Supplementary Figure 1 Weight and body temperature of ferrets inoculated with
|
|
|
- Nicholas Blankenship
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with 10 6 TCID50 of A/Anhui/1/2013 (H7N9) influenza virus, direct contact, and aerosol contact (n = 4 per group). Body temperature is shown for only 3 direct contact ferrets, as one temperature probe was faulty.
2 Supplementary Figure 2 Mean variation frequencies of HA and NA genes after virus replication in chickens and ferrets. Round 1 ferrets were inoculated with parental A/Anhui/1/13 (H7N9) influenza virus; all ferrets include donor and contact ferrets in rounds 1 and 2. Statistical comparisons were performed by using two-tailed Mann-Whitney U test, *P < 0.05.
3 a b c
4 d e f
5 g h Supplementary Figure 3 Heat map of variations in the whole genome of A/Anhui/1/2013 (H7N9) influenza virus in ferrets. Non-synonymous variant sequences for segments PB2 (a); PB1, PB1-F2 (b); PA, PA-X (c); HA (d); NP (e); NA (f); M1, M2 (g); and NS1, NEP (h) are shown. Parental virus is compared with viruses obtained in experimental rounds 1 and 2. Rows represent viruses from donor, direct contact (DC) and aerosol contact (AC) ferrets. Columns represent amino acid positions (counted from the start codon). Mutations in PA, M1, and NS1 genes are shown in black while those in PA-X, M2, and NS2 are in purple. Mutations with frequency > 0.01 are shown.
6 a Viral titre (log 10 TCID 50 ml -1 SD) NA E73K WT Mock * * * * Time post infection (h) c d b Viral titre (log 10 TCID 50 ml -1 SD) NA I300V WT Mock * Time post infection (h) Virus titer (log 10 TCID 50 ml -1 SD) PB1 D76N WT Mock Viral titre (log 10 TCID 50 ml -1 SD) NP I365V WT Mock Time post infection (h) Time post infection (h) Supplementary Figure 4 Effect of identified amino acid substitutions in the NA, PB1, and NP on replication kinetics of A/Anhui/1/2013 (H7N9) influenza viruses in vitro. Growth curves of the wild-type and the NA E73K (a), NA I300V (b), PB1 D76N (c), and NP I365V (d) rg- A/Anhui/1/2013 (H7N9) influenza viruses using MOI 1 TCID 50 per cell in MDCK cells at 37 C. Values are mean and SD from two independent experiments (n= 4). *<0.05 compared to WT virus by 2-way ANOVA.
7 Supplementary Figure 5 Activation ph of the HA proteins of H7N9 influenza viruses. Vero cells were inoculated with the indicated viruses at an MOI of 5 TCID50/cell. Cells were then treated with ph buffers at the indicated ph values, and syncytium formation was monitored. The highest ph at which syncytia were observed (boxed in red) was recorded as the ph of HA activation. Data is representative of two independent experiments.
8 1 2 3 Supplementary Table 1 Homology sequence analysis of A/Anhui/1/2013 (H7N9) influenza virus in comparison with H7N9 influenza viruses from birds and environment isolated during the first wave of the outbreak in China, H7N9 virus (isolated form birds and environment) Date of isolation Segment a Accession No. b % Nucleotide sequence homology with A/Anhui/1/2013 c % Amino acid sequence homology with A/Anhui/1/2013 A/Chicken/Shanghai/S1053/ PB2 EPI PB1 EPI PA EPI HA EPI NP EPI NA EPI MP EPI NS EPI A/Chicken/Zhejiang/SD033/ PB2 EPI PB1 EPI PA EPI HA EPI NP EPI NA EPI MP EPI NS EPI A/Environment/Shanghai/S1088/ PB2 EPI PB1 EPI PA EPI HA EPI NP EPI NA EPI MP EPI NS EPI A/Pigeon/Shanghai/S1069/ PB2 EPI PB1 EPI PA EPI HA EPI
9 NP EPI NA EPI MP EPI NS EPI A/Pigeon/Shanghai/S1423/ PB2 EPI PB1 EPI PA EPI HA EPI NP EPI NA EPI MP EPI NS EPI a PB2: RNA polymerase basic subunit 2; PB1: RNA polymerase basic subunit 1; PA: RNA polymerase acidic subunit; HA: haemagglutinin; NP: nucleoprotein; NA: neuraminidase; MP: matrix gene; NS: non-structural gene. b Sequence data used in this table were downloaded from GISAID, Global Initiative on Sharing Avian Influenza Data ( c Homology analysis was performed using BioEdit software ( Sequence Identity Matrix tool. 11
10 12 13 Supplementary Table 2 Genetic diversity of A/Anhui/1/2013 (H7N9) influenza viruses in chickens. Animal number (Parental virus) Dpi N/A 1 3 N100D (0.4203), K627R (0.1687), L665P ( Gene segment PB2 PB1 PA HA NP NA M NS b N141D A373T T10I (0.4211), (0.1277) (0.2283) A143T (01250), N167D (0.5824), L235Q (0.2182), Y501N (0.1454), Y501C (0.1457) N346S (0.125), V421A (0.3125), V609A (0.1355) T210N (0.4737), A255G (0.3125), E377G (0.100) N141D (0.6923), N167D (0.7945), Q444L (0.1477), Y501N (0.1874), Y501C (0.1884) R26G (0.4809), R98K (0.1094), A284T (0.1975), A428T (0.1407) T50K (0.1250), K139N (0.1677) a 5 R70G (0.1102) P28L (0.1070), S184N (0.7272), Q654stop (0.1698), R663G (0.1709) N141D (0.4201), A143T (0.1203), G151E (0.1761), N167D (0.4350), Y501N (0.1935), Y501C (0.1935) R99K (0.2261), A373T (0.1207), R446K (0.1058)
11 2 3 K48R (0.1020), W98stop (0.72), D275E (0.125) E623K (0.3325) N141D (0.4225), A143T (0.1509), N167D (0.5347), N208D (0.1339), A310T (0.1724), G475D ( ), Y501N (0.1598), Y501C (0.1598) 5 N141D (0.6972), N167D (0.5634), Y501Y (0.1596), Y501C (0.1586) T10I (0.2241) M165I (0.1438), M192I (0.1846), A193V (0.1969) 3 3 M90T (0.2526) K54E (0.6257), M523I (0.6470), Q569K (0.1161) Y110H (0.1724) N141D (0.7217), N167D (0.6614), L235Q (0.8971), Y501N (0.2537), Y501C (0.2529), G520V (0.1451) A284T (0.1267),
12 F94L (0.1726), L108F (0.1274) N141D (0.2786), N167D (0.3247), L235Q (0.1111), K414R (0.1111), Y501N ( ), Y501C (0.4694) A373T (0.1265) S119P (0.1097) Three 6-week-old, specific pathogen free chickens were inoculated with 10 6 EID 50 of virus in 0.5 ml PBS via natural routes (nares, trachea, eyes). RNA was extracted from oropharyngeal swabs on the indicated days post-inoculation (dpi) and influenza virus genes were amplified and sequenced. Shown are all amino acid variations that differed from the consensus parental sequence and were present at a frequency 0.1., no nonsynonymous mutations were observed at a frequency 0.1.
