacylglycerol fatty acid composition Today s topics on the Arabidopsis

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

Reviewer #1, expert in yeast metabolic engineering and biofuels (Remarks to the Author):

Reviewers' comments: Reviewer #1, expert in yeast metabolic engineering and biofuels (Remarks to the Author): In the manuscript by Gajewski et al., the authors engineered a yeast FAS to produce short-chain

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-

Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-

Supplementary Figure 1

Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

Available online at ScienceDirect. Procedia Chemistry 14 (2015 )

Available online at www.sciencedirect.com ScienceDirect Procedia Chemistry 14 (2015 ) 117 121 2nd Humboldt Kolleg in conjunction with International Conference on Natural Sciences, HK-ICONS 2014 Design

Testing the ABC floral-organ identity model: expression of A and C function genes

Objectives: Testing the ABC floral-organ identity model: expression of A and C function genes To test the validity of the ABC model for floral organ identity we will: 1. Use the model to make predictions

High coverage in planta RNA sequencing identifies Fusarium oxysporum effectors and Medicago truncatularesistancemechanisms

High coverage in planta RNA sequencing identifies Fusarium oxysporum effectors and Medicago truncatularesistancemechanisms Louise Thatcher Gagan Garg, Angela Williams, Judith Lichtenzveig and Karam Singh

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

Rpp-Mediated Gene Expression in Resistant and Susceptible Soybean Lines

Rpp-Mediated Gene Expression in Resistant and Susceptible Soybean Lines Katherine Schneider USDA-ARS, Foreign Disease-Weed Science Research Unit Martijn van de Mortel Iowa State University, Department

Supplemental Data. Pick and Bräutgam et al. Plant Cell. (2011) /tpc Mean Adjustment FOM values (± SD) vs. Number of Clusters

Mean Adjustment FOM values (± SD) vs. Number of Clusters Mean Adjustment FOM Number of Clusters Supplemental Figure 1. Figure of merit analysis of metabolite clustering. The algorithm tries 20 times to

Supplemental Information. Figures. Figure S1

Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

Supplemental Data. Article. Serotonin Regulates C. elegans Fat and Feeding. through Independent Molecular Mechanisms

Cell Metabolism, Volume 7 Supplemental Data Article Serotonin Regulates C. elegans Fat and Feeding through Independent Molecular Mechanisms Supriya Srinivasan, Leila Sadegh, Ida C. Elle, Anne G.L. Christensen,

Supporting Information

Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement

Balancing intestinal and systemic inflammation through cell type-specific expression of

Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia

Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves

Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves (a) and roots (b) and NIA2 in leaves (c) and roots (d)

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

Supplementary information

Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

Can Brachypodium distachyon provide insight into FHB? Paul Nicholson Disease and Stress Biology Department John Innes Centre

Can Brachypodium distachyon provide insight into FHB? Paul Nicholson Disease and Stress Biology Department John Innes Centre Genetics and mechanisms of FHB resistance in wheat DON (mg kḡ 1 ) ET-silenced

Supplemental Data. Beck et al. (2010). Plant Cell /tpc

Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)

A bts-1 (SALK_016526)

Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 217 A ts-1 (SALK_16526) BTS (At3g1829) ATG tsl1 (SALK_1554) 2 p BTSL1 (At1g7477) ATG tsl2 (SAIL_615_HO1)

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

Supplementary information

Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12536 Supplementary Discussion Fatty acyl-acp thioesterases for the production of FFAs There have been several reports on the production of FFAs, which are discussed

Oxi1 mutant plays an important role in Arabidopsis resistance against aphid (Myzus persicae)

Oxi1 mutant plays an important role in Arabidopsis resistance against aphid (Myzus persicae) Dr. Tahsin Shoala Assistant professor - College of Biotechnology - Misr University for Science and Technology

Penetration of the Stigma and Style Elicits a Novel Transcriptome in Pollen Tubes, Pointing to Genes Critical for Growth in a Pistil

Penetration of the Stigma and Style Elicits a Novel Transcriptome in Pollen Tubes, Pointing to Genes Critical for Growth in a Pistil Yuan Qin 1, Alexander R. Leydon 2, Ann Manziello 3, Ritu Pandey 3, David

Advances in the Production of Fuels and Chemicals Derived from Fatty Acid Metabolism

Engineering Conferences International ECI Digital Archives Metabolic Engineering IX Proceedings Summer 6-4-2012 Advances in the Production of Fuels and Chemicals Derived from Fatty Acid Metabolism Donald

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

Supplemental Figure S1.

53 kda- WT TPS29.2 (ethanol) TPS29.2 (water) Supplemental Figure S1. Inducible expression of E. coli otsa (TPS) in Arabidopsis. Immunoblot of leaf proteins (20 µg per lane) extracted from: (i) WT Col-0,

Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author:

Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author: In the manuscript by Ohno et al, the authors set out to identify the enzyme responsible for the ester bond formation