13 Supplementary Table 3 Ferret serum hemagglutination inhibition titers. A/Anhui/1/2013 (H7N9) virus Serum HI titer (HAU 50 µl 1 ) After inoculation After direct contact After aerosol contact D1 D2 D3 D4 DC1 DC2 DC3 DC4 AC1 AC2 AC3 AC4 Parental < < AC < ND ND ND ND ND < < < ND Titers are reciprocal values. HAU, hemagglutinating units. D, donor; DC, direct contact; AC aerosol contact; <, below the lower limit of detection (10 HAU/50 µl); ND, not determined.
14 Supplementary Table 4 Variation frequency of A/Anhui/1/2013 (H7N9) influenza virus after inoculation of ferrets and chickens. Animal model Experiment round Group Animal no. DPI Total variation frequency (log) HA variation frequency (log) NA variation frequency (log) N/A N/A Parental N/A N/A virus Ferrets 1 Donor D D D D Direct DC Contact DC DC Aerosol AC Contact 2 Donor D D D
15 Chicken N/A N/A s Three- to 4-month-old male ferrets were inoculated intranasally with 10 6 TCID 50 of virus. Four 6-week-old, specific-pathogen-free chickens were inoculated with % egg infectious doses (EID 50 ). Viral genes were amplified and sequenced from RNA extracted from nasal washes (ferrets) or oropharyngeal swabs (chickens) on the indicated day pi. Mean variation frequency for each sample was calculated using positions that are variable in at least one of the examined samples. If a site has a minor variant frequency above zero in any of the samples this was included in the nominator and the denominator of the proportion was the total number of variable sites that was variable in all samples. Variation frequency was expressed as the negative log. DPI, day post-inoculation when mutation was detected; N/A, not applicable.
16 Supplementary Table 5 Genetic diversification of A/Anhui/1/2013 (H7N9) influenza viruses during two rounds of experiments in ferrets. Experiment round Ferret group 1 (Parenta l virus) Ferre t no. DPI Gene segment PB2 PB1 PA HA NP NA MP NS N/A N/A N141D (0.4211), A143T (0.1250), N167D (0.5824), L235Q (0.2182), Y501N (0.1454), Y501C (0.1457) Donor D1 1 A143T (0.2322), N167D (0.2251) 4 N409S N167D (0.1619), (0.1130) L235Q (0.3133) D2 1 N141D (0.1936), A143T (0.1922), N167D (0.3266) Direct Contact Direct Contact D3 1 N141D (0.1561), A143T (0.2241), N167D (0.2254), Y501N (0.1688), Y501C (0.1628) 4 N141D (0.2861), A143T (0.1873), N167D (0.3769), L235Q (0.3691), Y501N (0.1782), Y501C (0.1782) D4 1 N141D (0.2087), N167D (0.3380) 4 N141D (0.2391), N167D (0.4117), L235Q (0.2562) A373T (0.1277) A373T (0.1036) A373T (0.1530) A373T (0.1123) A373T (0.1078) A373T (0.1371) A373T (0.1199) A373T (0.1408) T10I (0.2283) T10I (0.1838) T10I (0.1019) T10I (0.1822) T10I (0.2023) T10I (0.2098) T10I (0.2392) DC1 6 A674T (0.9712) DC2 6 A228E (0.9880) T10I (0.6308),
17 Aerosol Contact DC4 6 D76N (0.5316) 8 D76N (0.2793) AC4 8 D76N (0.4320) N141D (0.1818), N167D (0.4178), A228E (0.1173), L235Q (0.1737) N141D (0.2464), N167D (0.5005), A228E (0.1004), L235Q (0.1174) I365V (0.6387) R103K (0.9576) L193M T10I (0.1111), (0.2404), M352I I26M (0.1887) (0.1266), N340I (0.1511) E73K (0.4058), I300V (0.4103) 2 Donor D1-2 2 D76N (0.3177) Donor D2-2 2 D76N (0.3887) 4 D76N (0.2604) D3-2 2 D76N (0.2993) 4 D76N (0.2016) K414E (0.1563), Y501N (0.3182), Y501C (0.3182) Y501N (0.3137), Y501C (0.3137) I365V (0.6163) I365V (0.6236) I365V (0.4976) K414E (0.1455), Y501N (0.1783), Y501C (0.1719) Y501N (0.1449), Y501C (0.1439) I365V (0.6174) I365V (0.5547) E73K (0.3941), I300V (0.3451) E73K (0.4348), I300V (0.3739) E73K (0.2933), I300V (0.2848) E73K (0.3309), I300V (0.4053) E73K (0.4471), I300V (0.4426)
18 Three to 4-month-old male ferrets were inoculated intranasally with 10 6 TCID 50 of virus. Viral genes were amplified and sequenced from RNA extracted from nasal washes on the indicated day pi. Shown are all amino acid variations that differed from the consensus parental sequence and were present at a frequency of 0.1. Numbers in parentheses indicate the frequency at which each mutation occurred under each condition. DPI, day post inoculation when mutation was detected; NA, not applicable;, no nonsynonymous mutations were detected at a frequency 0.1.
19 45 Supplementary Table 6 List of primers used in the study. Primer Description Sequence (5 3 ) N9 E73K F E73K site-directed mutagenesis CAAACATCACCAACATCCAAATGAAAGAGAGAACAAG N9 E73K R E73K site-directed mutagenesis GAAATTCCTGCTTGTTCTCTCTTTCATTTGGATGTTG N9 I300V F I300V site-directed mutagenesis GCAGGGCTCAAATAGACCAGTGGTTCAGATAGACCC N9 I300V R I300V site-directed mutagenesis GTGTCATTGCTACTGGGTCTATCTGAACCACTGGTCTATTTG N9 ClaI/- F ClaI site deletion GTGGACCAGCAATAGTATAGTTTCGATGTGTTCCAGTACAG N9 ClaI/- R ClaI site deletion CCAGGAATTCTGTACTGGAACACATCGAAACTATACTATTGC PB2 K627E F K627E site-directed mutagenesis CCATTTGCAGCAGCCCCGCCGGAGCAGAGTAGG PB2 K627E R K627E site-directed mutagenesis CGGCGGGGCTGCTGCAAATGGTAATAGCTT PB1 D76N F D76N site-directed mutagenesis ATTGATGGACCATTACCTGAGAACAACGAGCCGA PB1 D76N R D76N site-directed mutagenesis CTCAGGTAATGGTCCATCAATTGGATTGAGT I365V F I365V site-directed mutagenesis GCTATCCACTAGAGGGGTTCAAGTTGCTTCAAAT I365V R I365V site-directed mutagenesis TTGAACCCCTCTAGTGGATAGCTGTCCTCTT N9 ClaI F N9 NheI HA-tag R N-terminal ClaI restriction site insertion for pcaags cloning C-terminal NheI restriction site and HAtag insertion TTACCATCGATATGAATCCAAATCAGAAGATTC TTTCGCGCTAGCTTAAGCGTAATCTGGAACATCGTATGGGTAGAGGAAGTACT CTATTTTAGCC N9 NheI R C-terminal NheI restriction site insertion TTTCGCGCTAGCTTAGAGGAAGTACTCTATTTTAGCC 46
20 47 48 Supplementary Table 7 List of sialic acid-containing glycans used in glycan arrays Chart Name NeuAcα- Type Sulfated number 1 Galβ(1-4)-GlcNAcβ-ethyl-NH 2 Type 2 2 Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)- GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 N 3 NeuAca(2-3)-Galβ(1-4)-6-O-sulfo-GlcNAcβ-propyl-NH 2 3 Type 2 6S-GlcNAc 4 NeuAcα(2-3)-Galβ(1-4)-[Fucα(1-3)]-6-O-sulfo-GlcNAcβ-propyl-NH 2 3 Type 2 6S-GlcNAc 5 NeuAcα(2-3)-6-O-sulfo-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 3 Type 2 6S-Gal 6 NeuAcα(2-3)-6-O-sulfo-Galβ(1-4)-[Fucα(1-3)]-GlcNAcβ-propyl-NH 2 3 Type 2 6S-Gal 7 NeuAcα(2-3)-Galβ(1-3)-6-O-sulfo-GlcNAcβ-propyl-NH 2 3 Type 1 6S-GlcNAc 8 NeuAca(2-3)-Galβ(1-4)-Glcβ-ethyl-NH 2 3 Lacto 9 NeuAca(2-3)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 3 Type 2 10 NeuAca(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 3 Type 2 11 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβethyl-NH 3 Type NeuAca(2-3)-GalNAcβ(1-4)-GlcNAcβ-ethyl-NH 2 3 LacDiNAc 13 NeuAca(2-3)-Galβ(1-3)-GlcNAcβ-ethyl-NH 2 3 Type 1 14 NeuAca(2-3)-Galβ(1-3)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 3 Type 2
21 15 NeuAca(2-3)-Galβ(1-3)-GlcNAcβ(1-3)-Galβ(1-3)-GlcNAcβ-ethyl-NH 2 3 Type 1 16 NeuAca(2-3)-Galβ(1-3)-GalNAcβ(1-3)-Gala(1-4)-Galβ(1-4)-Glcβ-ethyl-NH 2 3 Lacto 17 NeuAcα(2-3)-Galβ(1-3)-GalNAcα-Thr-NH 2 3 Core 1 18 NeuAcα(2-3)-Galβ(1-3)-[GlcNAcβ(1-6)]-GalNAcα-Thr-NH 2 3 Core 2 19 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-6)-[Galβ(1-3)]-GalNAcα-Thr-NH 2 3 Core 2 20 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-6)-[Galβ(1-3)]-GalNAcα- Thr-NH 2 3 Core 2 21 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-GalNAcα-Thr-NH 2 3 Core 3 22 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-GalNAcα-Thr-NH 2 3 Core 3 23 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-[NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-6)]- 3 Core 4 GalNAcα-Thr-NH 2 24 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-[NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-6)]-GalNAcα-Thr-NH 2 3 Core 4 25 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-3)-Galβ(1-4)- GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 3 N 26 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)- [NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 27 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 3 N 3 N
22 28 NeuAca(2-3)-[GalNAcβ(1-4)]-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 3 Type 2 29 NeuAca(2-3)-[GalNAcβ(1-4)]-Galβ(1-4)-Glcβ-ethyl-NH 2 3 Ganglio 30 Galβ(1-3)-GalNAcβ(1-4)-[NeuAca(2-3)]-Galβ(1-4)-Glcβ-ethyl-NH 2 3 Ganglio 31 NeuAca(2-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβ-propyl-NH 2 3 Type 2 32 NeuAca(2-3)-Galβ(1-3)-[Fuca(1-4)]-GlcNAcβ(1-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβethyl-NH 2 3 Type 2 33 NeuAca(2-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβ(1-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβethyl-NH 2 3 Type 2 34 NeuAca(2-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβ(1-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβ(1-3)-Galβ(1-4)-[Fuca(1-3)]-GlcNAcβ-ethyl-NH 2 3 Type 2 35 NeuGca(2-3)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 3-Gc Type 2 36 NeuAca(2-6)-Galβ(1-4)-6-O-sulfo-GlcNAcβ-propyl-NH 2 6 Type 2 6S-GlcNAc 37 NeuAca(2-6)-Galβ(1-4)-Glcβ-ethyl-NH 2 6 Lacto 38 NeuAca(2-6)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 6 Type 2 39 NeuAca(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 6 Type 2 40 NeuAca(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβethyl-NH 2 6 Type 2 41 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-[NeuAcα(2-6)]-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 6 Type 2 42 NeuAca(2-6)-GalNAcβ(1-4)-GlcNAcβ-ethyl-NH 2 6 LacDiNAc
23 43 NeuAcα(2-6)-[Galβ(1-3)]-GalNAcα-Thr-NH 2 6 Core 1 44 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-6)-[Galβ(1-3)]-GalNAcα-Thr-NH 2 6 Core 2 45 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-6)-[Galβ(1-3)]-GalNAcα- Thr-NH 2 6 Core 2 46 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-GalNAcα-Thr-NH 2 6 Core 3 47 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-GalNAcα-Thr-NH 2 6 Core 3 48 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-[NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-6)]- GalNAcα-Thr-NH 2 6 Core 4 49 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-[NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-6)]-GalNAcα-Thr-NH 2 6 Core 4 50 Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 6 N 51 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 6 N 52 GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 6 N 53 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-6)-Galβ(1-4)- GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 6 N 54 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)- [NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 6 N
24 55 NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 6 N 56 NeuGcα(2-6)-Galβ(1-4)-GlcNAcβ-ethyl-NH 2 6-Gc Type 2 57 NeuAcα(2-3)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-6)-Galβ(1-4)- GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 3/6 N NeuAcα(2-6)-Galβ(1-4)-GlcNAcβ(1-2)-Manα(1-3)-[NeuAcα(2-3)-Galβ(1-4)- GlcNAcβ(1-2)-Manα(1-6)]-Manβ(1-4)-GlcNAcβ(1-4)-GlcNAcβ-Asn-NH 2 3/6 N
Supplementary Figure 1. Heavy chain sequences of 2G1 and 8M2 aligned with V H 1-69
Supplementary Figure 1. Heavy chain sequences of 2G1 and 8M2 aligned with V H 1-69 germline gene sequence. 2G1 and 8M2 acquired 14 and 18 mutations from the germline gene sequence, respectively. In 2G1,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12391 Table 1. Binding of A(H7N9) viruses to individual glycan structures. # Structure a Anhui1 Shanghai1 1 Neu5Acα nb nb 2 Neu5Acα ++ nb 3 Neu5Acβ nb nb 4 Neu5Acα2-3(6-O-Su)Galβ1-4GlcNAcβ
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared
Relative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
To test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
Supplementary Figure 1 Schematic overview of the mutant virus libraries and their
Supplementary Figure 1 Schematic overview of the mutant virus libraries and their consecutive passages in MDCK cells. All nine virus libraries were passaged twice in MDCK cells. Then, aliquots of all nine
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock
Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication
Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication Oscar Blanch-Lombarte Rome, 7-9 June, 2017 European
modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Influenza A Virus Transmission Bottlenecks Are Defined by Infection Route and Recipient Host
Cell Host & Microbe, Volume 16 Supplemental Information Influenza A Virus Transmission Bottlenecks Are Defined by Infection Route and Recipient Host Andrew Varble, Randy A. Albrecht, Simone Backes, Marshall
Application of Reverse Genetics to Influenza Vaccine Development
NIAID Application of Reverse Genetics to Influenza Vaccine Development Kanta Subbarao Laboratory of Infectious Diseases NIAID, NIH Licensed Vaccines for Influenza Principle: Induction of a protective
Competing co-infections of LP and HP AIV H7N7
Competing co-infections of LP and HP AIV H7N7 Friedrich-Loeffler-Institute, Federal Research Institute for Animal Health Suedufer 10, 17493 Greifswald-Island of Riems, Germany Annika Graaf, Timm Harder
Public health relevant virological features of Influenza A(H7N9) causing human infection in China
Public health relevant virological features of Influenza A(H7N9) causing human infection in China Address requests about publications of the WHO Regional Office for Europe to: Publications WHO Regional
(the change introduced is to add a risk assessment, missing from the previous version, for small-scale laboratory work with characterized CVV)
Update of WHO biosafety risk assessment and guidelines for the production and quality control of human influenza vaccines against avian influenza A(H7N9) virus As of 23 May 2013 (replaces version of 10
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech
The A(H7N9) influenza outbreak in China
Viruses in May, Katoomba, 9 11 May 2013 The A(H7N9) influenza outbreak in China Anne Kelso Director WHO Collaborating Centre for Reference and Research on Influenza Melbourne Influenza in the 21 st century:
Study the Evolution of the Avian Influenza Virus
Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction
WHO biosafety risk assessment and guidelines for the production and quality control of human influenza pandemic vaccines: Update
WHO biosafety risk assessment and guidelines for the production and quality control of human influenza pandemic vaccines: Update 23 July 2009 Introduction This document updates guidance 1 from the World
An Outbreak of Pandemic H1N1 Influenza in Turkeys in Ontario DAVOR OJKIC ANIMAL HEALTH LABORATORY UNIVERSITY OF GUELPH
An Outbreak of Pandemic H1N1 Influenza in Turkeys in Ontario 1 DAVOR OJKIC ANIMAL HEALTH LABORATORY UNIVERSITY OF GUELPH 2 3 Host and lineage origins for the gene segments of the ph1n1 R J Garten et al.
Evolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
TITLE: Influenza A (H7N9) virus evolution: Which genetic mutations are antigenically important?
TITLE: Influenza A (H7N9) virus evolution: Which genetic mutations are antigenically important? AUTHORS: Joshua G. Petrie 1, Adam S. Lauring 2,3 AFFILIATIONS: 1 Department of Epidemiology, University of
Risk Assessment of H3N2 Avian Origin Canine Influenza Viruses
Risk Assessment of H3N2 Avian Origin Canine Influenza Viruses Henry Wan, Ph.D. Department of Basic Sciences College of Veterinary Medicine Mississippi State University E-mail: wan@cvm.msstate.edu Phone:
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Development of safe and immunogenic reassortant viruses with 5:3 genotype for live attenuated influenza vaccine
Development of safe and immunogenic reassortant viruses with 5:3 genotype for live attenuated influenza vaccine Irina Isakova-Sivak, PhD Institute of Experimental Medicine, Saint Petersburg, Russia The
Guiding outbreak management by the use of influenza A(H7Nx) virus sequence analysis
Rapid communications Guiding outbreak management by the use of influenza A(H7Nx) virus sequence analysis M Jonges (marcel.jonges@rivm.nl) 1,2, A Meijer 1, R A Fouchier 2, G Koch 3, J Li 4, J C Pan 4, H
Flu, Avian Flu and emerging aspects (H1N1 resistance)
EU-CIS Seminar New trends in Infectious Diseases 26 28 November 2008 / Lyon, France Flu, Avian Flu and emerging aspects (H1N1 resistance) Pr. Florence MORFIN FRE 3011 Université Lyon 1 - CNRS Laboratory
Original Article Development and Sequence Analysis of a Cold-Adapted Strain of Influenza A/New Caledonia/20/1999(H1N1) Virus
Iranian Journal of Virology 2011;5(4): 6-10 2011, Iranian Society for Virology Original Article Development and Sequence Analysis of a Cold-Adapted Strain of Influenza A/New Caledonia/20/1999(H1N1) Virus
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Supporting Information
Supporting Information Yen et al. 10.1073/pnas.1111000108 SI Materials and Methods Cells. Madin Darby canine kidney (MDCK) cells and human embryonic kidney 293T cells were obtained from the American Type
Origins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings
Origins and evolutionary genomics of the novel 2013 avian-origin H7N9 influenza A virus in : Early findings Jiankui He*, Luwen Ning, Yin Tong Department of Biology, South University of Science and Technology
HPAI. Update of H7N9 in china:the epidemiological and virological features LPAI. H7N9 avian influenza viruses (before 2013)
Update of H7N9 in china:the epidemiological and virological features Yuelong Shu WHO Collaborating Center for Reference and Research on Influenza Chinese National Influenza Center National Institute for
C E E Z A D. Rational Development of Influenza Vaccines: NDV-based influenza vaccines for poultry and livestock
C E E Z A D Center of Excellence for Emerging and Zoonotic Animal Diseases A Department of Homeland Security Center of Excellence Rational Development of Influenza Vaccines: NDV-based influenza vaccines
Pathogenicity and transmission of a swine influenza A(H6N6) virus
OPEN (2017) 6, e17; doi:10.1038/emi.2017.3 www.nature.com/emi ORIGINAL ARTICLE Pathogenicity and transmission of a swine influenza A(H6N6) virus Hailiang Sun 1, Bryan S Kaplan 2, Minhui Guan 1, Guihong
Pandemic Influenza influenza epidemic: realization of a worst-case scenario
Pandemic Influenza October 9, 2006 1918 influenza epidemic: realization of a worst-case scenario First case: Albert Mitchell, Camp Funston, KS, March 11, 1918 Up to 20% of all humans infected 20-50 million
SUPPLEMENTARY INFORMATION
doi:10.1038/nature14008 Supplementary Figure 1. Sequence alignment of A/little yellow-shouldered bat/guatemala/060/2010 (H17N10) polymerase with that of human strain A/Victoria/3/75(H3N2). The secondary
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10831 1. Pathological analyses of H5 avian-human reassortant viruses. The rgca04 infection in the lungs of ferrets mainly caused severe bronchopneumonia with
New Small and Versatile Reporter Technologies for Challenging Applications in Virology. Robert Brazas, Ph.D.
New Small and Versatile Reporter Technologies for Challenging Applications in Virology Robert Brazas, Ph.D. Presentation Overview Small size of NanoLuc Luciferase is advantageous Agenda Building a better
Characterization of the 1918 influenza virus polymerase genes
Vol 437 6 October 2005 doi:10.1038/nature04230 Characterization of the 1918 influenza virus polymerase genes Jeffery K. Taubenberger 1, Ann H. Reid 1, Raina M. Lourens 1, Ruixue Wang 1, Guozhong Jin 1
Impact of Amino Acid Mutations in PB2, PB1-F2, and NS1 on the Replication and Pathogenicity of Pandemic (H1N1) 2009 Influenza Viruses
JOURNAL OF VIROLOGY, May 2011, p. 4596 4601 Vol. 85, No. 9 0022-538X/11/$12.00 doi:10.1128/jvi.00029-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Impact of Amino Acid Mutations
Supplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
Multifunctional Adaptive NS1 Mutations Are Selected upon Human Influenza Virus Evolution in the Mouse
Multifunctional Adaptive NS1 Mutations Are Selected upon Human Influenza Virus Evolution in the Mouse Nicole E. Forbes 1,2, Jihui Ping 1,2, Samar K. Dankar 1,2, Jian-Jun Jia 1,2, Mohammed Selman 1,2, Liya
Isolation and characterization of H7N9 viruses from live poultry markets Implication of the source of current H7N9 infection in humans
Invited Article Virology doi: 10.7/s11434-013-5873-4 Isolation and characterization of H7N9 viruses from live poultry markets Implication of the source of current H7N9 infection in humans SHI JianZhong
Epistatic interactions between neuraminidase mutations facilitated the emergence of the oseltamivir-resistant H1N1 influenza viruses
Received 19 Jan 1 Accepted 19 Aug 1 Published 9 Oct 1 DOI: 1.13/ncomms9 Epistatic interactions between neuraminidase mutations facilitated the emergence of the oseltamivir-resistant H1N1 influenza viruses
A Live Attenuated H7N7 Candidate Vaccine Virus Induces Neutralizing Antibody That Confers Protection from Challenge in Mice, Ferrets, and Monkeys
JOURNAL OF VIROLOGY, Nov. 2010, p. 11950 11960 Vol. 84, No. 22 0022-538X/10/$12.00 doi:10.1128/jvi.01305-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. A Live Attenuated H7N7
Update on Zoonotic Infections with Variant Influenza A Viruses in the USA
Update on Zoonotic Infections with Variant Influenza A Viruses in the USA Todd Davis Zoonotic Virus Team Virology, Surveillance and Diagnosis Branch Influenza Division CDC, Atlanta OFFLU Swine Influenza
ph1n1 H3N2: A Novel Influenza Virus Reassortment
ph1n1 H3N2: A Novel Influenza Virus Reassortment Jonathan Gubbay Medical Microbiologist Public Health Laboratory Public Health Ontario June 16, 2011 ph1n1 H3N2 Reassortment: Talk Overview Explain strain
Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences
Avian Influenza Virus H7N9 Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus RNA virus, Orthomyxoviruses Influenza A virus Eight Gene segments
Update of WHO biosafety risk assessment and guidelines for the production and quality control of human influenza pandemic vaccines
Update of WHO biosafety risk assessment and guidelines for the production and quality control of human influenza pandemic vaccines 28 May 2009 Introduction This document updates WHO guidance 1 to national
Immunogenicity of Avian Influenza H7N9 Virus in Birds
Immunogenicity of Avian Influenza H7N9 Virus in Birds Identification of Viral Epitopes Recognized by the Immune System Following Vaccination and Challenge Darrell R. Kapczynski US DEPARTMENT OF AGRICULTURE,
Detection of Influenza A Virus. THESIS. Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in
Characterization of Sialic Acid Receptors on MDCK Cells Maintained Under Different Media Conditions by Flow Cytometric Analysis and Implications for Detection of Influenza A Virus. THESIS Presented in
Infection dynamics of novel influenza A viruses isolated from Australian pigs
Infection dynamics of novel influenza A viruses isolated from Australian pigs Joanne Taylor PhD Candidate Supervisors: Dr Frank Wong, Dr David Williams, Dr John Bingham, Dr Joanne Meers 3 rd December 2015
Experiences with Live Attenuated Avian Influenza Vaccine Trials in Thailand
Experiences with Live Attenuated Avian Influenza Vaccine Trials in Thailand Punnee Pitisuttithum, MBBS,DTM&H,FRCPT Vaccine Trial Center,Faculty of Tropical Medicine, Mahidol University For MOPH,CDC,MU,Geneva
http://nmhm.washingtondc.museum/collections/archives/agalleries/1918flu/ncp1603.jpg 1 https://assets-production-webvanta-com.s3-us-west- 2 2.amazonaws.com/000000/47/62/original/images/img_109_influenza/Spanish_flu_death_chart.jpg
Vaccine 30 (2012) Contents lists available at SciVerse ScienceDirect. Vaccine. jou rn al h om epa ge:
Vaccine 30 (2012) 7395 7399 Contents lists available at SciVerse ScienceDirect Vaccine jou rn al h om epa ge: www.elsevier.com/locate/vaccine Possible outcomes of reassortment in vivo between wild type
Investigation on the possible application of a serological DIVA monitoring strategy when a rhvt-h5 vaccine is used to control Avian Influenza
AVMA AAAP Convention 2016 August 7, San Antonio, Texas, USA Investigation on the possible application of a serological DIVA monitoring strategy when a rhvt-h5 vaccine is used to control Avian Influenza
Deep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
Introduction to Avian Influenza
Introduction to Avian Influenza David L. Suarez D.V.M., Ph.D. Research Leader Exotic and Emerging Avian Viral Disease Research Unit Agricultural Research Service United States Department of Agriculture
Influenza or flu is a
Clinical and Research Area Infectious Diseases Influenza Virus Types A and B Influenza or flu is a respiratory illness that is caused by influenza viruses. Influenza viruses type A and type B cause seasonal
Laboratory Diagnosis of Viral Infections affect the Lower Respiratory Tract. M Parsania, Ph.D. Tehran Medical Branch, Islamic Azad University
Laboratory Diagnosis of Viral Infections affect the Lower Respiratory Tract M Parsania, Ph.D. Tehran Medical Branch, Islamic Azad University Overview of viral infections affect the lower respiratory tract
Ralf Wagner Paul-Ehrlich-Institut
www.pei.de Other Assays for the Detection of Neuraminidase (NA)-Specific Antibodies Ralf Wagner Paul-Ehrlich-Institut Overview to presented assays Assay principle based on: Chemical substrates: Protein
Epidemiological, clinical, and virologic features of two family. virus infections in Southeast China
Received: 9 November 2016 Accepted: 19 April 2017 Published: xx xx xxxx Epidemiological, clinical, and virologic features of two family virus infections in Southeast China Jianfeng Xie, Yuwei Weng, Jianming
Supplemental Information Dose Response Parameters for Gain of Function Pathogens
Supplemental Information Dose Response Parameters for Gain of Function Pathogens Infection Dose-Response To quantify the likelihood of an individual or animal becoming infected from exposure to virus,
Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
Influenza viruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics
Influenza viruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Enveloped particles, quasi-spherical or filamentous Diameter 80-120 nm Envelope is derived
Supporting Online Material for
www.sciencemag.org/cgi/content/full/328/5985/1529/dc1 Supporting Online Material for Reassortment of Pandemic H1N1/2009 Influenza A Virus in Swine D. Vijaykrishna, L. L. M. Poon, H. C. Zhu, S. K. Ma, O.
Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD)
Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD) John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang, Taejoong Kim, Stephen Spatz, Qingzhong Yu USDA-ARS-USPNRC
Molecular characterization of avian influenza H5N1 virus in Egypt and the emergence of a novel endemic subclade
Journal of General Virology (2014), 95, 1444 1463 DOI 10.10/vir.0.063495-0 Molecular characterization of avian influenza H5N1 virus in Egypt and the emergence of a novel endemic subclade Rabeh El-Shesheny,
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
V rology Springer-Vertag 1991 Printed in Austria
Arch Virot (1991) 119:37-42 _Archives V rology Springer-Vertag 1991 Printed in Austria Replication of avian influenza viruses in humans A. S. Beare 1'* and R. G. Webster: l Clinical Research Centre, Harvard
Reverse genetic platform for inactivated and live-attenuated influenza vaccine
EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 42, No. 2, 116-121, February 2010 Reverse genetic platform for inactivated and live-attenuated influenza vaccine Eun-Ju Jung, Kwang-Hee Lee and Baik Lin Seong
H7N9 Live Attenuated Influenza Vaccine Is Highly Immunogenic, Prevents Virus Replication, and Protects Against Severe Bronchopneumonia in Ferrets
The American Society of Gene & Cell Therapy original article H7N9 Live Attenuated Influenza Vaccine Is Highly Immunogenic, Prevents Virus Replication, and Protects Against Severe Bronchopneumonia in Ferrets
Phylogenetic Methods
Phylogenetic Methods Multiple Sequence lignment Pairwise distance matrix lustering algorithms: NJ, UPM - guide trees Phylogenetic trees Nucleotide vs. amino acid sequences for phylogenies ) Nucleotides:
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Characterization of Uncultivable Bat Influenza Virus Using a Replicative Synthetic Virus
Characterization of Uncultivable Bat Influenza Virus Using a Replicative Synthetic Virus Bin Zhou 1. a, Jingjiao Ma 2., Qinfang Liu 2., Bhupinder Bawa 2, Wei Wang 1, Reed S. Shabman 1, Michael Duff 2,
Potential Role of Exposure to Poultry Products and By-products for Human H5N1 infections
Potential Role of Exposure to Poultry Products and By-products for Human HN infections David E. Swayne, A. Lipatov, Y.K. Kwon, M. Jackwood & J. Beck USDA/Agricultural Research Service Southeast Poultry
Swine influenza research in Europe in 2015: an update
Swine influenza research in Europe in 2015: an update Prof. Kristien Van Reeth, Ghent University, Belgium Jose Carlos Mancera Gracia, Ghent University, Belgium Pathogenesis and transmission of influenza
INFLUENZA-2 Avian Influenza
INFLUENZA-2 Avian Influenza VL 7 Dec. 9 th 2013 Mohammed El-Khateeb Overview 1. Background Information 2. Origin/History 3. Brief overview of genome structure 4. Geographical Distribution 5. Pandemic Nature
Evolutionary interactions between haemagglutinin and neuraminidase in avian influenza
Ward et al. BMC Evolutionary Biology 2013, 13:222 RESEARCH ARTICLE Open Access Evolutionary interactions between haemagglutinin and neuraminidase in avian influenza Melissa J Ward 1*, Samantha J Lycett
Trends in influenza A virus genetics: Can we predict the natural evolution of a H5N1 Z?
Current Topics in Virology Vol. 7, 2008 Trends in influenza A virus genetics: Can we predict the natural evolution of a H5N1 Z? Earl G. Brown 1, *, Syed A. Sattar 2, Jason A. Tetro 2 and Jinhua Liu 3 1
Pandemic Potential of Reassortant Swine Influenza A Viruses
University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 12-2009 Pandemic Potential of Reassortant Swine Influenza A Viruses
Live Attenuated Influenza Vaccine. I. Background and Seasonal Vaccine
Live Attenuated Influenza Vaccine I. Background and Seasonal Vaccine Influenza infection stimulates multiple arms of the immune system Systemic antibody to HA and NA, and multiple internal proteins Mucosal
Patricia Fitzgerald-Bocarsly
FLU Patricia Fitzgerald-Bocarsly October 23, 2008 Orthomyxoviruses Orthomyxo virus (ortho = true or correct ) Negative-sense RNA virus (complementary to mrna) Five different genera Influenza A, B, C Thogotovirus
Supplementary Information
Supplementary Information Profiling of core fucosylated N-glycans using a novel bacterial lectin that specifically recognizes α1,6 fucosylated chitobiose Saulius Vainauskas 1, Rebecca M. Duke 1,2, James
Blocking Interhost Transmission of Influenza Virus by Vaccination in the Guinea Pig Model
JOURNAL OF VIROLOGY, Apr. 2009, p. 2803 2818 Vol. 83, No. 7 0022-538X/09/$08.00 0 doi:10.1128/jvi.02424-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Blocking Interhost Transmission
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Supplemental Methods Phenotype Prediction Analyses In order to assess the phylogenetic properties of nssnvs, sequence conservation analysis was conducted using
Existence of reassortant A (H1N2) swine influenza viruses in Saitama Prefecture, Japan
International Congress Series 1263 (2004) 749 753 Existence of reassortant A (H1N2) swine influenza viruses in Saitama Prefecture, Japan Shin ichi Shimada a, *, Takayasu Ohtsuka b, Masayuki Tanaka b, Munehito
Diagnosis of H1N1 (2009) at the CSIRO Australian Animal Health Laboratory
Diagnosis of H1N1 (2009) at the CSIRO Australian Animal Health Laboratory Peter Daniels and Paul Selleck Prepared for the 2 nd OFFLU Technical Meeting OIE Paris, 15 & 16 September, 2009 AAHL holds the
I N T R O D U C T I O N
I N T R O D U C T I O N Wednesday 5 April 2017 Jérôme BAUDON, Head of Avian Strategic Business Unit Boehringer Ingelheim THE NEW BOEHRINGER INGELHEIM Merial is now part of the Boehringer Ingelheim family.
(;[rowth Charaeteristies of Influenza Virus Type C in Avian Hosts
Archives of Virology 58, 349--353 (1978) Archives of Virology by Springer-Verlag 1978 (;[rowth Charaeteristies of Influena Virus Type C in Avian Hosts Brief Report By M ~R A~N D. AUSTIn, A. S. MONTO, and
Transmission and Pathogenesis of Swine-Origin 2009 A(H1N1) Influenza Viruses in Ferrets and Mice
Transmission and Pathogenesis of Swine-Origin 2009 A(H1N1) Influenza Viruses in Ferrets and Mice The MIT Faculty has made this article openly available. Please share how this access benefits you. Your
Cross-Reactivity to Field Isolates of Canine Influenza Virus by a Killed Canine Influenza Virus (H3N8, Iowa05) Vaccine
Cross-Reactivity to Field Isolates of Canine Influenza Virus by a Killed Canine Influenza Virus (H3N8, Iowa05) Vaccine Nancee Oien, B.S., M.S. a Sally Mattern, B.S a Jaime Brozowski, B.S., M.S. b Janet
Envelope e_ :------, Envelope glycoproteins e_ ~ Single-stranded RNA ----, Nucleocapsid
Virus Antib(tdies Your Expertise, Our Antibodies, Accelerated Discovery. Envelope e_---------:------, Envelope glycoproteins e_-------1~ Single-stranded RNA ----, Nucleocapsid First identified in 1989,
Research Article Effect of the PB2 and M Genes on the Replication of H6 Influenza Virus in Chickens
Influenza Research and Treatment, Article ID 547839, 6 pages http://dx.doi.org/10.1155/2014/547839 Research Article Effect of the PB2 and M Genes on the Replication of H6 Influenza Virus in Chickens Hiroichi
What sort of Science is Glycoscience? (Introductory lecture)
Glycosciences: Glycobiology & Glycochemistry e-learning course What sort of Science is Glycoscience? (Introductory lecture) Paula Videira Faculdade de Ciências Médicas Nova University, Lisbon Portugal
Isolation of an Egg-Adapted Influenza A(H3N2) Virus without Amino Acid Substitutions at the Antigenic Sites of Its Hemagglutinin
Jpn. J. Infect. Dis., 71, 234 238, 2018 Original Article Isolation of an Egg-Adapted Influenza A(H3N Virus without Amino Acid Substitutions at the Antigenic Sites of Its Hemagglutinin Tomoko Kuwahara 1,
Human Influenza. Dr. Sina Soleimani. Human Viral Vaccine Quality Control 89/2/29. November 2, 2011 HVVQC ١
Human Influenza Dr. Sina Soleimani Human Viral Vaccine Quality Control 89/2/29 November 2, 2011 HVVQC ١ Presentation outline 1. Introduction 2. Virology 3. Classification 4. Hosts 5. Antigenic Specifications
OFFLU contribution to the WHO vaccine selection meeting
OFFLU contribution to the WHO vaccine selection meeting WHO Consultation on the Composition of Influenza Vaccines for the Southern Hemisphere 0 (0- Feb 0, Geneva) Giovanni Cattoli OFFLU Annual technical
RECOMBINANT VACCINES Live or Killed
Antigens and Vaccines Molecular biology drives Innovation Antigen Gene of Interest Recombination RECOMBINANT VACCINES Live or Killed Antigens and Vaccines Molecular biology drives Innovation Antigen Gene
Minimal molecular constraints for respiratory droplet transmission of an avian human H9N2 influenza A virus
Minimal molecular constraints for respiratory droplet transmission of an avian human H9N2 influenza A virus Erin M. Sorrell 1, Hongquan Wan 1,2, Yonas Araya, Haichen Song 3, and Daniel R. Perez 4 Department